DNA AND CELL BIOLOGYVolume 16, Number 8, 1997Mary Ann Liebert, Inc.Pp. 929-937

Identification of the Human a6 Integrin Gene Promoter

CHING-SHWUN LIN,1 YAOQI CHEN,1 TRUC HUYNH,1 and RANDALL KRAMER1 3

ABSTRACT

The o6 integrin subunit couples with either the fil or the (34 subunit to form a laminin receptor. «6 expres-sion is cell-type-specific and generally is present at high levels in epithelial and endothelial cells. To study itsgene regulation, we isolated a genomic clone containing the human «6 integrin gene promoter. It includes 3kb of the upstream flanking region, the first exon (385 bp), and 9 kb of the first intron. The a6 promoter di-rects transcription initiation from a primary site 202 nucleotides from the translation initiation codon. Un-like most other integrin gene promoters, the o6 promoter has a TATA box (GATAAA), which is located 22nucleotides upstream from the primary transcription initiation site. A 190-bp region upstream from the TATAbox is highly rich (78%) in C and G nucleotides and contains several Spl and AP2 binding sequences. How-ever, full promoter activity (in the presence of the SV40 enhancer) requires only 78 bp of this C/G-rich se-

quence upstream from the TATA box. Slightly upstream from the C/G-rich region are a steroid receptor bind-ing homolog and an epithelial-cell-specific E-pal sequence. Another possible epithelial cell-specific bindingsequence (Kerl) is found immediately downstream from the TATA box. Cell-type-specific activities of thepromoter paralleled the a6 mRNA levels in four tested cell lines. In the presence of the SV40 enhancer, «6promoter activity increased approximately four-fold in primary keratinocytes and in HT1080 fibrosarcomacells and 30-fold in T47D breast carcinoma cells, but remained undetectable in K562 leukemia cells. Genomicanalysis that compared a6-expressing with non-«6-expressing cells suggested that DNA methylation is not in-volved in the silencing of the o¡6 gene in a6-negative cells. DNase I footprint analysis confirmed the bindingof Spl and AP2 to their cognate sequences. A nuclear extract of high-a6-expressing HBL-100 cells also pro-duced significant binding to these sites, suggesting that the two transcription factors are probably involved inthe positive regulation of the a6 promoter.

IINTRODUCTION (Ruiz et al., 1993); and (iii) the homing of T cells to the thy-

mus is mediated by binding to adßl on the luminal surface ofNTEGRiNS are a suPERFAMiLY of aß heterodimeric cell-sur- vascular endothelium (Ruiz et al, 1995).face receptors that mediate cell-extracellular matrix (ECM) ad is expressed as a maternal protein in oocytes, long be-

and cell-cell adhesions (Ruoslahti, 1991; Hynes, 1992). The ad fore a functional laminin molecule is present (Hierck et al,subunit can couple with the ßl subunit to form a laminin re- 1983). In addition to its critical role in the fertilization of ova,

ceptor in a wide variety of tissues (Sonnenberg and Linders, adßl also serves important functions throughout the devel-1990) or with j84 to form a component of the hemidesmosome opment of the embryo. For example, adßl has been shown toin epithelial and endothelial cells (Stepp et al, 1990). Although mediate the laminin anchorage of the developing embryo tothe primary function of adßl and adßA is to mediate cell-ECM the trophectoderm (Hierck et al., 1993). The defined distrib-interactions, in three instances adßl has been shown to be ca- ution of ad as well as its co-localization with laminin on

pable of mediating cell-cell adhesion: (i) in ova, adßl serves somitic tissues suggest that ad is probably involved in somiteas a receptor for sperm (Almeida et al., 1995); (ii) melanoma differentiation (Pow and Hendrickx, 1995). In a6-null mice,cell binding to vascular endothelium is blocked by ad antibody several epithelial tissues undergo a blistering disease, result-

Departments of 'Stomatology and 2Anatomy and 3the Cardiovascular Research Institute, University of California, San Francisco, CA 94143-0512.

929

930 LIN ET AL.

ing in a lethal phenotype (E. Georges-Labouesse, personalcommunication).

Despite the apparent importance of ad in development andother biological processes, very little is known about the regu-lation of its expression in these processes. At present, only twosuch studies have been published. First, Defilippi et al (1994)showed that in human endothelial cells, ad is selectively anddramatically down-regulated at the mRNA level by tumornecrosis factor-a (TNF-a) and interleukin-1/3 (IL-1/3). Second,Hertle et al (1991) reported that during epidermal differentia-tion, ad expression is down-regulated in the suprabasal ker-atinocytes along with a number of other ßl integrins.

In either the normal biological processes or in disease (e.g.,tumor progression; for review, see Ziober et al, 1996), changesin ad expression are most likely regulated at the transcriptionlevel. Therefore, the isolation of the ad gene promoter shouldrepresent the first step in our effort to understand how the adgene is regulated. In this report, we present the structure andthe initial characterization of the human ad gene promoter. Wedemonstrate its cell-type-specific promoter activity and possi-ble regulation by epithelial cell-specific transcription factorsAP2, E-pal, and Kerl.

MATERIALS AND METHODS

Cell culture

Cultured human cell lines were from ATCC (Rockville, MD)and grown in fetal bovine serum (FBS)-supplemented DME (foradherent cells HT 1080, HBL-100, MCF-7, MDA-MB-231, andT47D) or RPMI (for suspension cells K562) medium. Primaryhuman keratinocytes were prepared from neonatal foreskins(obtained from the Well Baby Nursery of the University of Cal-ifornia, San Francisco) by a method originally developed byBoyce and Ham (1985) and modified by Zhang and Kramer(1996).

Cell transfectionImmortalized adherent cells (HT 1080 and T47D) were trans-

fected by the calcium phosphate precipitation method (Grahamand van der Eb, 1973). Primary keratinocytes were transfectedby the lipofectin method (Life Technologies Inc., Gaithersburg,MD). Suspension cells (K562) were transfected by electropo-ration using a Bio-Rad electroporator (Hercules, CA) with set-tings of 960 p¥ and 250 volts (for a 0.4-cm cuvette containing4 X 106 cells in 0.4 ml of serum-free RPMI).

