PRODUCTION OF BIOSIMILAR TRASTUZUMAB IN PLANTS: EXPRESSION,
PURIFICATION, AND ANALYSIS OF FUNCTION
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
BRITTANY MARIE GROHS
In partial fulfilment of requirements
for the degree of
Masters of Science
January, 2011
© Brittany M. Grohs, 2011
1*1 Library and Archives Canada
Published Heritage Branch
395 Wellington Street OttawaONK1A0N4 Canada
Bibliotheque et Archives Canada
Direction du Patrimoine de Pedition
395, rue Wellington OttawaONK1A0N4 Canada
Your Tile Votre rSference ISBN: 978-0-494-80078-2 Our file Notre r6f6rence ISBN: 978-0-494-80078-2
NOTICE: AVIS:
The author has granted a nonexclusive license allowing Library and Archives Canada to reproduce, publish, archive, preserve, conserve, communicate to the public by telecommunication or on the Internet, loan, distribute and sell theses worldwide, for commercial or noncommercial purposes, in microform, paper, electronic and/or any other formats.
L'auteur a accorde une licence non exclusive permettant a la Bibliotheque et Archives Canada de reproduce, publier, archiver, sauvegarder, conserver, transmettre au public par telecommunication ou par I'lnternet, preter, distribuer et vendre des theses partout dans le monde, a des fins commerciales ou autres, sur support microforme, papier, electronique et/ou autres formats.
The author retains copyright ownership and moral rights in this thesis. Neither the thesis nor substantial extracts from it may be printed or otherwise reproduced without the author's permission.
L'auteur conserve la propriete du droit d'auteur et des droits moraux qui protege cette these. Ni la these ni des extraits substantiels de celle-ci ne doivent etre imprimes ou autrement reproduits sans son autorisation.
In compliance with the Canadian Privacy Act some supporting forms may have been removed from this thesis.
Conformement a la loi canadienne sur la protection de la vie privee, quelques formulaires secondaires ont ete enleves de cette these.
While these forms may be included in the document page count, their removal does not represent any loss of content from the thesis.
Bien que ces formulaires aient inclus dans la pagination, il n'y aura aucun contenu manquant.
1*1
Canada
ABSTRACT
PRODUCTION OF BIOSIMILAR TRASTUZUMAB IN PLANTS: EXPRESSION, PURIFICATION, AND ANALYSIS OF FUNCTION
Brittany Marie Grohs Advisor: University of Guelph, 2011 Professor J. C. Hall
This thesis is an investigation of the production and purification of biosimilar
trastuzumab from Nicotiana benthamiana. N. benthamiana plants were engineered to
express trastuzumab and purification of this antibody was performed. Plant-produced
trastuzumab was determined to have the same specificity for HER2 as the innovator drug
Herceptin® and was also as effective at inhibiting the proliferation of HER2-
overexpressing cancer cells. A scalable purification scheme (hollow fiber tangential flow
microfiltration, Protein A chromatography and SP Sepharose cation exchange
chromatography) was developed to improve the purification of plant-produced
trastuzumab. Immunoblot analyses revealed the purity and antibody-banding pattern of
plant-produced trastuzumab to be comparable to Herceptin®. The results of this thesis
provide further evidence that plants can be used to produce biosimilar therapeutic
antibodies.
PREFACE
This thesis contains one chapter, portions of which will be published in a book
and one chapter that has been published in a peer-reviewed scientific journal.
CHAPTER TWO
Meyers, A. J., Grohs, B.M., and Hall, J.C. Antibody Production inplanta. In: Comprehensive Biotechnology, 2nd Edition (Butler, M., Webb, C, Moreira, A., Grodzinski, B., Cui, Z.F., and Moo-Young, M., eds.). Oxford, UK: Elsevier. In press.
CHAPTER THREE
Grohs, B.M., Niu, Y., Veldhuis, L.J., Trabelsi, S., Garabagi, F., Hassell, J.A., McLean, M.D., and Hall, J.C. (2010). Plant-produced trastuzumab inhibits the growth of HER2 positive cancer cells in vitro. J. Agric. Food Chem., 58, 10056-10063.
Reprinted with permission from Grohs et al., 2010. Copyright 2010 American Chemical Society.
l
ACKNOWLEDGEMENTS
First, I would like to thank my advisor Dr. J. Christopher Hall. Four years ago, I
was an undergraduate student with no practical experience and no desire to conduct
research. Through Chris' mentoring, I have not only developed a passion for research, but
have gained valuable insight, research and writing skills, and the ability to think
critically. For this, I will be forever grateful.
Thanks to Dr. Michael D. McLean for his endless patience, guidance and support.
I will always appreciate Mike's willingness to make time to discuss new ideas and
troubleshoot problems.
Thanks to my committee members, Drs. Raja Ghosh and Donald I.H. Stewart for
their guidance in planning laboratory experiments and for critical review of this thesis.
Sincere gratitude and thanks to Yongqing Niu and Linda Veldhuis for their
friendship, for their patience in answering my endless questions, and for providing me
with the training and tools that have allowed me to excel in the lab.
Thanks to Ashley J. Meyers for her friendship, for her help in the lab, and for our
problem-solving conversations. I will always cherish your friendship.
Thanks to all my fellow members of the Hall lab group from 2003-2010. You
have made my time in the lab not only memorable, but truly enjoyable.
Finally, I would like to thank my friends and family for their continuous love and
support. I am especially grateful to Brenda Grohs, Brian Grohs, Kirsten Grohs, Valerie
Sutter, Devin Woods, and Melissa Bassoriello - 1 would not be where I am today with
out you.
ii
LIST OF ABBREVIATIONS
ADCC
AEX
Akt
ATCC
ATPS
BCIP
BSA
CDK
CDR
CEX
CH
CHO
CHT
CL
CRC
DMEM
d.p.i.
EBA
ECD
EDTA
EGF
EGFR
Antibody dependent cellular cytotoxicity
Anion exchange chromatography
Protein kinase B
American type culture collection
Aqueous two-phase system
5-Bromo-4-Chloro-3-Indolyl Phosphate
Bovine serum albumin
Cyclin-dependent kinase
Complementarity determining region
Cation exchange chromatography
Constant domain of the heavy chain
Chinese hamster ovary
Ceramic hydroxyapatite
Constant domain of the light chain
Canada research chair
Dulbecco's modified Eagle's medium
Days post infiltration
Expanded-bed adsorption
Extracellular domain
Ethylenediaminetetraacetic acid
Epidermal growth factor
Epidermal growth factor receptor
i i i
ELISA
ELP
ER
Fab
FBS
Fc
FDA
FPLC
GalT
GMP
HB-EGF
HCIC
HDEL
HER2
HIC
HIV
HRP
HSV
I.D.
IEC
IEF
IgA
IgD
Enzyme-linked immunosorbent assay
Elastin like-polypeptide
Endoplasmic reticulum
Fragment, antigen binding
Fetal bovine serum
Fragment, crystallizable
United States Food and Drug Administration
Fast-performance liquid chromatography
(31,4-galactosyltransferase
Good manufacturing practice
Heparin-binding epidermal growth factor
Hydrophobic charge induction chromatography
Histidine-aspartate-glutamate-leucine
Human epidermal growth factor receptor 2
Hydrophobic interaction chromatography
Human immunodeficiency virus
Horseradish peroxidase
Herpes simplex virus
Internal diameter
Ion exchange chromatography
Isoelectric focusing
Immunoglobulin alpha (a) isotype antibody
Immunoglobulin delta (8) isotype antibody
IgG
IgE
IgM
IMAC
ITC
IV
IQ
kDa
KDEL
LMH
mAb
MES
mRNA
MW
MS
mumAb
NBT
NF-KB
NK
NMR
NOSp
NOSt
NRG
Immunoglobulin gamma (y) isotype antibody
Immunoglobulin epsilon (s) isotype antibody
Immunoglobulin mu (u) isotype antibody
Immobilized metal affinity chromatography
Inverse transition cycling
Intravenous
Dissociation equilibrium constant
Kilodalton
Lysine-aspartate-glutamate-leucine
Litres per square meter per hour
Monoclonal antibody
1 -(iV-morpholino)ethanesulphonic acid
messenger ribonucleic acid
Molecular weight
Mass spectrometry
Murine monoclonal antibody
Nitro blue tetrazolium chloride
Nuclear factor-kappa B
Natural killer
Nuclear magnetic resonance
Nopaline synthase promoter
Nopaline synthase terminator
Neuregulin
NSERC
OD600
OMAFRA
PBK
PBS
PBST
PCR
PEG
Pi
PBK
PS
PVDF
PVX
RNAi
RP
RP-HPLC
RPMI
RTK
scFv
SDS-CE
SDS-PAGE
SP
SPR
Natural Sciences and Engineering Research Council of Canada
Optical density at 600 nm
Ontario Ministry of Agriculture, Food, and Rural Affairs
Protein kinase B
Phosphate buffered saline
Phosphate buffered saline Tween
Polymerase chain reaction
Poly(ethylene glycol)
Isoelectric point
Phosphatidylinositol-3 kinase
Polysulphone
Polyvinylidene fluoride
Potato virus X
RNA interference
Reverse phase
Reverse phase high performance liquid chromatography
Roswell Park Memorial Institute
Receptor tyrosine kinases
Single chain variable fragment
Sodium dodecyl sulfate-capillary electrophoresis
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
Sulphopropyl
Surface plasmon resonance
TAG
TFF
TGF
TMV
TMP
TNF
TSP
Tt
VEGF
VH
v L
WNV
Triacylglycerol
Tangential flow filtration
Transforming growth factor
Tobacco mosaic virus
Transmembrane pressure
Tumor necrosis factor
Total soluble protein
Transition temperature
Vascular endothelial growth factor
Variable domain of the heavy chain
Variable domain of the light chain
West Nile virus
vn
TABLE OF CONTENTS
PREFACE i
ACKNOWLEDGEMENTS ii
LIST OF ABBREVIATIONS iii
TABLE OF CONTENTS viii
LIST OF TABLES xii
LIST OF FIGURES xiii
1 INTRODUCTION, RESEARCH OBJECTIVES, AND HYPOTHESES 1
2 LITERATURE REVIEW 5
2.1 Trastuzumab 5
2.1.1 Human Epidermal Growth Factor Receptor 2 (HER2) 5
2.1.2 Engineering of Trastuzumab 9
2.1.3 Mechanism of Action 11
2.1.3.1 Cytostatic Effects 11
2.1.3.1.1 Arrest of Cell-Cycle Progression 12
2.1.3.2 Cytolytic Effects 14
2.2 Plant Biopharming of Therapeutic Antibodies 15
2.2.1 Expression of Antibodies in Plants 15
2.2.1.1 Glycosylation 16
2.2.2 Purification of Antibodies from Plants 16
2.2.2.1 Grinding and Extraction 17
2.2.2.2 Clarification and Enrichment 18
2.2.2.2.1 Aqueous Two-Phase Partitioning System (ATPS) 19
2.2.2.2.2 ELP Fusion Protein (ELPylation) 20
viii
2.2.2.2.3 Filtration 21
2.2.2.3 Antibody Capture and Purification 23
2.2.2.4 SemBioSys Oilbody Purification Platform 24
2.2.2.5 Polishing 25
2.2.3 Characterization of Plant-Produced Antibodies 26
2.3 Affinity Chromatography 27
2.3.1 Affinity Purification Scheme 27
