Joensuu_J.J

7/31/2019 Joensuu_J.J

1/8

Vaccine 24 (2006) 23872394

F4 (K88) fimbrial adhesin FaeG expressed in alfalfa reduces F4+enterotoxigenic Escherichia coli excretion in weaned piglets

J.J. Joensuu a,, F. Verdonckb, A. Ehrstrom c, M. Peltola a, H. Siljander-Rasi e,A.M. Nuutila d, K.-M. Oksman-Caldentey d, T.H. Teeri a, E. Cox b,

B.M. Goddeeris b, V. Niklander-Teeri a

a Department of Applied Biology, P.O. Box 27, FIN-00014 University of Helsinki, Finlandb Laboratory of Veterinary Immunology, Faculty of Veterinary Medicine, Gent University, BE-9820 Merelbeke, Belgium

c Department of Animal Science, P.O. Box 28, FIN-0 0014 University of Helsinki, Finlandd VTT Biotechnology, P.O. Box 1500, FIN-02044 VTT, Finland

e MTT Agrifood Research Finland, Swine Research, Tervamaentie 179, FIN-05840 Hyvinka a, Finland

Received 19 May 2005; received in revised form 21 November 2005; accepted 24 November 2005

Available online 9 December 2005

Abstract

Transgenic plants are attractive bioreactors to large-scale production of recombinant proteins because of their relatively low cost. This

study reports for the first time the use of transgenic plants to reduce enterotoxigenic Escherichia coli (ETEC) excretion in its natural host

species. The DNA sequence encoding the major subunit and adhesin FaeG of F4+ ETEC was transformed into edible alfalfa plants. Targeting

of FaeG production to chloroplasts led to FaeG levels of up to 1% of the total soluble protein fraction of the transgenic alfalfa. Recombinant

plant-produced FaeG (pFaeG) remained stable for 2 years when the plant material was dried and stored at room temperature. Intragastric

immunization of piglets with pFaeG induced a weak F4-specific humoral response. Co-administration of pFaeG and the mucosal adjuvant

cholera toxin (CT) enhanced the immune response against FaeG, reflected a better induction of an F4-specific immune response. In addition,the intragastric co-administration of CT with pFaeG significantly reduced F4+ E. coli excretion following F4+ ETEC challenge as compared

with pigs that had received nontransgenic plant material. In conclusion, transgenic plants producing the FaeG subunit protein could be used

for production and delivery of oral vaccines against F4+ ETEC infections.

2005 Elsevier Ltd. All rights reserved.

Keywords: F4 (K88) fimbriae; Enterotoxigenic Escherichia coli; Plant-made vaccine; Alfalfa; Chloroplast targeting; Piglet

1. Introduction

Diarrhea caused by F4+ enterotoxigenic Escherichia coli

(ETEC) is a common problem among neonatal and newlyweaned piglets. ETEC infections result in severe economic

losses due to mortality and reduced growth rates. F4 fimbriae

are long proteinaceous appendages radiating from the surface

of F4+ ETEC, with a length of 0.11 m and a diameter of

2.1 nm.They arecomposedof hundreds of identicalrepeating

protein subunits, called FaeG, as well as some minor subunits

Corresponding author. Tel.: +358 9 191 58 451; fax: +358 9 191 58 434.

E-mail address: [email protected] (J.J. Joensuu).

[1,2]. The major F4 fimbrial subunit, FaeG, is also the adhe-

sive subunit, allowing these bacteria to adhere to F4-specific

receptors (F4R) on small intestinal enterocytes [3], which

results in colonization, toxin production and subsequent diar-rhea. To prevent ETEC infections in suckling piglets, sows

canbe vaccinated parenterally with F4 fimbriae, with the pro-

tective IgA antibodies then being transmitted via colostrum

and milk to suckling piglets [4]. Parenteral vaccination is not

efficient in preventing post-weaning diarrhea in piglets no

longer protected by passive lactogenicimmunitysince it stim-

ulates a systemic rather than intestinal F4-specific immune

response [57]. Oral vaccination of piglets with purified F4

fimbriae or the recombinantly produced F4 fimbrial adhesin

0264-410X/$ see front matter 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.vaccine.2005.11.056


2/8

2388 J.J. Joensuu et al. / Vaccine 24 (2006) 23872394

FaeG, by contrast, has been reported to induce an F4-specific

mucosal immune response [810].

Vaccines are typically composed of killed or attenuated

disease-causing organisms. Recombinant subunit vaccines

offer a desirable alternative, with potentially fewer side-

effects than delivering the whole organism. Recombinant

subunit vaccines do not contain an infectious agent, thusbeing safer to administer and prepare. Subunit vaccines are

mostly produced in genetically engineered bacteria, yeast, or

mammalian cells. However, plant-produced subunit vaccines

would be safer than the classically used recombinant pro-

duction systems since contamination risk with mammalian

pathogens is significantly reduced. Transgenic plants would

also function as low-cost, efficient, and practical oral vaccine

delivery vehicles to stimulate mucosal immunity (for review,

see [11]).