Isolation of a.6 genomic clones

For the isolation of ad gene fragments, a human luekocyte-derived genomic library (Lin et al., 1993b) was screened witha 32P-labeled cDNA probe. The probe DNA was derived froma human ad cDNA plasmid (a gift from Dr. A. Sonnenberg,University of Amsterdam) and contained 29 bp of 5 ' untrans-lated region (UTR) and 198 bp of coding sequence. Approxi-mately 5 X 105 phage plaques were screened by standard pro-cedures. Positive clones were purified by three rounds ofhybridization with the probe, and their DNAs were analyzed byrestriction mapping, Southern blotting, and the polymerase

chain reaction (PCR). Genomic subfragments of a representa-tive clone (ag302) were released from the vector by Sal llHindIII digestion and cloned in pBluescript plasmid (Stratagene,Inc., San Diego, CA). The plasmids were then subjected to fur-ther restriction mapping, PCR, and DNA sequence analysis.

RNA isolation, DNA sequencing, andsequence analysis

Cellular RNAs were prepared by the guanidine isothio-cyanate method (Chirgwin et al., 1979). DNA sequencing was

performed by either the dideoxy chain-termination (Sanger et

al, 1977) or the chemical cleavage (Maxam and Gilbert, 1980)method. DNA sequencing data were managed and analyzed bythe MacVector computer program (Eastman Kodak Company,Rochester, NY).

SI mappingS1 mapping (Berk and Sharp, 1977) was used for the iden-

tification of transcription initiation sites and a modified proce-dure has been described previously (Lin et al, 1993a). A sin-gle-stranded probe for SI mapping was prepared by thefollowing procedures: (i) a 1-kb Pst I DNA fragment contain-ing the ad promoter and the first exon (Fig. 1 ) was cloned intoM13mpl8 phage vector, (ii) a synthetic primer with sequence(5'-CAGCCACCTTCGCCTCCTCT) corresponding to nu-

cleotides 39-58 of ad cDNA (Tamura et al, 1990) was labeledat the 5' end with 32P and used to initiate the synthesis of thecomplementary strand from the M13 DNA, (iii) the double-stranded M13 DNA was cut by Ksp I (Sac II) restriction en-

zyme at a site located in the promoter 200 bases upstream fromthe 3' end of the primer, and (iv) the DNA was electrophoresedin an alkaline denaturing gel to separate the labeled single-stranded DNA from the unlabeled DNA. In SI mapping ex-

periments, the single-stranded probe was annealed to 40 pg ofcellular RNAs overnight and then subjected to S1 nuclease di-gestion. The digestion products were separated in a sequencinggel and visualized by autoradiography.

CAT plasmid construction and CAT assaysRestriction and PCR fragments derived from genomic clone

ag302 were inserted in the pCAT-basic and pCAT-enhancerplasmids (Promega Inc., Madison, WI) and tested for promoteractivities by the (chloramphenicol acetyltransferase (CAT) re-

porter method (Gorman et al, 1982). The pCAT-basic plasmidlacks a regulatory element for the reporter CAT gene; there-fore, CAT expression is dependent on the transcriptional ac-

tivity of the inserted gene fragment. The pCAT-enhancer plas-mid is identical to the pCAT-basic plasmid, except that itcontains an SV40 enhancer located downstream from the CATgene; thus, pCAT-enhancer allows the identification of en-

hancer-dependent gene promoters. A human /3-actin pro-moter-CAT plasmid was used as a positive control and has beendescribed previously (Lin et al, 1993a). Ten micrograms ofeach CAT plasmid was transfected into cells along with 1 pgof a /3-galactosidase (/3-Gal) reporter plasmid. The /3-Gal re-

porter plasmid was used as a control for the normalization ofpotential differences in transfection efficiency with differentplasmid preparations. It uses the human ß-actin gene promoter

«6 INTEGRIN GENE PROMOTER 931

to drive the expression of the ß-Gal gene (Lin et al., 1993a).Between 48 and 72 hr after transfection, cells were harvestedand lysed by three rounds of freezing and thawing. After re-

moval of cell debris by centrifugation, the cell lysate was as-

sayed for protein concentration, and a sample (10-20 p\) con-

taining 10 pg of protein was used for CAT and ß-Gal assays.Nonradioactive methods for these two assays were performedwith commercial enzyme-linked immunosorbent assay (ELISA)kits (5 prime-3 prime, Inc., Boulder, CO).

DNase I footprint analysisTo identify possible regulatory elements in the promoter,

DNase I footprint analysis (Galas and Schmitz, 1978) was em-

ployed. Nuclear extracts were prepared from cultured cells bythe method of Dyer and Herzog (1995). A DNA probe was gen-erated by labeling at the 5' end of the Nru I restriction site (seeResults) with 32P. Approximately 1 ng of probe DNA was

mixed with 10 pg of nuclear protein or 1 footprint unit of a

transcription factor (i.e., Spl or AP2, both purchased fromPromega, Inc., Madison, WI) in the presence of 0.5 pg ofpoly(dl-dC) and 2% of polyvinyl alcohol in a reaction volumeof 10 pi. After incubation at room temperature for 15 min, 1p\ ( 1 unit) of DNase I was added to the probe/protein mixtureand incubated at room temperature for 1 min. The reaction was

stopped by the addition of 25 pi of stop solution (0.2 M NaCl,20 mM EDTA, 1% NaDodS04, 0.2 mg/ml tRNA), followed byphenol extraction and ethanol precipitation. The reaction prod-ucts were then electrophoresed in a 6% polyacrylamide-7 Murea sequencing gel along with a sequencing ladder producedby chemical cleavage at the A and G nucleotides of the probe(Maxam and Gilbert, 1980).

Genomic blot analysisBecause the ad gene promoter might be regulated by DNA

methylation, we examined the methylation state in the ad pro-moter of a6-expressing and nonexpressing cell lines. GenomicDNAs of cultured cells were isolated by the method of Lairdet al (1991). Approximately 10 pg of each DNA was digestedwith 60 units of each restriction enzyme for 16 hr. After phe-

nol-chloroform extraction and ethanol precipitation, the di-gested DNAs were electrophoresed in a 1.5% agarose gel andtransferred to Hybond nylon membrane (Amersham Life Sci-ences Inc., Arlington Heights, IL). The membrane was hy-bridized to a 32P-labeled ad promoter fragment (a 1-kb Pst Irestriction fragment; Fig. 1) and then processed by standard pro-cedures for autoradiography.