2.3.1.1 Affinity Purification Scheme - Binding 30
2.3.1.2 Affinity Purification Scheme - Elution 32
2.3.1.3 Factors Affecting Solute Retention 32
2.3.1.3.1 Reaction Kinetics 33
2.3.2 Affinity Resins 35
2.3.2.1 Affinity Ligands 35
2.3.2.1.1 Biological Ligands 35
2.3.2.1.2 Bioengineered Ligands 39
2.4 Conclusion 40
3 RESEARCH CHAPTER 1: PLANT PRODUCED TRASTUZUMAB INHIBITS THE GROWTH OF HER2 POSITIVE CANCER CELLS IN VITRO 41
3.1 Abstract 41
3.2 Introduction 41
3.3 Material and Methods 45
3.3.1 Cell Lines and Plasmids 45
3.3.2 Vector Construction and Plant Infiltration 46
3.3.3 SDS-PAGE and Western Blot Analyses 49
3.3.4 Quantitative ELISA 50
3.3.5 Antibody Purification 51
ix
3.3.6 N-Terminal Sequence Analysis 52
3.3.7 Cell Culture 52
3.3.8 Cell Proliferation Assay 53
3.4 Results 54
3.4.1 Accumulation of Trastuzumab in N. benthamiana Plants 54
3.4.2 Purification and Characterization of Plant-Produced Trastuzumab 55
3.4.3 Specificity of Plant-Produced Trastuzumab 56
3.4.4 Inhibition of Tumor Cell Proliferation 58
3.5 Discussion 60
3.6 Acknowledgements 62
4 RESEARCH CHAPTER 2: PURIFICATION OF A PLANT-PRODUCED ANTIBODY USING HOLLOW FIBER TANGENTIAL FLOW MICROFILTRATION 64
4.1 Abstract 64
4.2 Introduction 65
4.3 Materials and Methods 68
4.3.1 Plant Material 68
4.3.2 Extraction and Clarification 68
4.3.3 Chromatography 70
4.3.4 SDS PAGE and Immunoblot Analyses 71
4.3.5 Quantitative ELISA 71
4.4 Results 72
4.4.1 Purification of Trastuzumab from TV. benthamiana 72
4.4.2 Polishing of Plant-Purified Trastuzumab 77
4.4.3 Characterization of Antibody Integrity and Purity 77
4.5 Discussion 80
x
4.6 Acknowledgements 83
5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS 84
6 LITERATURE CITED 88
XI
LIST OF TABLES
Table 2.1 Characteristics and specifications of trastuzumab (Herceptin®) 11
Table 2.2 Immunoglobulins bound by the bacterial cell wall proteins: Protein A, G, and L 37
Table 3.1 Nucleotide sequences of the primers used in the construction of pTrasHC 48
Table 3.2 Nucleotide sequences of the primers used in the construction of pTrasLC 48
Table 4.1 Specifications for the hollow fiber tangential flow filtration module (M10S-320-01P) used in the purification of trastuzumab from N. benthamiana 70
Table 4.2 Analysis of the recovery of trastuzumab from 100 g of A7! benthamiana . 75
xn
LIST OF FIGURES
Figure 2.1 The ligand-free conformation of each of the ErbB receptors (A) and the process of ErbB receptor dimerization (B) 6
Figure 2.2 Representation of the effects of epidermal growth factor receptor (EGF)
and neuregulin 4 (NRG4) on the ErbB signalling network 8
Figure 2.3 The mammalian cell cycle 13
Figure 2.4 Schematic representation of the two types of micro filtration: dead-end
filtration (A) and tangential flow filtration (B) 22 Figure 2.5 Affinity chromatography purification scheme represented by an affinity
column (A) and typical chromatograph (B) 29
Figure 2.6 Affinity chromatograms showing the effect of reaction kinetics on solute retention 34
Figure 2.7 Ribbon diagram showing the IgG-binding sites of the B domain of Protein A (A) and the C2 domain of Protein G (B) 38
Figure 3.1 Schematic diagram of the constructs for expression of trastuzumab in N.
benthamiana; pTrasHC (A) and pTrasLC (B) 47
Figure 3.2 Quantification of trastuzumab expression in N. benthamiana 55
Figure 3.3 Analysis of the purity of plant-produced trastuzumab. Reducing,
Coomassie stained SDS-PAGE (A) and immunoblot (B) 57 Figure 3.4 Qualitative analysis of the binding of plant-produced trastuzumab to HER2
ligand 58
xin
Figure 3.5 Effect of plant-produced trastuzumab on the proliferation of human breast tumor cells that overexpress HER2 59
Figure 4.1 Schematic of the follow fiber tangential flow microfiltration system flow-path 69
Figure 4.2 Structural integrity of plant-produced trastuzumab purified using a combination of ammonium sulfate precipitation, Protein G, and Protein A chromatography 73
Figure 4.3 Purification scheme for the recovery of trastuzumab from 100 g of frozen N. benthamiana tissue (A) 74
Figure 4.4 Purification of trastuzumab from clarified N. benthamiana extract using Protein A affinity chromatography 76
Figure 4.5 Polishing of plant-purified trastuzumab by SP Sepharose cation exchange chromatography 78
Figure 4.6 Non-reducing immunoblot analysis of the fractions collected throughout the SP Sepharose purification of plant-produced trastuzumab (A-F) 79
Figure 4.7 Non-reducing (A) and reducing (B) immunoblot analyses of the purity of plant-produced trastuzumab 80
xiv
1 INTRODUCTION, RESEARCH OBJECTIVES, AND HYPOTHESES
Monoclonal antibodies (mAb) are valuable biopharmaceuticals that are used in a
variety of therapeutic applications including immunomodulation, oncology, and the
treatment of pathogenic infections (Nissim and Chernajovsky, 2008). Trastuzumab
(Herceptin®, Genentech, Inc., San Francisco, CA) is one therapeutic mAb that is used for
the treatment of metastatic breast cancer. By targeting cells that overexpress human
epidermal growth factor receptor 2 (HER2), Herceptin® regulates the uncontrolled
growth of HER2 overexpressing cells through the induction of both cytostatic and
cytolytic effects (i.e. arrest of cell cycle progression and targeted cell lysis) (Baselga and
Albanell, 2001; Beano et al., 2008; Varchetta et al , 2007). However, treatment of human
disease with mAbs such as Herceptin® requires large quantities of these
biopharmaceuticals. In one treatment cycle, a single patient is administered a loading
dose of 4 mg of Herceptin®/kg body weight followed by a weekly maintenance dose of 2
mg/kg (Cobleigh et al., 1999). Over one year, 5-10 g of Herceptin® is required to treat
one patient. An efficient expression system is thus required to meet market demands.
Therapeutic mAbs are produced by conventional mammalian cell expression
systems. However, alternative expression systems that would allow the production of
biosimilar antibodies (follow-on biopharmaceuticals derived from innovator drugs) are
being investigated (Birch and Racher, 2006; Covic and Kuhlmann, 2007; Gottlieb, 2008;
Karg and Kallio, 2009). Plants are a promising alternative to traditional mammalian
expression systems due to their ease of handling, scalability, and because their protein
folding and post-translational modifications are similar to those of mammalian systems.
Furthermore, plant-produced antibodies retain biological activities (i.e., specificity,
1
cytotoxicity, and neutralization activity) that are similar to parental antibodies produced
by mammalian cell culture (reviewed in De Muynck et al., 2010; Fischer et al., 2009).
The large-scale agricultural production of antibodies is currently limited by plant-specific
N- and 0-glycosylation profiles; however, several strategies have been developed to
humanize plant glycosylation profiles (Gomord et al., 2010).
Antibody production in plants can be divided into two stages: the expression of
antibodies in plants (upstream production) and the post-harvest processing and
purification of plant-produced antibodies (downstream processing). With the advent of
improved expression technologies (i.e. magnlCON®), high antibody bioaccumulation
levels have been achieved in plants (Bendandi et al., 2010; Giritch et al., 2006).
Furthermore, the established infrastructure for large-scale agriculture and the scale-up
potential of plants pushes the upstream production of antibodies in plants to the forefront
of alternative antibody production systems (Twyman et al., 2007). However, attaining
maximum yields of plant-produced antibodies will also require improved extraction and
purification processes since downstream processing is currently the bottleneck of plant
biopharming.
Downstream processing currently accounts for over half of the total
manufacturing costs associated with the production of therapeutic proteins in any
expression system (Roque et al., 2004). For plant-produced antibodies, post-harvest
processing and purification procedures could account for more than 80% of the total cost
of plant biopharming (Evangelista et al., 1998; Hassan et al., 2008; Mison and Curling,
2000). Therefore, despite the extensive research that has been conducted to improve the
upstream production of antibodies in plants (i.e. antibody bioaccumulation and
2
humanized glycosylation patterns), downstream costs limit the success of plant
biopharming. A simplified processing and purification scheme that is similar to, or better
than, current mammalian processes would reduce downstream processing costs (Woodard
et al., 2009). In plant processing, multiple low efficiency clarification and concentration
steps can lead to greater product losses, longer processing times, and higher costs in
comparison to antibody-purification from mammalian cell culture (Aguilar and Rito-
Palomares, 2010; Platis and Labrou, 2006; Pujol et al., 2005). Thus, to attain maximum
yields of plant-produced antibodies, the inefficiency of initial post-harvest clarification
and concentration procedures must be addressed.
The aim of this thesis was to demonstrate the effectiveness of plants as an
alternative expression system for the production of biosimilar antibodies. The research
objectives for this thesis are as follows:
• To express biosimilar trastuzumab in Nicotiana benthamiana plants using the
magnlCON® viral-based transient expression system
• To characterize plant-produced trastuzumab and compare to the innovator drug
Herceptin®
• To improve the purity of plant-produced trastuzumab
Based on the objectives listed above, the hypotheses for this thesis are:
Research Chapter 1: Plant-produced trastuzumab will be just as effective as Herceptin® at
inhibiting the proliferation of HER2-overexpressing cancer cells.
3
Research Chapter 2: A combination of hollow fiber tangential flow filtration, Protein A
affinity chromatography, and SP Sepharose cation exchange chromatography will
improve the purification of plant-produced trastuzumab.
4
2 LITERATURE REVIEW
2.1 Trastuzumab
Trastuzumab (Herceptin®) is an anti-HER2/neu humanized IgGlK antibody that is
used to treat metastatic breast cancer (Molina et al., 2001; Suzuki et al., 2007).