Expression of recombinant FaeG has recently been

reported in tobacco chloroplasts [12] and tobacco cytosol

[13]. Moreover, recombinant FaeG produced in chloroplasts

of tobacco was able to bind the F4 receptor present on porcinevillous enterocytes [12], which is necessary to induce an

F4-specific immune response following oral immunization

[9,14]. Tobacco has many advantages as a laboratory model

plant, including high transformation efficiency and easy cell

culture protocols. However, unlike crop plants, tobacco can-

not be used as a delivery vehicle for oral vaccines since

it contains high amounts of toxic secondary metabolites.

Alfalfa is a good candidate species for edible plant vac-

cine production. It can be cultivated in variety of different

climates and is commonly used as an additive to improve

the quality of feed. Furthermore it can be easily processed

with techniques that do not disturb the properties of foreignproteins.

In this study, the F4 fimbrial adhesin FaeG was trans-

formed into the crop plant alfalfa and used to immunize

weaned piglets intragastrically. We then determined whether

an F4-specific immune response was induced that could

reduce the excretion of F4+ E. coli following an F4+ ETEC

challenge.

2. Materials and methods

2.1.1. Plant material

To express FaeG adhesin in the chloroplast of alfalfa

(Medicago sativa L.), the PCR product (the primers:

CAAGGATCCTGGATGACTGGTGATTTC, CCATCTA-

GATCAGTAATAAGTTATTGCTAC) of FaeG-encoding

DNA sequence from the ETEC 5/95 strain (serotype

O149:F4ac, LT+, ST-B+) was cloned under the Cauliflower

Mosaic Virus 35S RNA promoter and linked to the chloro-

plast transit peptide (TP)-encoding sequence of the pea

rubisco small subunit gene ss3.6 [15]. The resulting gene

construct [12] was conjugated into Agrobacterium tume-

faciens strain C58C1RifR [16] that contained the modified

Ti-plasmid pGV2260 [17], using triparental mating [18].

Alfalfa hybrid Regen-SY [19] leaf explants were dipped for

5 min in 18 h grown Agrobacterium culture. For formation

of callus the explants were cultivated in dim light at 23 C on

a SH based callus induction medium [20,21]. For induction

of somatic embryogenesis, the callus was further cultivated

on SH media [22] supplemented with 10 mM NH4NO3 and30 mM proline. Root formation was induced on SH media

supplemented with 0.29 mM GA3. Rooted seedlings were

transplanted into pots containing a mixture of peat and

vermiculite.

The transformation and the transgene copy number

of alfalfa T0-plantlets from five separate transgenic lines

(60.1, 60.2, 60.3, 60.4, and 60.5) were confirmed by DNA

hybridization analysis. Total DNA was prepared from the

leaves as described by [23]. Ten micrograms of HindIII-

digested DNA were separated on a 1% agarose gel and trans-

ferred to a nylon membrane (Hybond-N+, Amersham Bio-

sciences, Espoo, Finland) according to [24]. The probe was

prepared from the faeG-PCR fragment by labeling the frag-ment with a RediprimeTM II random prime labeling system

kit (Amersham Biosciences, Espoo, Finland) and [32P]dCTP.

The probe was purified from unincorporated nucleotides

with a NickTM Column (Amersham Biosciences, Espoo,

Finland). Hybridization was performed overnight at 42 C

usingthe ULTRAhybTM hybridization buffer (Ambion, Cam-

bridgeshire, UK). The membrane was washed twice for

20min at 65 C with 2 SSC (0.3M NaCl, 0.3 M Na-

citrate, pH 7.0) supplemented with 0.1% SDS, three times

with 0.2 SSC-0.1% SDS, and once with 0.1 SSC-0.1%

SDS. Membranes were incubated with the phosphoimager

plate (Imaging plate BAS-MP 2040S, Fujifilm) for 23 h, andscanned with a phosphoimager (BAS-1500, Fujifilm, Japan).

The level of FaeG accumulation in the transgenic plant lines

was analyzed by densitometry on immunoblots as described

by [12].

T0-plants from two high-yield transgenic lines (60.1 and

60.3) with a single copy of transgene were vegetatively prop-

agated by cuttings in mixture of peat and vermiculite and

grown in a greenhouse (18 C, 16/8 h light period, 60% rel-

ative humidity), with the green tissues being harvested at

2-week intervals. The plant material obtained was dried in an

oven at 37 C to 10% humidity, wrapped in plastic, and stored

at room temperature. To perform the immunization experi-

ment, the dried transgenic alfalfa (1:1 mixture of lines 60.1

and 60.3), as well as control alfalfa was pulverized by using

an experimental mill (KT-30, Koneteollisuus Oy, Helsinki,

Finland) with a 0.8-mm sieve.

Soluble proteins from dry transgenic plant powder were

extracted by adding 15 volume (w/v) extraction buffer

containing 0.2 M HEPES-KOH (pH 7.0), 20 mM DTT, and

a Complete Mini protease inhibitor cocktail mix (Roche,

Espoo, Finland), and homogenized with a mortar and pes-

tle on ice. The homogenate was centrifuged for 10 min at

4 C at 14,000 g, the recovered supernatant represented

the total soluble proteins (TSP). The total soluble protein


3/8

J.J. Joensuu et al. / Vaccine 24 (2006) 238 72394 2389

concentration of the supernatant was determined by Bradford

dye binding with a Bio-Rad protein assay kit (Bio-Rad Labo-

ratories, Espoo, Finland) using bovine serum albumin (BSA)

as a standard. The amount of FaeG in the TSP was analyzed

on immunoblots with densitometry analysis as described in

[12].