RESULTS

Isolation and sequence analysis of a.6 gene promoterUsing a 5'-end cDNA fragment as probe, three identical

clones containing 12 kb of the ad gene were obtained from a

human genomic library. A combination of restriction mapping,Southern blotting, PCR, and sequencing analyses establishedthat the 12-kb genomic fragment contained 3 kb of upstreamflanking region, the first exon (385 bp), and 9 kb of the firstintron (Fig. 1). Hind III restriction digestion of the 12-kb ge-nomic fragment produced six subfragments. The largest was 4.8kb long and contained the 3-kb upstream region, the first exon,and 1.8 kb of the first intron. This 4.8-kb fragment and its de-rivatives were used for all further analyses. As shown in Fig.2, a continuous 1,415-bp sequence, beginning at 1,218 bp up-stream from the translation initiation codon and ending with thefirst 14 nucleotides of the first intron, was determined fromthree of the Pst I subfragments (Fig. 1). Alignment of the se-

quence with the published ad cDNA sequence (Tamura et al.,1990) indicated that the first exon encodes the first 61 aminoacids of the pre-a6 chain and that the exon-intron junction se-

quence conforms with the consensus sequence. Comparisonwith the published ad cDNA also revealed two nucleotide dif-ferences in the 5'-UTR. One is an extra C nucleotide (betweenbases -141 and -143; Fig. 2), which is missing in the pub-lished cDNA sequence. Another is a T (base —2, Fig. 2) in-stead of a C in the cDNA sequence, located two nucleotides 5'to the translation initiation codon. Note that this latter changeabolishes the Nco I restriction site (CCATGG) surrounding thetranslation initiation codon.

H H HJ_l_

H

P

CpG island

1 1CN P P

I I I,T—ATGL

FIG. 1. Structure of the ad genomic ag302. The top line represents the ad genomic DNA (straight portion) between the twoÀ phage DNA arms (wavy portions). The bottom line is a more detailed map of the promoter region. The thickened segment rep-resents the first exon with the translation initiation codon indicated. The rightward arrow indicates the initiation site and the di-rection of transcription. The two downward arrows indicate the range of putative CpG island. Short vertical lines indicates re-striction sites (H, Hind III; S, 5a/1; P, Pst I; N, Nru I; C, Sac I).

932 LIN ET AL.

CTGCTACTGTAGTTTGTTGTCTACGTTCATAATGGCAAAACGTGCTAAATGTCAGAGGTTGGTGAAAATTAAGCGTAAATTTTTTCTCATCCAAGTTCACAGTACTCTTGAATTAATTACCTCTCCTCGGTTAAGAACCCCTGCAGGATAAGGTTGCCCCTAGGGCCAACACCTCACTGGAGCCCCGCCTCATGTCCTGGAGCAGGAGCCTTCATGCCACCTACACAGAACTCGGAGCTGTCTCTTGGCCCAGCAGTTCTCCCCACAACTAGTTCTGAAAGTCCGGGGCTAGGAAAGAACGGCATCGTCGCCTGAGCTCCTGGCGCCACTTTAAACAACCCATCCTTGACTTGCGTGACTTCTTCCACAAGCTCTCCTGGTCACCTGGGCAAAATCCTAGGTGATCTGGGGACAAGGCGGAACTTCGGTTTTCTGATCTGCAAAAAGAAACACCTACCTCATAGGACTGTTAGGATGAATTGAGGTAATGGCTGGGTTGTGTACATTATACAGCACTATCAAGGTGTGCGCTGTGATCATTTTTGAGGGTTGTTAGGTGTTTGAGGACCCAGAACAGTCTACACAGCTGTAGTCCCCAAGTGTTGGGCACGCCTTAAGCGCTCCATAAAC

-51B GCCATGAGGCCCGGTGCATCACCTGCACTTCTCTTTATAACGGGTAGTAAAGTCTCCCTCGCTCTGTGCT

-363 -310| AP2 AP2 AP2 |

-378 GGCTCCCACGTCnTnGCTTÇCGGGCAGGTACeGGGCAGCTGGAGACGCCAGAGCCGGCGGGTAAGGTGCG

-284Spl Spl

¡GCGCGCAAGGAGGGGÇqAGAGGGTGGGGAGGGGCGGGGCCGGCGTCCTCG

-233 -184I Kerl * Inr I NruI

-238 TCACTTQATAAAACGCCTGCGAGTCTCCAGAGAACAACGGGCTCATTCAGCGGTCGCGAGCTGCCGGCGA

-168 GGGGGAGCGGCCGGACGGAGAGCGCGACCCGTCCCGGGGGTGGGGCCGGGCGCAGCGGCGAGAGGAGGCG

-

9 8 AAGGTGGCTGCGGTAGCAGCAGCGCGGCAGCCTCGGACCCAGCCCGGAGCGCAGGGCGGCCGCTGCAGGT

-

2 8 CCCCGCTCCCCTCCCCGTGCGTCCGCTCAJE2GCCGCCGCCGGGCAGCTGTGCTTGCTCTACCTGTCGGCGMAAAGQLCLLYLSA

4 3 GGGCTCCTGTCCCGGCTCGGCGCAGCCTTCAACTTGGACACTCGGGAGGACAACGTGATCCGGAAATATGGLLSRLGAAFNLDTREDNVIRKYG

113 GAGACCCCGGGAGCCTCTTCGGCTTCTCGCTGGCCATGCACTGGCAACTGCAGCCCGAGGACAAGCGGCT

183 gtgagCtc

FIG. 2. Nucleotide sequence encompassing the human ad in-tegrin gene promoter. The sequence is numbered with nu-cleotide #1 corresponding to nucleotide A of the translation ini-tiation codon. Nucleotide #183 is the beginning of the firstintron. Two sequences that are different from the published adcDNA sequence are indicated by "cc" between bases —141 and—

143, and "c" at base —2. A consensus transcription initiatorsequence is labeled as Inr. The actual primary transcription ini-tiation site (see text) is indicated by (*). Sequences homologousto Spl, AP2, Kerl, E-pal (Myc), and SR motifs are underlined.The TATA box is in boldface letters. The numbers between theSac I and Nru I restriction sites indicate the ends of PCR-gen-erated promoter fragments (see text and Fig. 4).