Herceptin® specifically targets the extracellular domain (ECD) of human epidermal
growth factor receptor 2 (HER2), a transmembrane tyrosine kinase receptor that is
overexpressed in 25-30% of breast cancers (Baselga et al., 1998; Carter et al., 1992;
Slamon et al., 1987, 1989). In clinical treatment, Herceptin® has been successfully used
as both a monotherapy (Vogel et al., 2002) and in combination with chemotherapy
(Marty et al., 2005; Slamon et al, 2001; Suzuki et al., 2007).
2.1.1 Human Epidermal Growth Factor Receptor 2 (HER2)
HER2 (pl85HER2) is a 182 kDa transmembrane tyrosine kinase receptor encoded
by the HER2 proto-oncogene (also known as neu, human homologue of the rat
neuroblastoma proto-oncogene product, or c-erbB-2, similar to the avian erythroblastosis
viral oncogene B (v-erbB) product) (Kumar et al., 1991; Lewis et al., 1993; Molina et al.,
2001; Sahin and Wiemann, 2009; Slamon et al., 1987). As a member of the ErbB family
of transmembrane receptor tyrosine kinases (RTK), HER2 is directly involved in the
regulation of normal cell growth and differentiation (Baselga and Swain, 2009; Hynes
and Stern, 1994; Suzuki et al., 2007; Yakes et al., 2002). The ErbB network consists of
four receptors, ErbBl (EGFR, HER1), ErbB2 (HER2), ErbB3 (HER3), and ErbB4
(HER4) (Baselga and Swain, 2009). Each of the four ErbB receptors is comprised of an
extracellular ligand-binding domain, a transmembrane domain, and an intracellular
5
tyrosine kinase domain (Figure 2.1A) (Fry et al., 2009; Yarden and Sliwkowski, 2001).
The extracellular ligand-binding domain consists of four subdomains (I-IV) (Citri and
Yarden, 2006). The leucine-rich repeats of subdomains I and III are specifically involved
in ligand-binding (Citri and Yarden, 2006).
Figure 2.1 The ligand-free conformation of each of the ErbB receptors (A) and the process of ErbB receptor dimerization (B). ErbB receptor dimerization begins when an extracellular ligand binds to subdomains I and III of an ErbB receptor. The interaction between a ligand and an ErbB receptor induces a conformational change that exposes the dimerization domain (subdomain II) of the ErbB receptor (Lemmon, 2009). Two ligand-bound receptors can subsequently dimerize through subdomain II (Lemmon, 2009). Receptor dimerization allows trans-phosphorylation of C-terminal tyrosine residues, which are required for activation of intracellular signalling cascades (Baselga and Swain, 2009). Reprinted by permission from Macmillan Publishers Ltd: [NATURE REVIEWS CANCER] (Baselga and Swain, 2009), copyright 2009.
6
Fourteen extracellular ligands, with conserved epidermal growth factor (EGF)
domains, can bind to the extracellular domain of the ErbB receptors (Citri and Yarden,
2006; Lazzara and Lauffenburger, 2009). Upon ligand-binding, three of the four ErbB
receptors (EGFR/Erbl, ErbB3/HER3, ErbB4/HER4) become activated and undergo a
conformational change that promotes receptor homo- or hetero-dimerization (Figure
2.IB) (Fry et al., 2009; Schmitz and Ferguson, 2009). Dimerization triggers the intrinsic
tyrosine kinase activity of the ErbB receptors, causing the trans-autophosphorylation of
tyrosine residues on the C-terminus of the receptors (Fry et al., 2009; Yakes et al., 2002).
Binding of signal transducers and adapter molecules to these phosphorylated sites
initiates various intracellular cascades involved in the regulation of cell-cycle progression
and cell proliferation (Fry et al., 2009; Mohsin et al., 2005; Yakes et al., 2002).
Control of cell growth and differentiation through ErbB signal transduction is
highly complex (Figure 2.2) (Alroy and Yarden, 1997; Baselga and Albanell, 2001).
Fourteen different extracellular ligands can bind and activate ErbB receptor dimerization
(Alroy and Yarden, 1997; Citri and Yarden, 2006). In turn, the various combinations of
ligand-induced receptor dimers determine which intracellular signalling pathways are
triggered (Baselga and Albanell, 2001; Alroy and Yarden, 1997). HER2 and ErbB3 are
non-autonomous receptors (Citri and Yarden, 2006): HER2 exists in a conformational
state that mimics a ligand-bound receptor conformation (Citri and Yarden, 2006; Klapper
et al., 1999) and ErbB3 lacks the intrinsic tyrosine kinase activity required for signal
transmission within the cell (Citri and Yarden, 2006; Guy et al., 1994) (Figure 2.1A).
7
0 u , P u t [Apoptosia ] [ Migration ) [ Growth ] [ Adhesion ] j Difleramiatiorij
Figure 2.2 Representation of the effects of epidermal growth factor receptor (EGF) and neuregulin 4 (NRG4) on the ErbB signalling network, (a) Binding of a ligand (green boxes) to the extracellular domain of an ErbB receptor (green circles) induces a conformational change that allows receptor homo- or heterodimerization to occur (input layer; green). The ErbB ligands in this figure are transforming growth factor-a (TGF-a), epidermal growth factor receptor (EGF), epiregulin, (3-cellulin, heparin-binding EGF (HB-EGF), amphiregulin, and neuregulin la, ip, 2a, 20, 3 and 4 (NRGla, IP, 2a, 2p, 3, and 4, respectively). The ErbB ligands biregulin and epigen (Lazzara and Lauffenburger, 2009) are not represented in this figure. The receptor(s) to which a particular ligand binds is (are) represented in parentheses within the green boxes. ErbB2 (HER2) does not bind any ligands and is represented by a complete green circle. ErbB3 (HER3) does not posses intrinsic tyrosine kinase activity and is represented by a complete green circle with an X. (b) Binding of adaptors and enzymes to phosphorylated tyrosine residues on the C-terminus of the ErbB dimers initiates various intracellular signalling cascades (signal-processing layer; blue) that (c) regulate cell adhesion, apoptosis, differentiation, growth, and migration (output layer; yellow). For simplicity, only a portion of the cascades and transcription factors involved in the ErbB signaling network are shown in this figure. Reprinted by permission from Macmillan Publishers Ltd: [NATURE REVIEWS MOLECULAR CELL BIOLOGY] (Yarden and Sliwkowski, 2001), copyright 2001.
8
Although not directly involved in ligand binding, HER2 is the preferred
heterodimeric partner for other ErbB receptors (Fry et al., 2009; Schmitz et al., 2009;
Yakes et al., 2002). As reviewed by Citri and Yarden (2006), HER2 heterodimers induce
stronger mitogenic signals due to stronger ligand-receptor interactions, recruit a more
diverse group of phosphotyrosine-binding proteins for signal transmission within the cell
(Jones et al., 2006), and undergo slower signal attenuation (i.e. receptor endocytosis and
recycling) (Baulida et al., 1996; Lenferink et al., 1998; Worthylake et al., 1999).
The occurrence of HER2 related breast cancer results from the amplification of
the gene encoding the HER2 protein (i.e. multiple copies of that gene) causing
overexpression of HER2 (Slamon et al., 1989; Yakes et al., 2002). Overexpression of
HER2 in the cell membrane results in the spontaneous formation of HER2 multimers,
which become constitutively autophosphorylated (Samanta et al., 1994; Yakes et al.,
2002). As a result, normal HER2 signalling pathways become disrupted, causing the loss
of cell growth regulation and the development of resistance to apoptosis (Le et al., 2003;
Zhou et al., 2001). Clinical studies have shown a correlation between the extent of HER2
overexpression and the survival time of a patient (Molina et al., 2001; Slamon et al.,
1987, 1989), where patients with higher levels of HER2 typically have more aggressive
tumors and are at a higher risk for relapse or death (Slamon et al., 1987, 1989).
2.1.2 Engineering of Trastuzumab
HER2 is an ideal candidate for targeted cancer therapy using mAbs (Molina et al.,
2001) since HER2 is overexpressed in 25-30% of human breast and ovarian tumors
(Slamon et al., 1987, 1989), and has a highly accessible ECD (Molina et al., 2001). A
murine anti-HER2 mAb (mumAb 4D5), was first developed against the ECD of HER2
9
(Fendly et al., 1990; Hudziak et al., 1989). Briefly, BALB/c mice were immunized
through a series of intraperitoneal injections with HER2-overexpressing NIH 3T3/HER2-
3400 cells (Fendly et al., 1990; Hudziak et al., 1989). Mice were subsequently boosted
with intraperitoneal injections of partially-purified HER2, followed by a final intravenous
injection with enriched HER2 (Fendly et al., 1990; Hudziak et al., 1989). Splenocytes
from mice with high antibody titers were harvested and fused with mouse myeloma cells
(cell line X63-Ag8.653) to generate hybridomas expressing anti-HER2 antibodies
(Fendly et al., 1990; Hudziak et al., 1989). Of the various anti-HER2 mAbs that were
generated, murine mAb (mumAb) 4D5 was the most effective at inhibiting HER2-
overexpressing cancer cell growth in vitro (Fendly et al., 1990; Hudziak et al., 1989;
Lewis et al., 1993). However, the potential for mumAb 4D5 to be used in human therapy
was limited because of the immunogenicity of murine antibodies in humans (Baselga et
al., 1998). mumAb 4D5 also lacked the ability to mediate cytolytic effects through
recruitment of immune effector cells (Lewis et al., 1993). A humanized mAb was thus
created by engineering the complementary determining regions (CDR) of mumAb 4D5
into the framework of a human IgGl (Carter et al., 1992). The resulting humanized anti-
HER2 antibody (trastuzumab, Herceptin®; Table 2.1) was found to be as effective as
mumAb 4D5 in inhibiting the growth of cells that were overexpressing HER2 and could
also mediate cytolytic effects on tumor cells, but lacked the immunogenicity associated
with mumAb 4D5 (Carter et al., 1992; Lewis et al., 1993). Further clinical studies
demonstrated that Herceptin® is effective in treating HER2-overexpressing breast cancer
both alone (Baselga et al., 1996; Cobleigh et al., 1999; Vogel et al., 2002) and in
combination with chemotherapy (Pegram et al., 1998; Slamon et al., 2001).
10
Table 2.1 Characteristics and specifications of trastuzumab (Herceptin ) (DrugBank, 2009; United States Food and Drug Administration (FDA) Center for Drug Evaluation and Research, 2009).