2.2. Purification of F4 fimbriae

F4 fimbriae were purified as described by Van den Broeck

et al. [14]. The purity of the purified F4 fimbriae was

assessed using a Coomassie-stained 10% SDS-PAGE and a

Bio-Rad ChemiDocTM station equipped with Quantity One

software (Bio-Rad Laboratories, Espoo, Finland). The pro-

tein concentration of purified F4 fimbriae was determined

using bicinchoninic acid reaction, with BSA as a standard

(SigmaAldrich, Helsinki, Finland), taking into account the

purity of the purified F4 fimbriae.

2.3. Bacterial inoculum

Bacteria of F4+ ETEC strain 5/95 (serotype O149:F4ac,

LT+, ST-B+) were collected from an overnight culture in

Tryptone Soya Broth (Scharlau Chemie, Barcelona, Spain),

as described elsewhere [9]. The concentration of the bacte-

ria was determined by measuring the optical density (OD) of

10-fold dilutions of the bacterial suspension at 660 nm. Bac-

terial suspension at 660 nm with an OD660 of 1 equalling

109 viable bacteria/ml, as determined by counting colony-

forming units.

2.4. Animal trial

2.4.1. Animals

Nineteen F4R+ and F4-seronegative conventionally bred

pigs (Finnish LandraceYorkshire) from three different lit-

ters were used. Pigs were managed according to legislation

documented within the Finnish Animal Welfare Act (247/96),

the Order of using vertebrate animals for scientific purposes

(1076/85), and the European convention for the protection

of vertebrate animals used for experimental and scientific

purposes. The piglets were weaned at the age of 4 weeks,

randomized into four groups and housed in an isolation unit

where they receivedwater andstandard pigletfood ad libitum.

The piglets were treated orally with OriprimTM (125 mg/kg

of body weight, Orion Pharma, Espoo, Finland) from 2 days

before till 3 days after the weaning to prevent E. coli infec-

tions due to transport and handling.

2.4.2. Immunizations

At 1 week post-weaning, the piglets were intragastri-

cally immunized. The first group (C, n = 4) received 30 g

of dried and pulverized nontransgenic plant material and

served as a negative control. The second group (C + F4, n = 5)

received 2 mg of purified F4 fimbriae mixed with a similar

amount of nontransgenic plant material. This group served

as positive control since oral administration of 2 mg of puri-

fied F4 has been shown to protect F4R+ piglets against a

subsequent challenge with F4+ ETEC [9]. The third and

fourth groups were immunized with transgenic alfalfa. The

FaeG subunits produced in transgenic alfalfa plants appear

as monomers, whereas purified F4 fimbriae are multimers

(data not shown). Since polymeric antigens tend to stimu-late a higher immune response than monomeric forms [9], a

10-times higher amount of monomeric pFaeG (20 mg) than

F4 fimbriae (2 mg) was used to immunize the piglets. The

third group (pFaeG group, n = 5) was immunized with 30 g

of pulverized transgenic plant material containing 20 mg of

FaeG. The fourth group (pFaeG+ CT, n = 5) received the

same amount of transgenic plant material supplemented with

50g of cholera toxin (CT) (List Biological Laboratories,

Campbell, USA). The purified F4 fimbriae, CT, and the

plant material were dissolved in a final volume of 300 ml

water containing 0.28% (w/v) NaHCO3 for gastric pH neu-

tralization and administered intragastrically at 0, 1, 2, and

14 days post-primary immunization (dppi). Animals weredeprived of food and water 3 h before till 2 h after the

immunizations.

One week after the booster immunization (21 dppi), the

animals were orally challenged with virulent F4+ ETEC

strain 5/95, as previously described by [25], with minor mod-

ifications. Briefly, pigs were orally pre-treated at 1518 dppi

with OriprimTM (125 mg/kg of body weight, Orion Pharma,

Espoo, Finland) to decrease colonization resistance. At

21 dppi, pigs were sedated with azaperon (StresnilTM,

Janssen-Cilag, Espoo, Finland, 1 mg/kg body weight), after

which gastric pH was neutralized with intragastric adminis-

tration of 60ml of 0.17M NaHCO3. Fifteen to thirty minuteslater, 1010 F4+ ETEC in 20 ml of PBS were given intragas-

trically.

2.4.3. Sample collection

Blood was collected from the jugular vein on 0, 7,

14, 21, 25, 28, and 35dppi to analyze F4- and CT-

specific serum antibodies. To determine the excretion of

F4+ ETEC, faecal samples were taken daily from chal-

lenge until 8 days post-challenge (29 dppi) and kept on ice

until the subsequent analysis. Two weeks after the challenge

(35 dppi), the pigs were euthanized, and jejunal villi were

isolated as described elsewhere [14] to confirm the presence

of F4R.