Identification of transcription initiation site

To identify the transcription initiation site, we used the SImapping method. The 5'-end portion of the single-strandedDNA probe used in the experiment was complementary to the

5' end of ad mRNA. As shown in Fig. 3, RNAs prepared froma6-expressing HT1080 fibrosarcoma (Lin et al., 1993c) andHBL-100 breast epithelial cells (Hogervorst et al, 1991) par-tially protected the probe from SI nuclease digestion, whereasRNAs prepared from a6-negative K652 leukemia cells (Hoger-vorst et al., 1991) failed to protect the probe. The major probefragment protected by HT 1080 and HBL-100 RNAs corre-

sponds to nucleotide A at —203 (Fig. 2), indicating that thisnucleotide is the primary transcription initiation site. A minorprotected probe fragment, which is two nucleotides larger thanthe major protected fragment and corresponds to nucleotide Aat -205 (Fig. 2), may represent a secondary transcription ini-tiation site.

Identification ofpotential regulatory sequences

Twenty-two nucleotides upstream from the primary tran-

scription initiation site lies a sequence of GATAAAA that in-cludes two alternative TATA-like sequences of GATAAA andATAAAA (Fig. 2). These two sequences have been shown tobe the respective TATA box in the human immunoglobulinkappa light-chain gene (Klobeck et al., 1985) and in the bovineelastin gene (Manohar and Anwar, 1994). Mutagenesis of thecentral T to a G nucleotide abolished the ad promoter activity(see below). Nine nucleotides downstream from the primarytranscription initiation site lies another sequence (CTCATTCA)that resembles the consensus transcription initiator (Inr) (Smaleand Baltimore, 1989). Thus, the Inr, in this case, appears eitherto direct the transcription initiation outside its own sequence or

to play no role in transcription initiation.A highly GC-rich region (78%) is located within 190 nu-

cleotides, upstream from the TATA box. In this region, severalpotential binding sequences for Spl and AP2 transcription fac-tors intersperse with each other, suggesting that this region isprobably the promoter core (four Sp 1 and four AP2 sites withstrong homology with the respective consensus sequences are

marked in Fig. 2). Evidence that these two transcription factorsbind to the ad promoter will be shown below.

209 GAGAAC

* AACGG

1 98 G

A C G T K HT^—^

C G T K HB

FIG. 3. Identification of transcription initiation sites by SI mapping. Lanes A, C, G, and T, Sequencing ladders. Nucleotidesequence on the left is complementary to the sequencing ladder and is numbered according to Fig. 2. (*) denotes the primarytranscription initiation site. All other lanes are S1 digestion products in the presence of the indicated cellular RNAs. Lane K,K562; lane HT, HT1080; lane HB, HBL-100.

o6 INTEGRIN GENE PROMOTER 933

To identify other potential transcription factor binding se-

quences in the ad gene promoter, a computer-assisted searchagainst the GenBank database was performed. The search iden-tified a sequence (GAACAGGCTGCTC) between -533 and—521 (Fig. 2) with high homology (9 out of 10 bases) to theconsensus steroid receptor binding sequence (GAACANNNT-GTTC). This finding suggests that the ad gene promoter couldbe regulated by steroid hormones. The search also identified a

sequence (GCCTGCGAGT) immediately downstream from theputative TATA box sequence (between —224 and —214; Fig.2) that shares complete homology in the 5' half with the palin-dromic Kerl binding sequence (GCCTGCAGGC). Kerl was

first identified as a keratinocyte-specific transcription factor inthe human K14 keratin gene promoter (Leask et al, 1990). Be-cause ad expression is high in basal keratinocytes and low insuprabasal keratinocytes, the existence of a Kerl-like sequenceand its proximity to the putative TATA box sequence raises thepossibility that the sequence might be involved in the regula-tion of ad gene expression during keratinocyte differentiation.

Another epithelial cell specific enhancer sequence that alsoshares homology with the Kerl binding sequence, but has notbeen incorporated into the GenBank database, is the E-pal se-

quence (CACCTGCAGGTG). E-pal, the half-sites of which are

homologs of the CANNTG consensus sequence for binding ofhelix-loop-helix transcription factors (e.g., c-Myc), was firstidentified in the mouse E-cadherin gene promoter and has beenshown to confer epithelial cell-specific activity on the SV40promoter (Behrens et al., 1991). When E-pal was searchedagainst the ad promoter sequence, we found a highly homolo-gous sequence (10 out 12 bases) between —560 and —569(CATCTGCACGTG; Fig. 2). Both half-sites of this sequencealso conform with the c-Myc binding sequence. Also notewor-thy is that this E-pal-like sequence is located only 15 bp up-stream from the putative steroid receptor binding sequence.

Localization of promoter activities

The ad promoter was contained in a 4.8-kb Sal l-Hind IIIDNA fragment (Fig. 1 ). This fragment and three derivative frag-ments (Fig. 4) were cloned into pCAT-basic and pCAT-en-hancer (containing an SV40 enhancer) plasmids. Thus, a totalof eight ad CAT constructs were made and their promoter ac-

tivities were analyzed in high a6-expressing primary ker-atinocytes and HT1080 fibrosarcoma cells (Lin et al, 1993c),in low a6-expressing T47D breast cancer cells (Sager et al.,1993), and in null a6-expressing K562 leukemia cells (Hoger-vorst et al., 1991). As summarized in Fig. 4, the 4.8-kb frag-ment, which contains 2.5 kb of the flanking sequence and 2 kbof the first intron, had no detectable level of promoter activityin any of the four cell lines. Deleting the intron sequence, as

represented by the 2.5-kb fragment, resulted in the appearanceof a low promoter activity in primary keratinocytes but did nothave an effect in the other three tested cells. When most of theupstream sequence was removed, as represented by the 1-kband 0.3-kb fragments, low levels of promoter activities were

detectable in all three a6-expressing cells (primary ker-atinocytes, HT1080 and T47D). In the absence of the SV40 en-

hancer, the relative promoter activities in the four tested celllines largely reflected the relative levels of ad mRNA in thesecell lines. However, the level of promoter activity in the high-