Product Background
Product name Manufacturing company FDA approval date Drug bank accession
Trastuzumab; Herceptin® Genentech, Inc. 1998 DB00072, BIOD00098, BTD00098
Product Description
Type of antibody Source Production host Target
IgGlK Humanized murine antibody Chinese hamster ovary (CHO) cells Extracellular domain (ECD) of HER2
Protein Specifications
Chemical structure Binding affinity Isoelectric point (pi) Molecular weight (MW)
C6470H10012N1726O2013S42 Kd = 5 nM 8.45 145.5 kDa
Therapy
Administration Loading dose Maintenance dose Half life
Intravenous (IV) infusion 4 mg/kg body weight 2 mg/kg body weight 2-12 days
2.1.3 Mechanism of Action
Herceptin® regulates the uncontrolled growth of cells overexpressing HER2 in
vivo through several direct and indirect molecular mechanisms, including the induction of
both cytostatic and cytolytic effects (Beano et al., 2008; Varchetta et al., 2007).
2.1.3.1 Cytostatic Effects
The cytostatic effects induced by Herceptin® include accelerated receptor
endocytosis and degradation (Baselga and Albanell, 2001; De Santes et al., 1992; Sarup
et al., 1991), prevention of HER2 ECD cleavage (reviewed by Baselga and Albanell,
11
2001) as well as reduced tyrosine phosphorylation (Kumar et al., 1991), which disrupts
initiation of intracellular cascades involved in cell-cycle progression and cell proliferation
(Mohsin et al., 2005; Molina et al., 2001; Varchetta et al., 2007; Yakes et al., 2002).
As reviewed by Shepard et al. (2008), some of the additional effects of
Herceptin® include an increased response to tumor necrosis factor-a (TNF-a) mediated
growth inhibition (Hudziak et al., 1989), decreased production of interleukin (IL-8) and
vascular endothelial growth factor (VEGF) (both proangiogenic factors) (Wen et al.,
2006), and decreased expression of CXCR4, a chemokine receptor involved in metastasis
(Li et al., 2004).
2.1.3.1.1 Arrest of Cell-Cycle Progression
Herceptin® mediates the arrest of cell-cycle progression by blocking HER-
overexpressing cells from transitioning from the first gap phase (Gl) to the DNA
synthesis phase (S) of the cell cycle (Figure 2.3) (Lane et al., 2001). Cell-cycle
progression is controlled within the cell by the family of cyclin-dependent kinases (CDK)
(Lane et al., 2001). Specifically, cyclin ECDK2 is involved in regulating the Gl/S
transition of the cell cycle (Lane et al., 2001; Sherr and Roberts, 1999). p27&pl is a CDK-
inhibitor that regulates the activity of cyclin ECDK2 (Le et al., 2003). By binding to the
cyclin ECDK2 complex during the Gl phase of the cell cycle, p27IOpl prevents the
initiation of DNA synthesis (Le et al., 2003; Sherr and Roberts, 1999). CDK-inhibition
by p27Kjpl depends on cellular levels of the inhibitor (Le et al., 2003). Cell proliferation
will proceed when p27Kjpl levels are low; however, if p27Kipl levels are high, cell
proliferation is arrested and the cell exits the cell cycle (Le et al., 2003). A correlation
between HER2 overexpression and low cellular levels of p27Kjpl was found in primary
12
breast tumor samples (Yang et al., 2000). Specifically, HER2 mediated signals have been
linked to the increased degradation of p27Kipl within the cell (Yang et al., 2000).
Overexpression of HER2 thus leads to lower levels of p27Kipl and the excessive cell
growth associated with tumors (Yang et al., 2000). Researchers have shown that
Herceptin® arrests the proliferation of HER2-overexpressing cells by affecting receptor
signalling that leads to the sequestration of p27KipI and that prevents the formation of
p27Kipl/Cdk2 (Lane et al., 2001; Le et al., 2000, 2003). As reviewed by Baselga and
Albanell (2001), treatment with mumAb 4D5 or Herceptin® increases the number of
HER2-overexpressing cells in the Go/Gi phase by 10%, while decreasing the number of
cells in the S phase (Sliwkowski et al., 1999). In another study, Herceptin® was found to
block the transition from Gl to S in almost all HER2-overexpressing cells (Lane et al.,
2001).
M G2 ^ ^ ^ ^
UP Figure 2.3 The mammalian cell cycle. Go, Gap phase 0/resting phase; Gi and G2, Gap
phases 1 and 2, respectively; M, mitosis; S, DNA synthesis. Reprinted with modifications by permission from Macmillan Publishers Ltd: [NATURE REVIEWS MOLECULAR CELL BIOLOGY] (Reed, 2003), copyright 2003.
13
2.1.3.2 Cytolytic Effects
Herceptin® mediates cytolytic effects by triggering antibody-dependent cellular
cytotoxicity (ADCC) (Arnould et al., 2006; Beano et al., 2008; Suzuki et al., 2007;
Varchetta et al., 2007). Within the body, antibody-coated cells become targeted for lysis
by cytotoxic cells such as natural killer (NK) cells, macrophages, monocytes, and
neutrophils (Kindt et al., 2007; Suzuki et al., 2007). Binding of Herceptin® to the ECD of
HER2 specifically causes increased infiltration of NK cells to the site of the tumor
(Arnould et al., 2006). Targeted cell lysis is triggered by the interaction between the Fey
receptor Ilia on cytotoxic cells of the immune system and the Fc region of Herceptin®
(Kindt et al., 2007; Suzuki et al., 2007). The release of lytic enzymes, perforin,
granzymes and cytokines by the infiltrated NK cells leads to the destruction of the
targeted cells (Kindt et al., 2007; Shepard et al., 2008; Varchetta et al., 2007).
HER2-overexpression in NIH 3T3 cells has been shown to decrease sensitivity to
TNF-a and cytotoxicity induced by activated macrophages (Hudziak et al., 1988). HER2-
overexpressing breast tumor cell lines also showed resistance to TNF-a induced
cytotoxicity (Hudziak et al, 1989). Stimulation of the apoptotic pathway by TNF-a is the
natural antitumor response of the innate immune system (Shepard and Lewis, 1988;
Vivanco and Sawyers, 2002). Under normal cellular conditions, transphosphorylation of
HER2 leads to the activation of the phosphatidyhnositol 3-kinase (PI3K)/protein kinase B
(PKB; Akt) pathway (Vivanco and Sawyers, 2002; Zhou et al., 2000). The PI3K/Akt
pathway is highly regulated due to its involvement in cell growth, proliferation, adhesion
and motility (Vivanco and Sawyers, 2002; Zhou et al, 2000). Upregulation of the
PI3K/Akt pathway and subsequent activation of Akt and nuclear factor-kappa B (NF-KB)
14
leads to the resistance to apoptotic stimuli induced by TNF-a (Vanhaesebroeck and
Waterfield, 1999; Vivanco and Sawyers, 2002; Zhou et al., 2000). By binding to HER2,
Herceptin® prevents signalling to the PI3K/Akt pathway and subsequently sensitizes cells
to TNF-a induced apoptosis (Hudziak et al., 1989; Mohsin et al., 2005; Yakes et al.,
2002).
2.2 Plant Biopharming of Therapeutic Antibodies
Mammalian cell expression systems are traditionally used for the production
therapeutic antibodies; however, these systems are limited by time consuming culturing
processes and are associated with high cost. Plants have proven to be successful for the
production of recombinant antibodies (Hiatt et al., 1989) and in comparison to
mammalian systems, offer the advantages of minimal upstream production costs, ease of
handling (i.e. crop maintenance and scalability), and biological safety due to the absence
of human pathogens such as prions or viruses (Hiatt et al., 1989; Roque et al., 2004;
Schillberg et al, 2003).
2.2.1 Expression of Antibodies in Plants
Antibody expression in plants can be achieved using three different systems:
direct gene transfer, Agrobacterium-medi&tQd stable transformation or viral-based
expression. Using these systems, antibody expression has been achieved in a wide variety
of hosts including alfalfa, algae, duckweed, lettuce, maize, moss, potato, wheat, rice,
soybean, and tobacco (Nikolov et al., 2009). Antibody expression can also be targeted to
different cellular locations (i.e. apoplast, cytosol, ER, and plastids). A comprehensive list
of the various antibodies that have been expressed in plants is provided in De Muynck et
al. (2010) and Fischer et al. (2009).
15
2.2.1.1 Glycosylation
Plant and mammalian cells have similar secretory pathways. Therefore, plant-
produced antibodies undergo protein folding and post-translational modifications
resembling those that occur in mammalian cells (Hiatt et al., 1989; Schillberg et al.,
2003). However, plant-specific N- and O-glycosylation patterns may affect antibody
efficacy and/or be immunogenic in human therapy (Chargelegue et al., 2000). There are
currently three main strategies to address the differences between plant and mammalian
glycosylation patterns: incorporation of endoplasmic reticulum (ER) retention signals,
inactivation of endogenous plant glycosyltransferases and expression of mammalian
glycosyltransferases in plants (reviewed in Gomord et al., 2010). ER retention signals
(i.e. lysine-aspartate-glutamate-leucine, KDEL, or histidine-aspartate-glutamate-leucine,
HDEL) can be added to the C-terminal ends of the heavy and light chains to retain the
antibody in the ER, (i.e. where protein glycosylation is more conserved between plants
and mammals) (Gomord et al., 2010). In contrast, RNA interference (RNAi) technology
can be used to inactivate endogenous plant glycosyltransferases such as (3(1,2)-
xylosyltransferase and a(l,3)-fucosyltransferase to prevent the addition of the plant-
specific glycans (31,2-xylose and cd,3-fucose (Cox et al., 2006; Strasser et al., 2008,
2009). Finally, mammalian glycosyltransferases such as pi,4-galactosyltransferase
(GalT) can be expressed in plants for the addition of the mammalian-specific glycan
pl,4-galactose (Bakker et al., 2006; Frey et al., 2009; Vezina et al., 2009).
2.2.2 Purification of Antibodies from Plants
Post-harvest processing and purification procedures can account for more than
80% of the total cost of plant biopharming, thus making extraction of antibodies and
16
other proteins from plants one of the greatest barriers to using plants as bioreactors
(Evangelista et al., 1998; Hassan et al., 2008; Mison et al., 2000). Inefficiency arises from
the numerous purification steps that are required to separate plant-produced antibodies
from the complex mixture of plant proteins, alkaloids, pigments, polyphenols, and
mucilages (Platis et al., 2008; Valdes et al., 2003). There is currently no universal
strategy for the purification of plant-produced antibodies; however, most schemes employ
the same series of steps (grinding and extraction, clarification and enrichment, capture
and purification, and polishing).
2.2.2.1 Grinding and Extraction
Downstream processing and purification strategies are largely dependent on the
composition of the starting material (Roque et al., 2004). Initial antibody extraction is
thus the most important post-harvest step since it releases the antibody from the plant
tissue (Hassan et al., 2008; Menkhaus et al., 2004). The extraction conditions will also
determine the ratio of the target antibody to unwanted plant contaminants such as
pigments, proteins, and enzymes that may cause antibody degradation (Hassan et al.,
2008).