2.4.4. Assays

The presence of F4-specific IgA, IgG, and IgM in serum

was determined with ELISA as described by [8], with

one minor modification. Microtiter plates were directly

coated with purified F4 fimbriae derived from strain 5/95

(10g/ml in PBS). To detect CT-specific serum antibod-

ies, 96-well microtiter plates (NUNC Maxisorb, Roskilde,

Denmark) were coated with CT (5g/ml in PBS) and incu-

bated overnight at 4 C. The plates were blocked with dilu-

tion buffer (1% BSA in PBS). Series of 2-fold dilutions of


4/8


serum samples (in dilution buffer) starting from 1/10 were

added. Alkaline phosphatase-conjugated goat anti-pig anti-

serum (Bethyl laboratories, Montgomery, USA) was used

as a secondary antibody (1/3000 in dilution buffer). Plates

were incubated for 1 h at room temperature between the

steps described above. Three washings with PBS were done

between every step, except after the blocking. p-Nitrophenylphosphate was used as a substrate, and OD455 was spec-

trophotometrically determined. The cut-off value was calcu-

lated as mean OD455 value of all sera at day 0, increased

by three-times the standard deviation. The antibody titer was

the inverse of the highest dilution that still had an OD455

higher that the cut-off value (0.603). To analyze excretion

following F4+ ETEC challenge, F4 E. coli were enumer-

ated in faecal samples by dot blotting using the F4-specific

MAb (CVI-F4ac-5, CIDC-Lelystad, Lelystad, the Nether-

lands), as previously described by [8], with minor modifi-

cations. The bacterial colonies were blotted on nitrocellulose

membrane and detected with anti-mouse IgG AP conjugate

(Promega,Madison, USA) using chromogenic detection withNBT/BCIP (Promega). The resulting dots were counted and

the average for each group was calculated. The presence of

F4R was analyzed by an in vitro villous adhesion assay as

described by [14].

2.5. Statistical analysis

Statistical analysis (SPSS 12.0 for Windows) of serum

antibody titers and F4 E. coli excretion was performed using

a General Linear Model (repeated measures analysis of vari-

ance), adjusting for multiple comparisons by Bonferoni. Dif-

ferences in fecal scores between groups were analyzed forstatistical significance using the MannWhitney U-test.

3. Results

3.1. Alfalfa plants expressing FaeG

To examine whether orally delivered FaeG expressed in

plants is able to provide protection against F4 ETEC diarrhea

in weaned piglets, the crop plant alfalfa was transformed with

a FaeG-encoding construct. In fiveT0-transgenic alfalfa lines,

DNA hybridization experiments of genomic DNA revealed

unique integration patterns with 13 copies of the faeG

transgene (Fig. 1A). Accumulation of plant-produced FaeG

(pFaeG) in these T0-plants was confirmed by immunoblot-

ting and was not significantly affected by the copy number

of the transgene (Fig. 1B). Lines 60.1 and 60.3 with a single

copy of the transgene were subjected for further analysis and

the proportion of pFaeG in the fresh plant tissue was up to 1%

ofTSP(Fig.2). No degradation of pFaeG was observed when

the transgenic plant material was dried, or after a 2-year stor-

ageperiod at room temperature (Fig.2). By self pollination of

T0-plants, the transgene was inherited to T1-generation with

the similar expression level (data not shown). These results

Fig. 1. Analysis of five alfalfa T0-plants transformed with gene encoding

FaeG protein. (A) DNA hybridization analysis showing the copy number of

transgene. 60.1, 60.2, 60.3, 60.4, and 60.5 are the transgenic alfalfa plants

and C is the nontransgenic alfalfa. Ten micrograms of DNA was loaded for

lanes 16. DNA size in kb. (B) Immunoblot analysis of FaeG expression.

Total of 20g of TSP was loaded for lanes 16. Molecular mass in kDa.

confirm that alfalfa can be used as a high-yield expression

and storage vehicle for foreign proteins.

3.2. Intragastric immunization of newly weaned piglets

with pFaeG induces a slight systemic F4-specific

immune response

To analyze whether pFaeG could be used as a sub-

unit vaccine, transgenic plant material (60.1 and 60.3)

was vegetatively multiplied under greenhouse conditions

and used to immunize weaned piglets. Following the first

intragastric immunization of newly weaned piglets (0, 1,

and 2 dppi), only a very low F4-specific IgM titer was

observed in the positive control group immunized with puri-

fied F4 fimbriae (C + F4 group; mean titer 17) at 7 dppi

(Fig. 3). The booster immunization induced a weak sec-

ondary F4-specific systemic immune response in the C + F4

group, with the F4-specific IgM antibody titer decreas-

ing and the IgA and IgG titers increasing 1 week follow-

ing the boost. Intragastric immunization with pFaeG also

induced an F4-specific immune response; low F4-specific

IgG titers were detected in the pFaeG at 21 dppi. Induction

was improved when pFaeG was co-administered with CT as

a mucosal adjuvant (pFaeG + CT group). These data indicate

that intragastric immunization of newly weaned piglets with

pFaeG does activate a weak systemic F4-specific immune

response.