CN-LL

ATG

5 kb

DNAfragment

5 kb

2.5 kb

1 kb

0.3 kb

ß-actin

-363/-184

-310/-1 84

-284/-1 84

-31 0/-233

GfiGfiAA

2.5 kb

1 kb

0.3 kb

CAT expression in

HT1080

JL JL0 0

0 0

34 122

41 130

320

1 18

1 10

23

0

0

HFKB _E_0 0

62 248

54 243

50 244

273

K562

_B_ _E_

0 0

0 0

0 0

0 0

240

T47D

JL JL

0 0

0 0

5 1 46

5 171

202

FIG. 4. «6 integrin genomic fragments tested for promoteractivity. Top line represents a 4.8-kb genomic fragment con-

taining the first exon (filled box). Relevant restriction sites areindicated by vertical lines: C, Sac I; H, Hind III; P, Pst I; S,Sal I; N, Nru I. Lines beneath the 4.8-kb fragment representsubfragments tested for promoter activities. Below the map isa table summarizing the promoter activities of these subfrag-ments that were cloned in pCAT-basic (B) and pCAT-enhancer(E) plasmids and tested in the indicated cell lines (HFK is hu-man foreskin keratinocytes). A /3-actin promoter-CAT con-struct is included for comparison. DNA fragments below the ß-actin promoter-CAT construct were generated by PCR and theirexact sequences are indicated in Fig. 2 (e.g., DNA fragment—363/—184 begins at -363 and ends at -184). The numbersbelow the cell lines represent the amount of CAT detected (inpicograms) per 10 pg of cellular protein, and are the averageof two separate experimental results after correction for varia-tions in transfection efficiency (by a /3-Gal control; see Mate-rials and Methods).

a6-expressing primary keratinocytes and HT1080 cells seemedto be lower than expected when compared with the ß-actin pro-moter (ad mRNA level approaches that of /3-actin in ker-atinocytes and HT 1080 cells, unpublished observations). In thepresence of the SV40 enhancer, a three- to four-fold increaseof promoter activity was seen in primary keratinocytes andHT 1080 cells, and a rather dramatic 30-fold increase occurredin T47D cells. Taken together, these results indicated that (i)

934 LIN ET AL.

the promoter is cell-type-specific; (ii) the a6 promoter is lo-cated in a 210-bp segment between the Sac I and Nru I re-

striction sites (Fig. 2); (iii) neither the putative steroid receptorbinding site nor the E-pal-like sequence was required for basalpromoter activity (since both are located outside the 210-bp pro-moter fragment, Fig. 2); (iv) an unknown enhancer element dis-tal to the promoter is probably required for optimal promoteractivity; and (v) cell-type-specific negative regulatory elementsmight be present in the upstream region.

To locate further the minimal region required for promoterfunction and to test the importance of the GATAAA sequence,we used PCR to generate progressively smaller ad genomicfragments (between the Sac I and Nru I restriction sites; Fig.2) and a mutated TATA-like sequence (from GATAAA toGAGAAA) for promoter assay. These genomic fragments andthe mutant were cloned in pCAT-enhancer and analyzed inHT 1080 cells. The results (Fig. 4) indicated that: (i) full pro-moter activities were preserved in fragments —363/—184 and-310/-184, which contained 131 bp and 78 bp, respectively,upstream from the TATA-like sequence; (ii) fragment—284/—184, which contained 52 bp upstream from the TATA-like sequence, had approximately 20% of the full promoter ac-

tivity; (iii) fragment —310/—233, which had the same upstreamsequences as fragment

—

310/—

184 but did not have the TATA-like downstream sequences, had no detectable promoter activ-ity; and (iv) the GAGAAA mutant, which was identical to the—310/—184 fragment except for the mutation, had completelylost the promoter activity. As such, we conclude that a mini-mal upstream sequence of 78 bp from the TATA-like sequencewas required for full promoter activity and that the GATAAAsequence was absolutely essential for promoter function.

Could DNA methylation play a role in a6gene regulation?

Genes that contain CG islands in their promotes and/or firstintrons are known to be regulated by DNA methylation at theseislands. For example, the E-cadherin gene promoter has beenshown to be hypomethylated and hypermethylated in E-cad-herin-expressing (e.g., MCF-7) and nonexpressing (e.g., MDA-MB-231) cells, respectively (Graff et al, 1995; Yoshiura et al.,1995). Because the ad promoter is very rich in CG dinu-cleotides, we wondered whether DNA methylation could playa role in the differential expression of ad in different cell linesand tissues.

It is known that certain restriction enzymes are "methylationsensitive," meaning that they cannot cleave their cognate se-

quences when one or more C nucleotides in the recognition se-

quences are methylated. Restriction endonucleases Bss HII, KspI, and Nae I are methylation-sensitive enzymes and have one,one, and two recognition sites, respectively, in the 210-bp "min-imum" ad promoter region (between the Sac I and Nru I sites;Figs. 1 and 2). We used each of these three enzymes in com-

bination with Pst I restriction enzyme to digest genomic DNAsof high-a6-expressing HBL-100 cells, low-a6-expressingMCF-7 and MDA-MB-231 cells (Lin et al, manuscript inpreparation), and non-a6-expressing K-562 cells. Digestion ofgenomic DNAs with Pst I alone should produce a 1,043-bpDNA fragment that contains the ad gene promoter (Fig. 1).Double digestion with Pst VBss HII, Pst UKsp I, and Pst UNae

I should produce DNA fragments of 787 bp + 256 bp, 784 bp +259 bp, and 751 bp + 217 bp + 75 bp, respectively, providedthat the Bss HII, Ksp I, and Nae I sites in the ad promoter are

not methylated.As shown in Fig. 5, all tested genomic DNAs were digested

to completion by Bss HII and Ksp I, indicating that the Bss HIIand Ksp I sites are not methylated in any of the four cell lines.In the case of Nae I digestion, all DNAs (including the puri-fied 1 -kb ad promoter-containing Pst I fragment that was pre-pared from a plasmid and should not have methylated C nu-

cleotides) could only be partially digested. The incompletedigestion by Nae I was not unexpected, since this enzyme isknown to display marked site preferences. Except for this com-

plication, the banding patterns, as shown in lanes 4, 7, 10, and13 of Fig. 5, differed only slightly among the four cell lines.These slight differences do not correspond to the ad expressionlevels, and therefore it can be concluded that DNA methylationis not likely to be involved in the regulation of ad gene ex-

pression.The ol6 promoter is bound by transcription factors Spland AP2

Sequence analysis shown in Fig. 2 revealed the presence ofseveral AP2 and Spl transcription factor binding sites in the adgene promoter. To demonstrate the actual binding of these fac-tors, we performed DNase I footprinting on the DNA fragmentbetween the Sac I and Nru I restriction sites (Fig. 2). As shownin Fig. 6, both AP2 and Spl proteins bound specifically to theircognate sequences, and the bound regions overlapped with eachother, suggesting a possible mechanism of cooperative interac-tions between the two transcription factors in the regulation ofthe ad gene promoter. A nuclear extract prepared from the high-a6-expressing HBL-100 cell line also produced significantbinding to the Spl sites and some binding to the AP2 sites, sug-gesting a positive regulatory effect of the two transcription fac-tors on the ad promoter. These preliminary results also suggestthat the footprint analysis might be useful in the identificationof other regulatory sequences and their binding proteins that