Antibody expression has been achieved in a wide variety of plant hosts, tissues
and cellular locations (i.e. the ER, the cytoplasm, the chloroplast or the apoplast)
(Menkhaus et al., 2004). Consequently, the selection of appropriate extraction techniques
and conditions can depend on where the antibody is expressed. Efficient disruption of the
cell wall and membrane are required, for example, to ensure maximum antibody
extraction (Cox et al., 2009). Small-scale plant extraction can be achieved through
manual grinding of fresh or nitrogen-frozen tissue in a mortar with a pestle or through
17
mechanical grinding with a mixer mill or blender (Hassan et al., 2008; Menkhaus et al.,
2004). In contrast, large-scale plant extraction is typically conducted using mechanical
disruption equipment including hammer mills, high-shear rotor-stator mixers, and/or
high-pressure homogenizers (Nikolov et al., 2009). The disruption of plant tissue is
usually conducted in the presence of an extraction buffer; however, the ratio of buffer to
tissue must be optimized since larger volumes increase the total process time and cost.
Fresh leaf tissue from plants such as Nicotiana tabacum are composed of 80-90% water
and can thus be ground with the addition of little to no buffer (Valdes et al., 2003). In
contrast, seeds have a much lower water content (-10%) and thus require more buffer
and/or additional steps to ensure efficient extraction (Nikolov et al., 2009).
Buffer properties and composition are very important parameters to consider for
antibody extraction from plants, for example, high pH can increase antibody degradation
or reduce extraction efficiency (Hassan et al., 2008; Menkhaus et al., 2004). The addition
of detergents to the extraction buffer can increase the solubility of the target antibody and
plant proteins, while protease inhibitor cocktails and antioxidants can prevent
modification of the target antibody through degradation and/or oxidation. The
temperature, pH, and ionic strength of the extraction buffer will affect antibody stability
and solubility and thus the efficiency of antibody extraction from plant tissues (Menkhaus
et al., 2004; Nikolov et al., 2009). Buffer properties and composition can also improve
the selective extraction of the antibody over that of the contaminants.
2.2.2.2 Clarification and Enrichment
The purpose of adding a clarification step to a purification scheme is to remove
extraneous particles and macromolecules from the feed sample. Particulates and other
18
extraneous particles may cause fouling in a chromatography column. In addition,
phenolic compounds and anionic proteins present in crude plant extracts can interfere
with the performance of a chromatography column by decreasing its binding capacity, or
by causing the resin to develop ion-exchange properties due to the non-specific binding
of proteins and oligosaccharides (Platis et al., 2006). Clarification of crude plant extracts
thus extends the lifetime of a column by reducing contaminants within the feed sample.
Antibody recovery can also be enhanced by selectively isolating and enriching the
subcellular compartment containing the antibody, e.g. expression in chloroplasts followed
by their selective isolation by centrifugation (Seon et al., 2002).
Several different techniques have been employed, alone or in combination, to
clarify crude plant extracts and/or enrich the target antibody. These techniques include
acid precipitation (Woodard et al., 2009), ammonium sulfate precipitation (Grohs et al.,
2010; Huang et al., 2010), aqueous two-phase partitioning systems (ATPS) (Platis and
Labrou, 2006; Platis et al., 2008), centrifugation, dead-end filtration, ELP fusion proteins
(ELPylation) (Floss et al., 2010), and flat panel tangential flow filtration (Fischer et al.,
1999; Yuetal., 2008a).
2.2.2.2.1 Aqueous Two-Phase Partitioning System (ATPS)
The extraction of an antibody from a crude plant extract can be achieved using
aqueous two-phase partitioning (Platis and Labrou, 2006; Platis et al., 2008). Antibody
separation by ATPS is achieved by mixing two immiscible reagents, such as
poly(ethylene glycol) (PEG), dextran, other polymers, or salts, to form two distinct
phases (Balasubramaniam et al., 2003; Platis and Labrou, 2006). When a crude plant
extract is mixed with the two immiscible reagents, plant proteins and contaminants
19
separate into one of the two phases based on size, conformation, charge and
hydrophobicity. System properties such as polymer molecular mass and concentration,
salt concentration, ionic strength and pH can be optimized to minimize partitioning of
contaminants into the same phase as the antibody (Balasubramaniam et al., 2003; Platis
and Labrou, 2006). A PEG-potassium phosphate system has been specifically developed
to facilitate the purification of therapeutic antibodies (anti-HIV mAbs 2F5, 2G12, and
4E10) from N. tabacum plants (Platis and Labrou, 2006; Platis et al., 2008). Due to the
phenol-complexing properties of PEG, clarification of plant extracts by ATPS
successfully separated phenols and alkaloids from the target antibodies. Overall, plant
contaminants were reduced by 2-4 fold, while achieving 84-95% antibody recovery
(Platis and Labrou, 2006; Platis et al, 2008).
2.2.2.2.2 ELP Fusion Protein (ELPylation)
Elastin like-polypeptides (ELP) are synthetic polypeptides composed of the
repeating amino acid sequence Val-Pro-Gly-Xaa-Gly, where Xaa is any amino acid
except Pro (Conley et al., 2009; Floss et al., 2010). In a process called inverse transition
cycling (ITC), ELPs undergo temperature-dependent reversible transitions between
soluble monomers (below the transition temperature (Tt)) and insoluble aggregates
(above the Tt) (Floss et al., 2010). The purification of antibodies can be facilitated
through fusion of the antibody to the C-terminal ends of ELPs (ELPylation). Increasing
the temperature above the Tt induces the formation of ELP-antibody aggregates, which
can be separated from other proteins and compounds through centrifugation. Decreasing
the reaction temperature below the Tt allows the ELP-antibody fusions in the pellet to be
resolubilized in buffer. The antibody is subsequently released from the ELP through
20
proteolytic cleavage, a pH/temperature shift or treatment with dithiothreitol. In planta,
ELPylation has been specifically shown to increase the stability and expression levels of
both full-length antibodies and antibody fragments. ELPylation has also been used to
facilitate the purification of plant-produced antibodies and antibody fragments through
selective enrichment of the antibodies prior to chromatography (Floss et al., 2010).
2.2.2.2.3 Filtration
Microfiltration is a commonly used technique for the clarification, separation, and
purification of proteins (Saxena et al., 2009). There are two types of filtration: dead-end
filtration and tangential flow filtration (TFF). In dead-end filtration, the sample passes
perpendicular to the membrane (Figure 2.4A) (Ballew et al., 2002; Belfort et al., 1994).
The transmembrane pressure (TMP) drop, or the pressure difference between the two
sides of the membrane, is the force that drives sample permeation (Belfort et al., 1994;
Czermak et al., 2007). In dead-end filtration, the TMP is determined by the equation
(Ballew et al., 2002):
1 JVL.P— .r inlet — xpermeate
In this equation, Piniet and Pretentate represent the pressure of the feed sample and retentate,
respectively (Ballew et al., 2002). During filtration, increasing the TMP can lead to a
proportional increase in permeation rate; however, solutes in the feed sample begin to
adsorb to the surface of the membrane and block the pores (Ballew et al., 2002; Belfort et
al., 1994). As a result, the permeation rate decreases and the membrane begins to foul
(Ballew et al., 2002; Belfort et al., 1994).
21
Inlet B
ir ' t \t ••*>• \t \ m, Inlet ~> Retentate
• III •
Permeate Permeate
Figure 2.4 Schematic representation of the two types of microfiltration: dead-end filtration (A) and tangential flow filtration (B). Arrows indicate the direction of the sample relative to the membrane. Reprinted with modifications by permission from Spectrum Laboratories: (Ballew et al. 2002), copyright 2002.
In TFF, the sample passes parallel or tangential to the membrane (Figure 2.4B)
(Ballew et al., 2002; Belfort et al., 1994). In TFF, the TMP is also dependent on the
retentate pressure (PR) where (Ballew et al., 2002):
TMP=P"1'et+Pretentate-Ppemeate
Similar to dead-end filtration, the permeation rate of the sample (flux) is
proportional to the TMP (Ballew et al., 2002). Increasing the pressure exerted on the
membrane can thus also lead to the adsorption of solutes to the surface of the membrane;
however, increasing the velocity of the sample (shear rate) can help to prevent the build
up of solutes. In TFF, the permeate flux is driven by a balance between the TMP drop and
the shear rate, but is also affected by factors such as temperature, feed concentration and
membrane selectivity (Ballew et al., 2002).
22
TFF can be used to clarify hard-to-filter solutions such as crude plant extracts,
which quickly cause membrane fouling when conventional dead-end filtration methods
are used (Stoger et al., 2004). There are several different tangential flow module
configurations: hollow fiber, tubular, flat plate, spiral wound and rotating (reviewed in
Hill and Bender, 2007; Zeman and Zydney, 1996b). Each configuration offers different
advantages such as lower manufacturing and processing costs, increased surface area,
lower shear rates, and scalability (reviewed in Hill and Bender, 2007; Zeman and
Zydney, 1996b). In contrast to other techniques, clarification by tangential flow
microfiltration does not require any phase changes or chemical additives, which may
affect the stability and structural activity of the antibody (i.e. through protein
denaturation, deactivation, and/or degradation) (Zeman and Zydney, 1996a). To date,
only flat panel TFF has been used to clarify crude plant extracts for the purification of
plant-produced antibodies (Fischer et al., 1999; Yu et al., 2008a).
2.2.2.3 Antibody Capture and Purification
Similar to antibody purification from mammalian cell cultures, conventional
techniques such as bioaffinity (Protein A, G, and L) chromatography, expanded-bed
adsorption (EBA) chromatography, ion-exchange chromatography (IEC), immobilized
metal affinity chromatography (IMAC) (reviewed in Hussack et al., 2010; Nikolov et al.,
2009), and membrane chromatographic processes (Yu et al., 2008a, 2008b) have all been
used to purify plant-produced antibodies. Fusion of affinity tags (i.e. a polyhistidine or c-
MYC tag) can also facilitate the purification of plant-produced antibodies and antibody
fragments, although it must be remembered that these tags may affect the properties of
therapeutic antibodies (i.e. protein folding, stability, and immunogenicity).
23
Due to the high selectivity of the technique, Protein A chromatography still
remains the most commonly used technique for the purification of full-length antibodies
(Platis et al., 2008). However, Protein A chromatography is associated with high cost and
is subject to instability of the ligand (Platis et al., 2008; Terman, 1985a, 1985b). As a
result, numerous strategies have also been devised to circumvent the high costs associated
with traditional column chromatography and include, for example, the use of engineered
affinity ligands (Hussack et al., 2010) and oilbodies (Seon et al., 2002).