5/8

J.J. Joensuu et al. / Vaccine 24 (2006) 238 72394 2391

Fig. 2. Immunoblot analysis of FaeG expression in transgenic alfalfa. Lanes

12, 0.1 and 0.5g of purified F4 fimbriae; lanes 3 and 4, total soluble

protein (TSP) from fresh tissue of T0 transgenic plants 60.1 and 60.3; lane

5, TSP from fresh nontransgenic plant; lane 6, TSP from dried transgenic

plant material (1:1 mixture of 60.1 and 60.3 plants) after 2 years of storage.

A total of 20g of TSP was loaded for lanes 36. Molecular mass in kDa.

3.3. Intragastric immunization of weaned piglets with

pFaeG reduces F4+ E. coli excretion following F4+

ETEC challenge

To determine whether intragastric immunization of newly

weaned piglets with pFaeG also induces a mucosal F4-

specific immune response, the piglets were challenged with

pathogenic F4+ ETEC strain 5/95, and fecal excretion of F4+

E. coli was analyzed daily (Fig. 4). Animals in the negative

control group (C), which received nontransgenic plant mate-

rial, excreted F4+E. coli till 7 days post-challenge (dpc), with

maximal numbers being around 106 F4+ E. coli per gram

feces. Oral immunization with pFaeG reduced the excre-

tion of F4+ E. coli slightly following challenge but did not

shorten excretion time. Co-administration of pFaeG and CT

did, however, significantly reduce the number of excreted

F4+ E. coli (2 and 4 dpc; p = 0.041 and 0.062) as well as

the excretion time, as compared with the negative control

group (6 dpc; p = 0.002). Indeed, F4+ E. coli excretion in the

pFaeG + CT group is identical to that in the positive control

group (C + F4). These results indicate that intragastric immu-

nization of piglets with pFaeG induces a mucosal F4-specific

immune response. The induction of a mucosal F4-specific

Fig.3. MeanF4-specificIgM, IgA,and IgGserum antibodytiters (S.E.M.)

at 0, 7, 14, 21, 25, 28, and 35 days post-primary immunization (dppi)

of piglets intragastrically immunized with F4 fimbriae mixed with non-transgenic alfalfa (C + F4, n = 5), nontransgenic alfalfa (C, n = 4), transgenic

alfalfa expressing the F4 fimbrial adhesin FaeG (pFaeG, n = 5),or transgenic

alfalfa supplemented with cholera toxin (pFaeG+ CT, n = 5). A significant

(*p < 0.1 or **p < 0.05) difference was found between C + F4 and C (a),

C + F4 and pFaeG (b), C and pFaeG (d), C and pFaeG + CT (e), and pFaeG

and pFaeG+ CT (f). Black arrow represents immunization and white arrow

the F4+ ETEC challenge.

immune response is improved by co-administration of pFaeG

and CT, which results in a significant reduction of F4+ E.

coli excretion following F4+ ETEC challenge. While CT

supplementation also results in the induction of CT-specific

antibodies, at the moment of challenge (21 dppi), the CT-

specific antibody titer in serum of the supplemented group

(mean titer of 14) was not significantly higher than in the C

and pFaeG groups (mean titer of 10). CT-specific antibod-

ies may affect LT-induced diarrhea but will not reduce F4+

ETEC colonization [10,26]. However, no significant differ-

ences in diarrhea scores were observed between the groups

(Table 1).

The F4-specific serum antibody titers following F4+

ETEC challenge are in agreement with the results of F4+

E. coli excretion (Figs. 3 and 4). Infection of the negative

control group (C) induced a primary F4-specific antibody

response characterized by high F4-specific IgM titers during


6/8


Fig. 4. Mean F4+Escherichia coli excretion pergram feces (S.E.M.) after

oral ETEC challenge. Piglets were intragastrically immunized with F4 fim-

briae mixed with nontransgenic alfalfa (C + F4, n = 5), nontransgenic alfalfa

(C, n = 4), transgenic alfalfa expressingthe F4 fimbrialadhesinFaeG (pFaeG,

n = 5), or transgenic alfalfa supplemented with cholera toxin (pFaeG+ CT,

n = 5). A significant (*p < 0.1 or **p < 0.05) difference was present between

C + F4 and C (a), C + F4 and pFaeG (b), C and pFaeG+ CT (e), and pFaeG

and pFaeG+ CT (f).