HBL MCF MDA K562

PBBKNBKN B KNB KNPN

«M2 5 6- **"

FIG. 5. Genomic blot analysis for restriction sites that mightbe methylated. All DNAs, including those of HBL-100 (HBL),MCF-7 (MCF), MDA-MB-231 (MDA), and K562 cells, were

cut by Pst I together with either Bss HII (B), Ksp I (K), or NaeI (N). Lane PB, Purified 1-kb Pst I (ad promoter) fragment andits two Bss HII subfragments; lane PN, 1-kb Pst I fragment andits Nae I subfragments (incomplete digestion due to site pref-erences).

ató INTEGRIN GENE PROMOTER 935

AP

Sp

AP

Sp

Sp

-5 I

FIG. 6. DNase I footprint analysis. Lane AG, Sequencing lad-der (cleavage at A and G) of the probe. The other four lanesare DNase I-treated probe in the presence of the indicated bind-ing proteins. Lane C, Control (no binding protein); lane S, Spl ;lane A, AP2; lane H, HBL-100 nuclear extract. On the left arefour AP2 and three Spl binding sequences that can be read fromthe sequencing ladder and were shown in Fig. 2.

may be responsible for the differential regulation of ad geneexpression in cells and tissues.

DISCUSSION

For the study of integrin gene regulation at the molecularlevel, several integrin gene promoters have been isolated andcharacterized. These include a2 (Zutter et al, 1994), aA (Rosen

et al, 1991), a5 (Birkenmeier et al, 1991), al (Ziober andKramer, 1996) aw (Donahue et al, 1994), CDlla (Nueda etal, 1993), CDllb (Hickstein et al, 1992), CDllc (Lopez etal, 1993), VCAM-1 (Iademarco et al, 1992), allb (Prandini etal, 1992), ßl (Cervella et al, 1993), ß2 (CD 18) (Agura et al,1992), ß3 (Villa et al, 1994), and ßl (Leung et al, 1993). Acommon feature shared by most of these promoters is the lackof both TATA and CCAAT boxes. The only exception is thehuman a4 integrin gene promoter, which has both TATA andCCAAT boxes (although its murine counterpart does not) (Deet al, 1994). Also of interest is that the ß\ integrin gene hastwo distinct promoters that are regulated independently of eachother (Cervella et al, 1993). The longer RNA transcript origi-nating from the distal promoter is 20-fold more abundant andhas a wider tissue distribution than the shorter transcript.

In comparison with other integrin gene promoters, the hu-man ad gene promoter is unique in that: (i) it has the highestGC/AT ratio, (ii) it has a TATA box, and (iii) its activity couldbe upregulated by an heterogeneous enhancer. The high GC/ATratio is accompanied by the presence of several Spl and AP2binding sequences. DNase I footprint analysis showed that theentire ad promoter core was completely bound by Spl and AP2without interruption. Such a high density of transcription fac-tor binding sites has not been reported in any other integringenes.

High GC content is usually found in TATA-less promotersof the so-called housekeeping genes. However, the ad pro-moter, despite being highly GC-rich, has a TATA box. Whereasmost of the GC-rich sequences could be deleted without harm-ing the promoter function, the TATA box was absolutely re-

quired for such function. Upstream from the TATA box, the78-bp minimal sequence contains three Spl and one AP2 se-

quences. Therefore, it is likely that the ad promoter is co-reg-ulated by Spl, AP2, and TATA-binding transcription factors.

Up-regulation of ad promoter activity by the SV40 enhancerwas approximately four-fold in high-a6-expressing ker-atinocytes and HT1080 cells and 30-fold in low-a6-expressingT47D cells. Because no enhancement was observed with thenon-a6-expressing K562 cells, it appears that the promoter core

itself controls the cell-type-specific activities. The difference inpromoter function between keratinocytes, HT1080 and T47Dcells might reflect the different activities of the SV40 enhancerin these cell lines. Another possible explanation is that becauseT47D cells are derived from breast epithelial cells, which nor-

mally express ad abundantly, the SV40 enhancer could perhapsact as a substitute for an element that is lost during the patho-genesis of breast tumors. In any event, the enhancing effect ofthe SV40 enhancer suggests that there might be an endogenousenhancer element for the ad promoter that lies some distancefrom the promoter and is lacking in our a6 genomic clones.

In our sequence analysis, we have identified a nearly perfectsteroid receptor binding sequence, an E-pal-like sequence, anda Kerl-like sequence in the ad gene promoter. However, thepresence of the first two sequences in the 1-kb CAT constructand the absence of both sequences in the 0.3-kb construct pro-duced essential identical results in our promoter activity assays,suggesting that neither sequence is required for basal promoteractivity. Nevertheless, it is still intriguing that the two sequencesare highly homologous to their respective consensus sequencesand lie only 15 nucleotides apart. The proximity of the two sites

936 LIN ET AL.

implies possible interactions between them, and perhaps theseinteractions may have a role in the regulation of ad gene ex-

pression at certain developmental stages. A possible explana-tion for our inability to detect this presumed role of these se-

quences in our promoter assays is that these assays relied on

cultured cells that do not represent developmentally regulatedcells. As for the Kerl-like sequence, it may be significant thatits location is immediately 3' to the TATA box. Whether it isinvolved in the promoter function, the transcription initiation,or other aspects of ad gene regulation is at present not clearbut will be investigated further.

ACKNOWLEDGMENTS

The authors would like to thank Dr. Arnoud Sonnenberg forproviding the ad 5'-end cDNA. This work was supported by a

grant from the Cancer Research Coordinating Committee of theUniversity of California (to C.-S.L) and by a grant from Na-tional Institutes of Dental Research (DE/CA 11912 to R.K.)

REFERENCES

AGURA, E.D., HOWARD, M., and COLLINS, S.J. (1992). Identifi-cation and sequence analysis of the promoter for the leukocyte inte-grin beta-subunit (CD 18): A retinoic acid-inducible gene. Blood 79,602-609.