2.2.2.4 SemBioSys Oilbody Purification Platform
Oilbodies are plant-seed organelles that store lipids (Seon et al., 2002). For
example, in safflower seeds, triacylglycerols (TAG) are encapsulated by a phospholipid
monolayer containing structural proteins called oleosins; this structure is known as an
oilbody. The hydrophobic central core of the oleosin protein is found embedded in the
phospholipid membrane surrounding the oil, while the hydrophilic N- and C-termini are
found on the cytoplasmic side of the oilbody. Fusion of recombinant proteins to either the
N- or C-terminal of the oleosin polypeptide can be achieved without affecting oilbody
structure (Seon et al., 2002). Oilbodies have specifically been exploited for the
purification of plant-produced antibodies by creating oilbodies that display recombinant
Protein A-oleosin fusions (Gomord et al., 2004). Antibody expression can be
subsequently targeted to the seeds of plants expressing the recombinant oilbodies. During
seed extraction, the oilbodies remain intact and bind plant-produced antibodies through
the Protein A molecules fused to oleosin. Centrifugation of the crude aqueous extract
results in the formation of an immiscible oilbody layer on the surface of the crude
aqueous extract (Parmenter et al., 1995; Rooijen and Moloney, 1995). Following removal
24
of the aqueous extract, plant-produced antibodies that are bound to the oilbodies via
Protein A are eluted under acidic conditions (Gomord et al., 2004). The purification of
plant-produced antibodies from leaf tissues may also be achieved by combining the crude
aqueous extract from antibody-expressing leaf tissue with the recombinant oilbodies
previously extracted from seeds.
2.2.2.5 Polishing
The cost efficiency of plant biopharming is highly dependent on the required level
of antibody purity (Twyman et al., 2005). Plant contaminants and antibody-related
impurities can affect the safety and efficacy of therapeutic antibodies by causing
sensitization and allergic reactions, toxic effects on patients and/or product instability and
altered biodistribution (Miele, 1997). Leaching of Protein A during purification is also an
issue since Protein A is both immunogenic and toxic (Platis et al., 2008; Terman, 1985a,
1985b). Plant-produced, as well as mammalian cell-produced, therapeutic antibodies
must therefore undergo one or two polishing steps to ensure that the antibody
preparations are devoid of significant levels of all contaminants (e.g. antibody aggregates
and fragments, contaminating proteins and peptides, DNA, endotoxins, leached Protein
A, and plant contaminants) (Nikolov et al., 2009). Antibody-related impurities and other
contaminants can be removed using combinations of anion exchange chromatography
(AEX), cation exchange chromatography (CEX), ceramic hydroxyapatite (CHT)
chromatography, hydrophobic charge induction chromatography (HCIC), and
hydrophobic interaction chromatography (HIC) (reviewed in Nikolov et al., 2009).
25
2.2.3 Characterization of Plant-Produced Antibodies
The fixed requirement of any expression system and purification scheme is to
ensure the consistency, purity, and safety of the antibody. In addition, the structure and
function of the antibody must not be altered. Antibody variants that differ in charge,
hydrophobicity, and/or size are easily generated during antibody expression, processing,
and purification (Liu et al., 2008). Antibody heterogeneity arises from chemical
modifications (i.e. disulfide bonds, deamidation, glycosylation, oxidation, and
truncation), noncovalent interactions, and/or aggregation (Liu et al., 2008). Several
different biochemical and biological assays must thus be conducted to characterize a
therapeutic antibody.
Biochemical techniques are used to examine the molecular integrity of the
antibody. Isoelectric focusing (IEF) and ion exchange chromatography, for example, can
be used to determine charge variants, while HIC and reverse phase (RP) chromatography
are used to determine differences in hydrophobicity. SEC, sodium dodecyl sulfate-
polyacrylamide gel electrophoresis (SDS-PAGE), sodium dodecyl sulfate-capillary
electrophoresis (SDS-CE) and mass spectrometry (MS) are all techniques that identify
size variants (Beck et al., 2005; Liu et al., 2008). Furthermore, enzyme-linked
immunosorbent assays (ELISA) and surface plasmon resonance (SPR) can be used to
examine antibody affinity and specificity. In contrast, biological assays are used to
measure antibody-induced biological effects in vitro (i.e. metabolic activity, downstream
signalling, and immune effector functions). For biosimilar antibodies, biochemical and
biological assays are also used to confirm antibody identity and efficacy compared to the
innovator drug.
26
2.3 Affinity Chromatography
Among the various purification processes, affinity chromatography is the most
widely used in the isolation of recombinant antibodies (Roque et al., 2004, 2007). First
described by Cuatrecasas and colleagues in 1968, affinity chromatography exploits the
specific and reversible interactions between biological molecules (Clonis, 2006; Hage
and Ruhn, 2006; Roque et al., 2007). The biological interactions most commonly used in
affinity chromatography include the binding of an enzyme and substrate, an antibody and
an antigen, and a hormone to its receptor (Hage and Ruhn, 2006; Phillips and Dickens,
2000a). As a result of these highly specific interactions, affinity chromatography
decreases non-specific interactions while maximizing product yields (Roque et al., 2007).
The bio-molecular recognition between a solute and ligand also facilitates protein
purification from dilute solutions (Roque et al., 2007). Affinity chromatography can thus
be used in the isolation of recombinant antibodies (Roque et al., 2007).
2.3.1 Affinity Purification Scheme
Protein purification by affinity chromatography is dependent on the highly
specific and reversible interactions between biological molecules (Clonis, 2006; Hage
and Ruhn, 2006; Roque et al., 2007). By immobilizing of one of the interacting molecules
onto a solid support the target binding partner can be purified from a complex mixture of
compounds (Hage and Ruhn, 2006). In affinity chromatography, the ligand refers to the
immobilized binding partner, while the solute refers to the target molecule to be purified
(Hage and Ruhn, 2006).
27
The affinity chromatography purification scheme begins when the mobile phase, a
crude extract containing the target solute, is applied to an affinity column (Figure 2.5)
(Hage and Ruhn, 2006; Roque et al., 2007). Crude extracts can be derived from a variety
of sources including blood fractions, cell culture supernatants or cell extracts from
bacterial, mammalian, and plant sources (Huse et al., 2002). Application of the crude
extract to the column requires prior mixing with an application buffer, which provides the
pH and the ionic strength required to promote binding between the solute to be purified
and the stationary phase (the affinity resin with immobilized affinity ligand) (Hage and
Ruhn, 2006).
During sample application, the target solute can interact with the stationary phase
through non-covalent interactions such as ion attractive interactions, hydrogen bonds,
hydrophobic interactions and/or van der Waals forces (Janson and Jonsson, 1998; Phillips
et al., 2000a). The solutes that interact with the ligand are subsequently retained on the
affinity resin (Hage and Ruhn, 2006). The solutes that do not interact with the ligand
remain in the mobile phase and pass through the column to form the non-retained peak of
an affinity chromatogram (Hage and Ruhn, 2006). To ensure the removal of all
contaminating solutes, a series of washings are performed, by passing application buffer
through the column (Roque et al., 2007).
Elution of the target solute from the column requires the application of an eluant
to disrupt the specific interaction between the ligand and the target solute (Hage and
Ruhn, 2006). Once the target solute enters the mobile phase, it passes from the column
and forms the elution peak on an affinity chromatogram (Hage and Ruhn, 2006). Finally,
28
the application buffer is passed through the column to remove the harsh elution buffer
and regenerate the affinity resin (Hage and Ruhn, 2006; Ostrove, 1990).
A
o n o
-a ii - & a in -^ iv ^ < —> ^a° —> * — • «
i ii iii iv v
EFFLUENT VOLUME •
Figure 2.5 Affinity chromatography purification scheme represented by an affinity column (A) and typical chromatograph (B). The crude extract containing the target solute is applied to the column (i). The solutes that interact with the stationary phase are retained on the column, while all other solutes (i.e. contaminants) in the mobile phase pass through to form the non-retained peak (ii). The column is washed to remove any remaining contaminants (iii). An eluant is applied to the column (iv) to elute the target solute (v). An introduction to affinity chromatography, by Hage and Ruhn, in Handbook of Affinity Chromatography, Second Edition. Copyright 2006 by Taylor & Francis Group. Reproduced with modifications with permission of Taylor & Francis Group via Copyright Clearance Center. Figure originally appeared in Hage (1998).
29
2.3.1.1 Affinity Purification Scheme - Binding
The highly specific and reversible interaction between a target solute (S) and an
immobilized ligand (L) is represented by (Hage et al., 2006b; Mohr and Pommerening,
1985a; Nelson and Cox, 2005):
ka S + L - SL
ka
SL represents the complex formed between the solute and the ligand, ka represents the
second-order association constant and ka represents the first order dissociation constant
(Hage et al., 2006b; Mohr and Pommerening, 1985a; Nelson et al., 2005). The association
equilibrium constant (Ka) can be used to quantify the affinity of the solute for the ligand
(Hage et al., 2006b; Nelson and Cox, 2005).
^ k a [S][L]
kd [SL]
At the reaction equilibrium, [S] is the concentration of the solute remaining in the mobile
phase, [L] is the concentration of immobilized ligand without bound solute and [SL] is
the concentration of the immobilized ligand with bound solute (Hage et al., 2006b). The
dissociation equilibrium constant (IQ) is also commonly used to represent the strength of
the interaction between a solute and ligand (Nelson and Cox, 2005).
Ka
30
Solute-ligand binding occurs through a combination of noncovalent interactions,
which are dependent on the collision of the solute and ligand in the right orientation
(Janson and Jonsson, 1998; Mohr and Pommerening, 1985a). Although each individual
interaction may only contribute approximately 1 kcal/mol of binding energy, the
combination of several noncovalent interactions forms a strong binding interaction
between the solute and ligand (Janson and Jonsson, 1998). The relationship between the
free energy change of the reaction (AG0) and binding strength is represented by the
following equation (Janson and Jonsson, 1998; Phillips and Dickens, 2000a):
AG°=RTlnKd
In this equation R is the gas constant (8.314 Jmol"1 K"1) and Kj (M) is the dissociation
equilibrium constant (Janson and Jonsson, 1998; Phillips and Dickens, 2000a). T
represents the reaction temperature (in degrees Kelvin), which has a direct effect on the
rotation of the solute in solution (Janson and Jonsson, 1998; Mohr and Pommerening,
1985a). The lowest dissociation equilibrium constant required to retain a solute on an
affinity column is equal to 10"5 M (Janson and Jonsson, 1998). Using the equation above,
the binding energy required for the interaction between a solute and ligand at standard
temperature (298 K) and pressure (1 atm) is thus 7 kcal/mol (Janson and Jonsson, 1998).
As each binding interaction contributes around 1 kcal/mol of binding energy, four to
eight noncovalent interactions are required to retain a solute on an affinity column
(Janson and Jonsson, 1998).
31
2.3.1.2 Affinity Purification Scheme — Elution
Elution of the target solute from a column requires the application of an eluant to
disrupt the specific interactions between the ligand and the target solute (Hage and Ruhn,
2006). Solute elution can be accomplished by using either a specific or a non-specific
eluant (Hage and Ruhn, 2006; Phillips and Dickens, 2000b). Although both elution
schemes are effective, choosing the wrong eluant can cause damage to the target solute or
to the immobilized ligand (Phillips and Dickens, 2000b).