the first week following challenge (significantly higher in

the C group than in the pFaeG + CT group, p = 0.057) and

the subsequent appearance of F4-specific IgA and IgG anti-

bodies. A similar F4-specific IgM response was observed

in the pFaeG group. This is not surprisingly since the F4+

E. coli excretion was only a bit lower in this group than

in the negative control group. However, the faster appear-

ance and higher amounts of F4-specific IgA antibodies in the

pFaeG group suggest a priming of the immune system fol-

lowing pFaeG immunization. On the other hand, the presence

of protective F4-specific mucosal antibodies at the moment

of challenge will reduce bacterial proliferation and result in

Table 1

Daily fecal score for each animal in the different treatment groups

Group Fecal scorea

Pig 2dpcb 3dpc 4dpc 5dpc 6dpc 7dpc 8dpc

C + F4 1 1 1 0 0 1 0 0

2 1 1 0 1 0 0 0

3 1 1 1 0 0 0 0

4 1 1 1 0 1 0 0

5 1 2 1 1 0 0 0

C 1 1 2 3 1 0 0 0

2 1 0 0 0 0 0 0

3 1 1 1 1 1 0 0

4 2 2 2 1 1 0 0

pFaeG 1 1 1 1 0 0 0 0

2 0 1 1 0 0 0 0

3 1 0 1 0 0 0 0

4 3 2 3 2 1 1 0

5 1 0 0 0 0 0 0

pFaeG + CT 1 1 1 1 1 0 0 0

2 1 1 0 1 0 0 0

3 1 1 1 1 1 0 0

4 1 0 1 0 0 0 0

5 0 0 0 0 0 0 0

a Fecal score: 0, normal; 1, pasty; 2, semi-liquid; 3, watery.b Days post-challenge with F4+ ETEC.

reduced stimulationof the immune system. Indeed, the lowest

F4-specific serum antibody titers following challenge were

observed in the pFaeG + CT group. These results confirm the

ability of plant-produced FaeG to induce a protective F4-

specific immune response.

4. Discussion

ETEC are an important cause of intestinal infections in

animals and humans [26]. Induction of a protective mucosal

immune response against at least one of ETEC virulence fac-

tors (fimbriae and toxins) would be the first step towards

the development of an effective vaccine. Oral vaccination of

piglets with purified F4 fimbriae or its adhesin FaeG has been

reported to induce a protective F4-specific mucosal immune

response against subsequent F4+ ETEC infection [8,9]. An

effective delivery system is, however, needed to produce a

vaccine. Since the introduction of the concept of transgenic

plants as an alternative production and delivery system forsubunit vaccines [27], several E. coli fimbrial antigens have

been expressed in transgenic plants including BfpA [28], F4

(K88) [12,13] CFA/I [29] and F5 (K99) [30]. In these stud-

ies fimbriae-specific antibodies were induced in mice after

oral [28,29] or parenteral [13,30] administration. However,

to our knowledge, this is the first study reporting the use of

transgenic plants to reduce ETEC excretion in its natural host

species.

In this study, theF4 fimbrial adhesin FaeG was produced in

the edible plant alfalfa (pFaeG). The high-level expression of

pFaeG (1% of TSP) obtained in the chloroplasts of alfalfa

is identical to the pFaeG amount obtained in the chloro-plasts of tobacco [12]. Targeting of pFaeG to the cytosol

of tobacco is less efficient since the pFaeG level has only

reached 0.15% of TSP[13]. Takentogether, these results con-

firm that chloroplasts, by offering a compartment where large

amounts of foreign protein can accumulate without disturbing

the growth and metabolism of the cell, are excellent candi-

dates for high-level expression of foreign proteins in plant

cells, [31]. Chloroplasts also offer a suitable environment for

correct protein folding of eukaryoticproteins [31,32]. Indeed,

chloroplast-produced pFaeG is able to bind to the F4 receptor

[12].

Binding of FaeG to the F4R on small intestinal ente-

rocytes is a prerequisite for induction of an F4-specific

mucosal immune response following oral immunization [8].

The results of this study show that oral immunization of

piglets with pFaeG wasable to inducean F4-specific mucosal

immune response. This induction was rather weak since no

clear F4-specific antibodies were detected in serum 1 week

following the booster immunisation, but nevertheless able to

result in a limited reduction of F4+ E. coli excretion follow-

ing F4+ ETEC challenge. However, the efficacy of pFaeG is

lower than the bacterial produced recombinant FaeG (rFaeG)

described by Verdonck et al. [9,10]. This may perhaps be

explained by differences in FaeG sequence between the 5/95


7/8

J.J. Joensuu et al. / Vaccine 24 (2006) 23872394 2393

F4+ ETEC strain (used in pFaeG) and that of the GIS26

F4+ ETEC strain (used in rFaeG) [33]. Indeed, a higher F4-

specific immune response has been observed following oral

immunization with GIS26 F4 purified fimbriae [8] than with

5/95 purified fimbriae (this study), which is likely related

to a difference in FaeG polymerization and subunit folding

between these strains [33]. Furthermore, the resident plantmaterial may have a protective effect and even prevent some

antigen degradation in the digestive tract [34,35]. Whether

the plant material has a stimulating or a reducing effect on

the induction of an F4-specific mucosal immune response

following oral pFaeG immunization is unknown.

Oral co-administration of pFaeG and the mucosal adju-

vant CT resulted in a significant reduction of F4+ E. coli

excretion, similar to that obtained with purified 5/95 F4

immunization. The adjuvant effect of CT in pigs is reported

to be better towards antigens targeted to the mucosal epithe-

lium than towards nonmucosa-binding antigens [36,37]. This

suggests that further improvement of pFaeG targeting to the

F4R on enterocytes would lead to a better induction of F4-specific mucosal immune response. The polymeric appear-

ance of FaeG subunits in purified F4 fimbriae may enable

a higher avidity of binding to the F4R, as compared with

FaeG monomers. On the other hand, multimeric structures

are known to be more immunogenic than monomers [38].

Further research is needed to determine whether FaeG poly-

mers could be efficiently produced by plants.