ALMEIDA, E.A., HUOVILA, A.P., SUTHERLAND, A.E.,STEPHENS, L.E., CALARCO, P.G., SHAW, L.M., MERCURIO,A.M., SONNENBERG, A., PRIMAKOFF, P., MYLES, D.G., et al.(1995). Mouse egg integrin alpha 6 beta 1 functions as a sperm re-

ceptor. Cell 81, 1095-1104.BEHRENS, I., LOWRICK, O., KLEIN-HITPASS, L., and BIRCH-

MEIER, W. (1991). The E-cadherin promoter: functional analysis ofa G.C-rich region and an epithelial cell-specific palindromic regula-tory element. Proc. Nati. Acad. Sei. USA 88, 11495-11499.

BERK, A.J., and SHARP, P.A. (1977). Sizing and mapping of earlyadenovirus mRNAs by gel electrophoresis of SI endonuclease-di-gested hybrids. Cell 12, 721-732.

BIRKENMEIER, T.M., McQUILLAN, S.S., BOEDEKER, E.D., AR-GRAVES, W.S., RUOSLAHTI, E., and DEAN, D.C. (1991). The al-pha 5 beta 1 fibronectin receptor. Characterization of the alpha 5gene promoter. I. Biol. Chem. 266, 20544-20549.

BOYCE, ST., and HAM, R.G. (1985). Cultivation, frozen storage, andclonal growth of normal human epidermal keratinocytes in serum-free media. I. Tissue Cult. Methods 9, 83-93.

CERVELLA, P., SILENGO, L„ PASTURE, C, and ALTRUDA, F.(1993). Human beta 1-integrin gene expression is regulated by two

promoter regions. I. Biol. Chem. 268, 5148-5155.CHIRGWIN, J.M., PRZYBYLA, A.E., MacDONALD, R.I., and RUT-

TER, W.J. (1979). Isolation of biologically active ribonucleic acidfrom sources enriched in ribonuclease. Biochemistry 18, 5294—5299.

DE, M.C., SCHOLLEN, E., IASPERS, M., ONGENA, K., MATTHIIS,G., MARYNEN, P., and CASSIMAN, JJ, (1994). Cloning and char-acterization of the promoter region of the murine alpha-4 integrinsubunit. DNA Cell Biol. 13, 743-754.

DEFTLIPPI, P., BOZZO, C, VOLPE, G, RAMANO, G, VEN-TURING, M., SILENGO, L., and TARONE, G. (1994). Integrin-me-diated signal transduction in human endothelial cells: analysis of ty-rosine phosphorylation events. Cell Adhes. Commun. 2, 75-86.

DONAHUE, I.P., SUGG, N., and HAWIGER, I. (1994). The integrin

alpha v gene: identification and characterization of the promoter re-

gion. Biochim. Biophys. Acta 1219, 228-232.DYER, R.B., and HERZOG, N.K. (1995). Isolation of intact nuclei for

nuclear extract preparation from a fragile B-lymphocyte cell line.Biotechniques 19, 192-197.

GALAS, D.I., and SCHMITZ, A. (1978). DNase footprinting: a sim-ple method for the detection of protein-DNA binding specificity. Nu-cleic Acids Res. 5, 3157-3170.

GORMAN, CM., MOFFAT, L.F., and HOWARD, B.H. (1982). Re-combinant genomes which express chloramphenicol acetyltrans-ferase in mammalian cells. Mol. Cell Biol. 2, 1044-1051.

GRAFF, J.R., HERMAN, J.G., LAPIDUS, R.G., CHOPRA, H., XU,R., IARRARD, D.F., ISAACS, W.B., PITHA, P.M., DAVIDSON,N.E., and BAYLIN, S.B. (1995). E-cadherin expression is silencedby DNA hypermethylation in human breast and prostate carcinomas.Cancer Res. 55, 5195-5199.

GRAHAM, F.L., and VAN DER EB, A.J. (1973). A new technique forthe assay of infectivity of human adenovirus 5 DNA. Virology 52,456-457.

HERTLE, M.D., ADAMS, I.C., and WATT, F.M. (1991). Integrin ex-

pression during human epidermal development in vivo and in vitro.Development 112, 193-206.

HICKSTEIN, D.D., BAKER, D.M., GOLLAHON, K.A., and BACK,A.L. (1992). Identification of the promoter of the myelomonocyticleukocyte integrin CDllb. Proc. Nati. Acad. Sei. USA 89,2105-2109.

HIERCK, B.P., THORSTEINSDOTTIR, S., MESSEN, CM., FRE-UND, E., IPEREN, L.V., FEYEN, A., HOGERVORST, F., POEL-MANN, R.E., MUMMERY, C.L., and SONNENBERG, A. (1993).Variants of the alpha 6 beta 1 laminin receptor in early murine de-velopment: distribution, molecular cloning and chromosomal local-ization of the mouse integrin alpha 6 subunit. Cell Adhes. Commun.1, 33-53.

HOGERVORST, F., KUIKMAN, I., VAN KESSEL, A.G., and SON-NENBERG, A. ( 1991 ). Molecular cloning of the human alpha 6 in-tegrin subunit. Alternative splicing of alpha 6 mRNA and chromo-somal localization of the alpha 6 and beta 4 genes. Eur. J. Biochem.199, 425^133.

HYNES, R.O. (1992). Integrins: versatility, modulation, and signalingin cell adhesion. Cell 69, 11-25.

IADEMARCO, M.F., McQUILLAN, I.J., ROSEN, G.D., and DEAN,D.C. (1992). Characterization of the promoter for vascular cell ad-hesion molecule-1 (VCAM-1). J. Biol. Chem. 267, 16323-16329.

KLOBECK, H.G., MEINDL, A., COMBRIATO, G, SOLOMON, A.,and ZACHAU, H.G. (1985). Human immunoglobulin kappa lightchain genes of subgroups II and III. Nucleic Acids Res. 13,6499-6513.

LAIRD, P.W., ZUDERVELD, A., LENDERS, K., RUDNICKI, M.A.,JAENISCH, R., and BERNS, A. (1991). Simplified mammalianDNA isolation procedure. Nucleic Acids Res. 19, 4293.

LEASK, A., ROSENBERG, M., VASSAR, R„ and FUCHS, E. (1990).Regulation of a human epidermal keratin gene: sequences and nu-

clear factors involved in keratinocyte-specific transcription. Genes& Dev. 4, 1985-1998.