In competitive elution, the specific eluant is a solvent that contains an analogous
solute, which will compete for binding to the immobilized ligand (Phillips and Dickens,
2000b; Roque et al., 2007). When the specific eluant is applied to the column, the target
solute is displaced from the ligand and is eluted from the column (Hage and Ruhn, 2006;
Roque et al., 2007). Competitive elution will not affect the structural integrity of the
target solute or ligand (Phillips and Dickens, 2000b).
A non-specific eluant is a solvent that disrupts the non-covalent binding
interactions between the target solute and the immobilized ligand through an increase in
ionic strength, temperature, an extreme pH or by chaotropic dissociation (Hage and Ruhn,
2006; Larsson, 1993; Roque et al., 2007). Applying a nonspecific eluant to the column
causes the target solute to dissociate from the ligand and elute from the column (Phillips
and Dickens, 2000b; Roque et al., 2007).
2.3.1.3 Factors Affecting Solute Retention
Numerous factors can affect the retention of a solute on an affinity resin (Hage et
al., 2006b; Mohr and Pommerening, 1985a; Phillips and Dickens, 2000b). The most
32
significant factors include the concentration of ligand per unit of resin and the reaction
kinetics that define the interaction between the solute and ligand (Hage et al., 2006b).
2.3.1.3.1 Reaction Kinetics
The dissociation equilibrium constant (Ka) is commonly used to represent the
strength of the interaction between a solute and ligand (Nelson and Cox, 2005). When
there is little to no affinity between the target solute and ligand (Ka> 10" M), the target
solute will elute from the column with the contaminating solutes (non-retained peak)
(Figure 2.6A; (Mohr and Pommerening, 1985a)). As the affinity between the target
solute and ligand increases (Kj< 10"3 M), the target solute will weakly interact with the
immobilized ligand. However, this weak binding affinity is not strong enough to allow
for sufficient separation of the target solute from the contaminants (Figure 2.6B). As the
affinity between the target solute and ligand increases (IQ values between 10"4 and
10"3 M), the solute will be retained on the column, thus allowing for solute separation
(Figure 2.6C). Optimal Ka values for protein separation on an affinity column range
between 10" and 10" M. These binding affinities correspond to multiple non-covalent
interactions between the target solute and the immobilized ligand. The target solute is
thus firmly retained on the column, and can only be removed by applying a specific or
nonspecific eluant (Figure 2.6D). The greater the affinity between a target solute and
ligand (Kd< 10" M), the more difficult it will be to elute the target solute from the
column (Mohr and Pommerening, 1985a).
33
t s e o 00 csi <u ( j
c €3
S-r
O VI
<
c f
I \
\ / \
Effluent Volume
Figure 2.6 Affinity chromatograms showing the effect of reaction kinetics on solute retention. No affinity between the target solute and immobilized ligand; inefficient separation of the target solute (elution peak - dashed line) from the contaminants (nonretained peak - solid line) (A). Weak affinity (Ka< 10"3 M) (B), moderate affinity (Kd = 10"4 - 10"3 M) (C) and high affinity (104 and 10"8 M) (D) between the target solute and ligand. General considerations of the adsorption and elution step by Mohr and Pommerening, in Affinity Chromatography. Copyright 1985 by Marcel Dekker, Inc. Reproduced with modifications with permission of Marcel Dekker, Inc. via Copyright Clearance Center.
Solute retention on an affinity resin can be determined by the following equation (Hage et
al., 2006b; Janson and Jonsson, 1998):
k = (Ka)(mL)
V M
(tM)
In the first equation, k represents the retention factor of the solute of interest (Hage et al,
2006b; Janson and Jonsson, 1998). mL is the amount of active ligand that is immobilized
on the affinity resin and VM represents the volume of solvent in the column (also known
as void volume) (Hage et al., 2006b; Janson and Jonsson, 1998). In the second equation,
34
tR represents the retention time of the target solute that was retained on the column and tM
represents the retention time of the solutes that were not retained on the column (Hage et
al., 2006b; Sanbe and Haginaka, 2003). Efficient protein resolution occurs when the
retention time of the target solute is much higher than the retention time of contaminating
solutes (Janson and Jonsson, 1998).
2.3.2 Affinity Resins
A wide range of ready-to-use affinity resins are currently available for the
purification of antibodies (Mohr and Pommerening, 1985b). Selection of an appropriate
resin requires careful consideration of the source of the antibody to be purified, the
antibody isotype and the required degree of purity of the final product (Huse et al., 2002;
Roque et al., 2007). The cost associated with the production or purchase of the affinity
resin is also an important factor to be considered (Roque et al., 2007). If no suitable
commercial resin is available, it may be necessary to develop a more efficient affinity
resin (Mohr and Pommerening, 1985b).
2.3.2.1 Affinity Ligands
2.3.2.1.1 Biological Ligands
Biological affinity ligands used in the purification of antibodies are isolated from
natural sources and include antigens, anti-antibodies and lectins (Clonis, 2006; Huse et
al., 2002; Roque et al., 2007). However, the most widely used group of natural ligands
are the bacterial cell wall proteins (Roque et al., 2007). Found on the cell surface of some
species of bacteria, these proteins bind immunoglobulins in the blood to prevent the host
immune system from recognizing the bacteria as a foreign agent (Hage et al., 2006a;
Huse et al., 2002).
35
Protein A, a cell wall associated protein isolated from Staphylococcus aureus, is
one of the most widely used bacterial cell wall proteins for the purification of antibodies
(Bjorck and Kronvall, 1984; Hober et al., 2007). In its native form, Protein A consists of
five homologous immunoglobulin-binding domains (E, D, A-C), each with the ability to
bind the Fc region of IgGl, IgG2, and IgG4 (Table 2.2) (Hober et al., 2007; Kronvall and
Williams, 1969; Linhult et al., 2004; Turkova, 1999). Immobilization of Protein A to a
solid support; however, results in the inactivation of the three immunoglobulin-binding
domains located at the N-terminus of Protein A (Phillips et al., 1985; Turkova, 1999).
Therefore, when used as an affinity ligand, native Protein A can only bind two
immunoglobulins (Phillips et al., 1985; Turkova, 1999).
The structures of three domains of Protein A (B, D, and E) have been solved by
protein nuclear magnetic resonance (NMR) (Gouda et al., 1992; Starovasnik et al., 1996;
Torigoe et al., 1990) and x-ray crystallography (Graille et al., 2000). Structural analysis
reveals that these domains adopt similar immunoglobulin-binding structures, each
comprised of three a-helices (Graille et al., 2000; Karimi et al., 1999). The structure of
the B domain of Protein A in complex with the Fc region of an IgG has also been
examined through x-ray crystallography (Deisenhofer, 1981). The crystal structure
indicates that two of the three helices of the B domain of Protein A bind within the region
connecting the CH2 and CH3 domains of the antibody heavy chain (Figure 2.7A)
(Deisenhofer, 1981; Starovasnik et al., 1996).
Protein G, a surface receptor isolated from groups C and G Streptococci, has a
high affinity for the Fc region of an immunoglobulin (Bjorck and Kronvall, 1984;
Phillips, 2006; Roque et al., 2004, 2007). In its native form, Protein G consists of three
36
Table 2.2 Immunoglobulins bound by the bacterial cell wall proteins: Protein A, G, and L. Abbreviations: Strong binding (+++), mild binding (++), weak binding (+), no binding (-), unknown (U). Bioaffinity chromatography, by Hage et al. (2006a), in Handbook of Affinity Chromatogarphy, Second Edition. Copyright 2006 by Taylor & Francis Group. Reproduced with modifications with permission of Taylor & Francis Group via Copyright Clearance Center.
Source
Bovine
Goat
Human
Mouse
Rabbit
Isotype Protein A Protein G Protein L
IgGi
IgG2
IgGi
IgG2
IgGj
IgG2
IgG3
IgG4
IgM
IgA,
IgA2
IgE
IgD
IgG,
IgG2a
IgG2b
IgG3
IgG
+
+++
+
+++
+++
+++
+
+++
+
+
+
++
-
+
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
-
-
-
-
-
++
+++
+++
+++
+++
-
-
-
-
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+
trThe Fc region of an antibody is bound by Protein A and G, while KI, KIII, and KIV light chains and bound by Protein L
immunoglobulin-binding domains (C1-C3), each with the ability to bind the Fc region of
an antibody (Hage et al., 2006a; Stahl et al., 1993). In addition, native Protein G contains
two albumin-binding domains, each with the ability to bind serum albumin from various
mammalian species (Hage et al., 2006a; Stahl et al., 1993; Wideback and Kronvall, 1982;
Wideback et al., 1982). In recombinant forms of Protein G, the albumin binding sites
37
CH2
CH3
CH2
CH3
Figure 2.7 Ribbon diagram showing the IgG-binding sites of the B domain of Protein A (A) and the C2 domain of Protein G (B). The B domain of Protein A is formed of three a-helices, two of which (red) bind to the CH2 side of the region joining the CH2 and CH3 domains of IgG (A; Protein Data Bank ID 1FC2; Deisenhofer, 1981). The C2 domain of Protein G is formed of an a-helix and a four-stranded P-sheet (blue), which bind within the hinge region joining the CH2 and CH3 domains of IgG (B; Protein Data Bank ID 1FCC; Sauer-Eriksson et al., 1995).
have been removed along with one immunoglobulin-binding region (C2) (Hage et al.,
2006a; Sauer-Eriksson et al., 1995). As a result, the recombinant form of Protein G
consists of only two Fc binding regions, each with the potential to bind one
immunoglobulin (Hage et al., 2006a; Jurado et al., 2006).
Protein L, a cell wall protein isolated from Peptostreptococcus magnus, is also
used in the purification of antibodies (Akerstrom and Bjorck, 1989; Jurado et al., 2006;
Phillips, 2006). In its native form, Protein L consists of five domains (B1-B5), each with
the ability to bind kappa light chain containing antibodies (Table 2.1; (Wikstrom et al.,
1994)). The Bl domain of Protein L contains an a-helix and a four-stranded P-sheet,
which bind to a conserved backbone conformation in the variable region of kappa light
38
chain containing antibodies, specifically kappa I, kappa III, and kappa IV but not kappa
IV or lambda (Graille et al., 2001; Nilson et al., 1992). As such, Protein L can be used in
the purification of both whole antibody molecules and immunoglobulin fragments such as
single-chain variable fragments (scFv) and Fab fragments without affecting the antigen
binding properties of the antibody (Akerstrom and Bjorck, 1989; Hage et al., 2006a).
2.3.2.1.2 Bioengineered Ligands
During the chromatographic process, affinity ligands are subject to the harsh
conditions required for solute elution (Linhult et al., 2004). One of the downfalls of using
biological ligands in affinity chromatography is their susceptibility to protein
denaturation or chemical cleavage during these harsh treatments (Linhult et al., 2004;
Narayanan, 1994). Bioengineered ligands resemble natural ligands such a Protein A and
Protein L, but have been engineered to provide enhanced selectivity or chemical stability
(Roque et al., 2007).