Plant-produced vaccines do show promise in future vac-

cine development. In the United States, six clinical human

trials with vaccine antigen-producing plants have been tested

so far [35,39,40]. In the European Union, the development

of vaccine plants is receiving considerable funding: the SixthFramework Program (20022006) has awarded a 12 million

euro research grant to the Pharma-Planta research consor-

tium to aid in the investigation and development of vaccine

antigen-producing plants for medical purposes.

The ability of alfalfa-produced pFaeG to reduce F4+ E.

coli excretion following oral immunization of weaned piglets

is encouraging for future vaccine development since large

amounts of pFaeG, which remain stable over prolonged stor-

age, can be produced. This study is an important proof of

principle demonstrating the potential of plant-based vaccines

against animal ETEC infections.

Acknowledgments

This research was supported by the Academy of Finland

(62958), TEKES (40127/99, 40876/00 and 40268/03), the

University of Helsinki (974/62/98), Raisio Feed Ltd., and

FWO (grant, F. Verdonck). J. Joensuu is a PhD student at

a Viikki Graduate School in Biosciences. Dr. E.T. Bing-

ham from the University of Wisconsin-Madison is acknowl-

edged for providing Regen-SY seeds. Mrs. Lilia Sarelainen

and Mr. Tapio Helenius are thanked for excellent technical

assistance.

References

[1] Bakker D, Willemsen PTJ, Simons LH, van Zijderveld FG, de

Graaf FK. Characterization of the antigenic and adhesive proper-

ties of FaeG, the major subunit of K88 fimbriae. Mol Microbiol

1992;6(2):24755.

[2] Van den Broeck W, Cox E, Oudega B, Goddeeris BM. The F4

fimbrial antigen of Escherichia coli and its receptors. Vet Microbiol2000;71(34):22344.

[3] Jones GW, Rutter JM. Role of the K88 antigen in the pathogenesis

of neonatal diarrhea daused by Escherichia coli in piglets. Infect

Immun 1972;6:91827.

[4] Rutter JM, Jones GW. Protection against enteric disease caused by

Escherichia coli-a model for vaccination with a virulence determi-

nant. Nature 1973;242(5399):5312.

[5] Moon HW, Bunn TO. Vaccines for preventing enterotoxi-

genic Escherichia coli infections in farm animals. Vaccine

1993;11(2):21320.

[6] Bianchi ATJ, Scholten J, Van Zijderveld AM, Van Zijderveld FG,

Bokhout BA. Parenteral vaccination of mice and piglets with F4

super(+) Escherichia coli suppresses the enteric anti-F4 response

upon oral infection. Vaccine 1996;14(3):199206.

[7] Van der Stede Y, Cox E, Verdonck F, Vancaeneghem S, GoddeerisBM. Reduced faecal excretion of F4 super(+)-E. coli by the intra-

muscular immunisation of suckling piglets by the addition of 1 alpha,

2,5-dihydroxyvitamin D sub(3) or CpG-oligodeoxynucleotides. Vac-

cine 2003;21(910):102332.

[8] Van den Broeck W, Cox E, Goddeeris BM. Receptor-dependent

immune responses in pigs after oral immunization with F4 fimbriae.

Infect Immun 1999;67(2):5206.

[9] Verdonck F, Cox E, Van der Stede Y, Goddeeris BM. Oral immuniza-

tion of piglets with recombinant F4 fimbrial adhesin FaeG monomers

induces a mucosal and systemic F4-specific immune response. Vac-

cine 2004;22(3132):42919.

[10] Verdonck F, Snoeck V, Goddeeris BM, Cox E. Cholera toxin

improves the F4(K88)-specific immune response following oral

immunization of pigs with recombinant FaeG. Vet Immunol

Immunopathol 2005;103(12):219.[11] Sala F, Rigano MM, Barbante A, Basso B, Walmsley AM,

Castiglione S. Vaccine antigen production in transgenic plants:

strategies, gene constructs and perspectives. Vaccine 2003;21(78):

8038.

[12] Joensuu JJ, Kotiaho M, Riipi T, Snoeck V, Palva ET, Teeri TH, et

al. Fimbrial subunit protein FaeG expressed in transgenic tobacco

inhibits the binding of F4ac enterotoxigenic Escherichia coli to

porcine enterocytes. Transgenic Res 2004;13(3):2958.

[13] Huang Y, Liang W, Pan A, Zhou Z, Huang C, Chen J, et al.

Production of FaeG, the major subunit of K88 fimbriae, in trans-

genic tobacco plants and its immunogenicity in mice. Infect Immun

2003;71(9):54369.

[14] Van den Broeck W, Cox E, Goddeeris BM. Receptor-specific binding

of purified F4 to isolated villi. Vet Microbiol 1999;68(34):255

63.[15] Cashmore AR. Nuclear genes encoding the small subunit of ribu-

lose 1,5 bisphosphate carboxylase stromal protein in chloroplasts. In:

Kosuge T, Meredith CP, Wilson CM, editors. Genetic engineering of

plants: an agricultural perspective. New York: Plenum Press; 1983.

p. 2938.