LEUNG, E., MEAD, P.E., YUAN, Q., HANG, W.M., WATSON, J.D.,and KRISSANSEN, G.W. (1993). The mouse beta 7 integrin genepromoter: transcriptional regulation of the leukocyte integrinsLPAM-1 and M290. Int. Immunol. 5, 551-558.

LIN, C.-S., CHEN, Z.P., PARK, T., GHOSH, K., and LEAVITT, I.(1993a). Characterization of the human L-plastin gene promoter innormal and neoplastic cells. I. Biol. Chem. 268, 2793-2801.

LIN, C.-S., PARK, T., CHEN, Z.P., and LEAVITT, J. (1993b). Humanplastin genes. Comparative gene structure, chromosome location, anddifferential expression in normal and neoplastic cells. I. Biol. Chem.268, 2781-2792.

otf, INTEGRIN GENE PROMOTER 937

LIN, C.-S., ZHANG, K, and KRAMER, R. (1993c). ad integrin is up-regulated in step-increments accompanying neoplastic transforma-tion and tumorigenic conversion of human fibroblasts. Cancer Res.53, 2950-2953.

LOPEZ, CM., NUEDA, A„ VARA, A., GARCIA, A.J., TUGORES,A., and CORBI, A.L. (1993). Characterization of the pl50,95 leuko-cyte integrin alpha subunit (CD1 lc) gene promoter. Identification ofcis-acting elements. I. Biol. Chem. 268, 1187-1193.

MANOHAR, A., and ANWAR, R.A. (1994). Evidence for the pres-ence of a functional TATA box (ATAAAA) sequence in the genefor bovine elastin. Biochim. Biophys. Acta 1219, 233-236.

MAXAM, A.M., and GILBERT, W. (1980). Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol. 65,499-560.

NUEDA, A., LOPEZ, CM., VARA, A., and CORBI, A.L. (1993).Characterization of the CD1 la (alpha L, LFA-1 alpha) integrin genepromoter. I. Biol. Chem. 268, 19305-19311.

POW, C.S., and HENDRICKX, A.G. (1995). Localization of integrinsubunits alpha 6 and beta 1 during somitogenesis in the long-tailedmacaque (M. fascicularis). Cell Tissue Res. 281, 101-108.

PRANDINI, M.H., UZAN, G, MARTIN, F., THEVENON, D., andMARGUERIE, G. (1992). Characterization of a specific eryth-romegakaryocytic enhancer within the glycoprotein lib promoter. I.Biol. Chem. 267, 10370-10374.

ROSEN, G.D., BIRKENMEIER, T.M., and DEAN, D.C. (1991). Char-acterization of the alpha 4 integrin gene promoter. Proc. Nati. Acad.Sei. USA 88, 4094-f098.

RUIZ, P., DUNON, D., SONNENBERG, A., and EMHOF, B.A. (1993).Suppression of mouse melanoma metastasis by EA-1, a monoclonal an-

tibody specific for alpha 6 integrins. Cell Adhes. Commun. 1, 67-81.RUIZ, P., WILES, M.V., and IMHOF, B.A. (1995). Alpha 6 integrins

participate in pro-T cell homing to the thymus. Eur. I. Immunol. 25,2034-2041.

RUOSLAHTI, E. (1991). Integrins. J. Clin. Invest. 87, 1-5.SAGER, R., ANISOWICZ, A., NEVEU, M., LIANG, P., and

SOTIROPOULOU, G. (1993). Identification by differential displayof alpha 6 integrin as a candidate tumor suppressor gene. FASEB I.7, 964-970.

SANGER, F., NICKLEN, S., and COULSON, A.R. (1977). DNA se-

quencing with chain-terminating inhibitors. Proc. Nati. Acad. Sei.USA 74, 5463-5467.

SMALE, S.T., and BALTIMORE, D. (1989). The "initiator" as a tran-

scription control element. Cell 57, 103-113.

SONNENBERG, A., and LINDERS, C.J.T. (1990). The «6/31 (VLA-6) and a6ß4 protein complexes: Tissue distribution and biochemi-cal properties. I. Cell Sei. 96, 207-217.

STEPP, M.A., SPURR-MICHAUD, S„ TISDALE, A., ELWELL, J.,and GIPSON, I.K. (1990). »6/34 integrin heterodimer is a compo-nent of hemidesmosomes. Proc. Nati. Acad. Sei. USA 87,8970-8974.

TAMURA, R.N., ROZZO, C, STARR, L., CHAMBERS, I.,REICHARDT, L.F., COOPER, H.M., and QUARANTA, V. (1990).Epithelial integrin adßA: Complete primary structure of ad and vari-ant forms of /34. J. Cell Biol. Ill, 1593-1604.

VILLA, G.M., LI, L„ RIELY, G, and BRAY, P.F. (1994). Isolationand characterization of a TATA-less promoter for the human beta 3integrin gene. Blood 83, 668-676.

YOSHIURA, K., KANAI, Y., OCHIAI, A., SHIMOYAMA, Y., SUG-IMURA, T., and HIROHASHI, S. (1995). Silencing of the E-cad-herin invasion-suppressor gene by CpG methylation in human car-

cinomas. Proc. Nati. Acad. Sei. USA 92, 7416-7419.ZHANG, K., and KRAMER, R.H. (1996). Laminin 5 deposition pro-

motes keratinocyte motility. Exp. Cell Res. 227, 309-322.ZIOBER, B.L., and KRAMER, R.H. (1996). Isolation of integrin al

gene promoter and characterization of C2C12 myoblast. I. Biol.Chem. 271, 22915-22922.

ZIOBER, B.L., LIN, C.-S., and KRAMER, R.H. (1996). Laminin-bind-ing integrins in tumor progression and metastasis. Sem. Cancer Biol.7, 119-128.

ZUTTER, M.M., SANTORO, S.A., PAINTER, A.S., TSUNG, Y.L.,and GAFFORD, A. (1994). The human alpha 2 integrin gene pro-moter. Identification of positive and negative regulatory elements im-portant for cell-type and developmentally restricted gene expression.I. Biol. Chem. 269, 463^169.

Address reprint requests to:Dr. Ching-Shwun Lin

Department of StomatologyUniversity of California

513 Parnassus Avenue, Room C635San Francisco, CA 94143-0512

Received for publication September 15, 1996; accepted Febru-ary 5, 1997.