[16] van Larebeke N, Engler G, Holsters M, van den Elsacker S, Zaenen

I, Schilperoort RA, et al. Large plasmid in Agrobacterium tumefa-

ciens essential for crown gall-inducing ability. Nature 1974;252:169

70.

[17] Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, Van

Montagu M, et al. Efficient octopine Ti plasmid-derived vectors

for Agrobacterium-mediated gene transfer to plants. Nucl Acids Res

1985;13(13):477788.


8/8


[18] Van Haute E, Joos H, Maes M, Warren G, Van Montagu M, Schell

J. Intergeneric transfer and exchange recombination of restriction

fragments cloned in pBR322: a novel strategy for the reversed

genetics of the Ti plasmids of Agrobacterium tumefaciens. EMBO J

1983;2(3):4117.

[19] Bingham ET. Registration of alfalfa hybrid regen-SY germplasm

for tissue culture and transformation research. Crop Sci 1991;31:

1098.

[20] Shetty K, McKersie BD. Proline, thioproline and potassium mediated

stimulation of somatic embryogenesis in alfalfa (Medicago sativa L.).

Plant Sci 1993;88(88):18593.

[21] McKersie BD, Bowley SR, Jones KS. Winter survival of trans-

genic alfalfa overexpressing superoxide dismutase. Plant Physiol

1999;119(3):83948.

[22] Schenk RU, Hildebrandt AC. Medium and techniques for induction

and growth of monocotyledonous and dicotyledonous plant cell cul-

tures. Can J Bot 1972;50:199204.

[23] Stewart Jr CN, Via LE. A rapid CTAB DNA isolation technique use-

ful for RAPD fingerprinting and other PCR applications. BioTech-

niques 1993;14(5):74850.

[24] Sambrook J, Russel DW. Molecular cloning: a laboratory manual. 3rd

ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory

Press; 2001.[25] Cox E, Schrauwen E, Cools V, Houvenaghel A. Experimental

induction of diarrhoea in newly-weaned piglets. J Vet Med A

1991;38(6):41826.

[26] Nataro JP, Kaper JB. Diarrheagenic Escherichia coli. Clin Microbiol

Rev 1998;11(1):142201.

[27] Mason HS, Lam DMK, Arntzen CJ. Expression of hepatitis B

surface antigen in transgenic plants. Proc Natl Acad Sci USA

1992;89(24):117459.

[28] Vieira da Silva J, Garcia AB, Vieira Flores VM, Sousa de

Macedo Z, Medina-Acosta E. Phytosecretion of enteropathogenic

Escherichia coli pilin subunit A in transgenic tobacco and its

suitability for early life vaccinology. Vaccine 2002;20(16):2091

101.

[29] Lee JY, Yu J, Henderson D, Langridge WH. Plant-synthesized E. coli

CFA/I fimbrial protein protects Caco-2 cells from bacterial attach-

ment. Vaccine 2004;23(2):22231.

[30] Piller KJ, Clemente TE, Mu Jun S, Petty CC, Sato S, Pascual DW,

et al. Expression and immunogenicity of an Escherichia coli K99

fimbriae subunit antigen in soybean. Planta 2005;222(1):618.

[31] Daniell H, Chebolu S, Kumar S, Singleton M, Falconer R.

Chloroplast-derived vaccine antigens and other therapeutic proteins.

Vaccine 2005;23(15):177983.

[32] Daniell H, Lee S, Panchal T, Wiebe PO. Expression of native cholera

toxin B subunit gene and assembly as functional oligomers in trans-

genic tobacco chloroplansts. J Mol Biol 2001;311(5):10019.

[33] Verdonck F, Cox E, Schepers E, Imberechts H, Joensuu J, Goddeeris

BM. Conserved regions in the sequence of the F4 (K88) fimbrial

adhesin FaeG suggest a donor strand mechanism in F4 assembly.

Vet Microbiol 2004;102(34):21525.

[34] Tacket CO, Mason HS. A review of oral vaccination with transgenic

vegetables. Microbes Infect 1999;1(10):77783.

[35] Tacket CO. Plant-derived vaccines against diarrheal diseases. Vaccine

2005;23(15):18669.

[36] Foss DL, Murtaugh MP. Mucosal immunogenicity and adjuvanticity

of cholera toxin in swine. Vaccine 1999;17(78):788801.

[37] Verdonck F, De Hauwere V, Bouckaert J, Goddeeris BM, CoxE. Fimbriae of enterotoxigenic Escherichia coli function as a

mucosal carrier for a coupled heterologous antigen. J Control Release

2005;104(2):24358.

[38] Miller J, Williamson ED, Lakey JH, Pearce MJ, Jones SM, Titball

RW. Macromolecular organisation of recombinant Yersinia pestis

F1 antigen and the effect of structure on immunogenicity. FEMS

Immunol Med Microbiol 1998;21(3):21321.

[39] Twyman RM, Schillberg S, Fischer R. Transgenic plants in

the biopharmaceutical market. Expert Opin Emerging Drugs

2005;10(1):185218.

[40] Ma JK-C, Barros E, Bock R, Christou P, Dale PJ, Dix PJ, et

al. Molecular farming for new drugs and vaccines. EMBO reports

2005;6(7):5939.

Joensuu_J.J

Documents

Transcript of Joensuu_J.J