The Z domain is a recombinant form of the native B domain of Protein A, which
has been engineered to increase protein stability under alkaline conditions (Roque et al.,
2004). In alkaline conditions, proteins with asparagine residues are subject to
deamidation or backbone cleavage, where the degree of susceptibility is relative to the
primary structure of a protein (Linhult et al., 2004). A protein is particularly susceptible
to alkaline conditions when its primary structure contains an asparagine residue followed
by a glycine residue (Linhult et al., 2004). A protein that contains asparagine-glycine
residues is also susceptible to cleavage by hydroxylamine, a chemical used to cleave
proteins that have been expressed as fusions to Protein A (Hober et al., 2007; Linhult et
al., 2004). Although the B domain of Protein A is relatively stable under alkaline
39
conditions, the Z domain was engineered through two amino acid substitutions (Alai to
Val and Gly29 to Ala) to provide additional stability and resistance to cleavage by
hydroxylamine (Linhult et al., 2004; Nilsson et al., 1987; Tashiro et al., 1997). Despite
slight structural differences between the Z domain and the native B domain of Protein A,
both proteins exhibit similar binding capacities for the Fc region of antibodies (Hober et
al , 2007; Jendeberg et al , 1995; Zheng et al, 2004). The Z domain of Protein A,
however, does not bind to the Fab region of antibodies with as high of an affinity as the
native B domain (Jansson et al., 1998). The Z domain is thus a more stable purification
reagent than the B domain for the elution of recombinant antibodies under alkaline
conditions (Roque et al., 2004; Uhlen and Moks, 1990).
2.4 Conclusion
Herceptin® is an important biopharmaceutical used in the treatment of human
metastatic breast cancer. Although Herceptin® is produced by traditional mammalian cell
culture, production of a biosimilar trastuzumab in plants could alleviate the cost and
growing demand for antibody-based therapeutics. The agricultural production of
biosimilar trastuzumab was thus examined in the first research chapter of this thesis.
The large-scale agricultural production of antibodies remains limited by
inefficient downstream processing and purification procedures. A scalable scheme that
combines hollow fiber tangential flow microfiltration with Protein A affinity
chromatography and cation exchange chromatography was thus developed in the second
research chapter of this thesis.
40
3 RESEARCH CHAPTER 1: PLANT PRODUCED TRASTUZUMAB INHIBITS THE GROWTH OF HER2 POSITIVE CANCER CELLS IN VITRO
Reprinted with permission from Grohs et al., 2010. Copyright 2010 American Chemical Society.
3.1 Abstract
To study the agricultural production of biosimilar antibodies, trastuzumab
(Herceptin®) was expressed in Nicotiana benthamiana using the magnlCON® viral-based
transient expression system. Immunoblot analyses of crude plant extracts revealed that
trastuzumab accumulates within plants mostly in the fully assembled tetrameric form.
Purification of trastuzumab from N. benthamiana was achieved using a scheme that
combined ammonium sulfate precipitation with affinity chromatography. Following
purification, the specificity of the plant-produced trastuzumab for the HER2 receptor was
compared with Herceptin® and confirmed by western immunoblot. Functional assays
revealed that plant-produced trastuzumab and Herceptin® have similar in vitro anti
proliferative effects on breast cancer cells that overexpress HER2. Results confirm that
plants may be developed as an alternative to traditional antibody expression systems for
the production of therapeutic mAbs.
3.2 Introduction
Antibody research over the past 30 years has led to the development of valuable
biopharmaceuticals for the diagnosis and treatment of human disease (Nissim and
Chernajovsky, 2008). To date, the United States Food and Drug Administration (FDA)
has approved 22 monoclonal antibodies (mAb) for clinical use, while hundreds of others
are in clinical trials (Chames et al., 2009; Dimitrov and Marks, 2009). Antibodies
41
currently approved for clinical therapy have a wide range of applications, including the
treatment of microbial infections, autoimmune diseases, and cancer (Chadd and Chamow,
2001; Stoger et al., 2005). The advantage of using antibodies in therapeutic applications
is their low toxicity and high specificity for a target antigen (Ko et al., 2009); however, to
ensure the efficacy of some treatments, high antibody serum concentrations must be
maintained over a period of several months (Mori et al., 2007). One treatment cycle for a
single patient can require hundreds of milligrams to gram quantities of mAbs (Leong and
Chen, 2008; Mori et al., 2007). Therapeutic mAbs are thus among the most lucrative
products within the biopharmaceutical industry (Karg and Kallio, 2009). From 2004 to
2006, market sales of the top five therapeutic mAbs (Rituxan®, Remicade®, Herceptin®,
Humira®, and Avastin®) increased from $6.4 billion to $11.7 billion (Dimitrov and
Marks, 2009). During 2010, the market value of these antibodies is predicted to rise to
over $30 billion (Ko et al., 2009). In the past, such high market demands for
biopharmaceuticals have led to a manufacturing bottleneck (Karg and Kallio, 2009).
Therapeutic mAbs have traditionally been produced in mammalian cell systems;
however, these systems are associated with high production costs and are hindered by
time-consuming culturing processes (Birch and Racher, 2006; Roque et al., 2007). In an
attempt to meet rising market demands, pharmaceutical companies are working to
improve the efficiency of existing biopharmaceutical production systems (Birch and
Racher, 2006; Karg and Kallio, 2009) as well as increase the number of antibody
production facilities (Karg and Kallio, 2009). Following construction, these facilities
must be validated under Good Manufacturing Practice (GMP), a process that can take an
average of three years (Vezina et al., 2009). Although some improvements have been
42
made to increase antibody production, pharmaceutical companies still may not be able to
meet future demands. As a result, alternative expression systems that would allow the
production of biosimilar antibodies (follow-on biopharmaceuticals that have been proven
to be similar to innovator drugs) are also being investigated (Birch and Racher, 2006;
Covic and Kulmann, 2007; Gottlieb, 2008; Karg and Kallio, 2009).
Agricultural production of therapeutic proteins (biopharming) is one alternative to
traditional mammalian cell expression systems for the large-scale production of
therapeutic mAbs. In comparison to mammalian systems, plant bioreactors offer many
advantages for the pharmaceutical industry, including lower upstream production costs,
speed of manufacturing, indefinite scalability, and ease of handling (Arntzen, 2008;
Churchill et al., 2002). Plants also offer the advantage of biological safety, as there is no
health risk from contamination with zoonotic pathogens and toxins (Hefferon, 2010;
Huang et al., 2010). Plant biopharming is also beneficial for the agricultural industry
since biopharmed crops can be maintained and harvested using current agricultural
practices (Twyman et al., 2007), and thus provide valuable new markets for farmers
(Hussack et al., 2010). Conversely, the limitations of plant bioreactors include higher
downstream processing and purification costs, and the addition of plant-specific N-
glycans to the recombinant antibodies. Full-length recombinant antibodies were first
successfully expressed in tobacco plants in 1989 (Hiatt et al., 1989). Since then, a wide
variety of transgenic plant hosts have been successfully used for recombinant antibody
production (Fischer et al., 2009), including plants that have been genetically modified to
express recombinant antibodies with humanized A -̂glycan profiles (Gomord et al., 2010).
The expression of antibodies in plants has also been achieved using different expression
43
platforms, including both stable and transient plant transformation technologies (Ko et
al., 2009).
To achieve regulatory affirmation of plant-produced biosimilar therapeutics,
researchers must be able to demonstrate that plant-produced antibodies maintain the
identical structural and functional integrity as their mammalian counterparts (Stoger et
al., 2005). Plant-produced antibody preparations must also be analyzed to ensure that they
are homogeneous, not adversely immunogenic, and devoid of significant contaminants
(Stoger et al., 2005). No study has been conducted to date to compare a plant-produced
antibody with a clinically approved therapeutic mAb.
Trastuzumab (Herceptin®, Genentech Inc., San Francisco, CA) is a humanized
murine immunoglobulin G1K antibody that is used in the treatment of metastatic breast
cancer. Trastuzumab binds to the extracellular domain of human epidermal growth factor
receptor 2 (HER2), a member of the ErbB family of transmembrane tyrosine kinase
receptors, that is overexpressed in 20-30% of metastatic breast cancer patients (Ben-
Kasus et al., 2009; Slamon et al, 1987, 1989). Under normal cell conditions, HER2 is
directly involved in the activation of signaling pathways that mediate cell growth and
differentiation (Ben-Kasus et al., 2009; Molina et al., 2001; Suzuki et al., 2007).
Overexpression of HER2 results in the disruption of normal signaling pathways, causing
the loss of cell growth regulation and the development of resistance to apoptosis (Le et
al., 2003; Zhou et al., 2001). By targeting cells that overexpress HER2, trastuzumab
mediates the arrest of cell proliferation and the lysis of cancer cells by antibody-
dependent cellular cytotoxicity (ADCC) (Arnould et al., 2006; Beano et al., 2008; Suzuki
et al., 2007). In treatment, patients with HER2-overexpressing metastatic breast cancer
44
are administered a loading dose of 4 mg of trastuzumab/kg followed by a weekly
maintenance dose of 2 mg/kg (Cobleigh et al., 1999). Upon the basis of market demand,
treatment of human metastatic breast cancer with trastuzumab thus requires kilogram
quantities of this biopharmaceutical. An alternative expression system may therefore be
required to supply future worldwide need for therapeutic antibodies such as trastuzumab.
Genetically modified plants have proven successful for the large-scale production
of mAbs; however, no study has yet been conducted to characterize and compare a plant-
produced antibody having a primary structure identical to a clinically approved
therapeutic mAb. In this study, trastuzumab was expressed in N. benthamiana, a relative
of tobacco, using a viral-based transient expression system (Giritch et al., 2006).
Trastuzumab expression in N. benthamiana plants was quantified, and plant-purified
trastuzumab was characterized in comparison to Herceptin®. Plant-produced and
commercial trastuzumab were found to bind the same ligand and have similar in vitro
anti-proliferative effects on breast cancer cells that overexpress HER2. These results
indicate that agricultural biopharming could be developed for effective use as an
alternative to mammalian cell systems for the large-scale production of biosimilar
antibodies.
3.3 Material and Methods
3.3.1 Cell Lines and Plasmids
All cloning procedures were performed using Top 10 F' Escherichia coli cells
(Invitrogen, Burlington, Canada). Plasmids used in the magnlCON® viral-based transient
expression system (pICH21595, pICH25433 pICH20111, pICH24180 and pICH14011)
were obtained from Icon Genetics GmbH (Halle, Germany (Giritch et al., 2006)). All
45
mammary adenocarcinoma cell lines (MCF-7, SK-BR-3 and BT-474) were obtained from
American Type Culture Collection (ATCC; Rockville, MD) and cultured according to
ATCC specifications unless stated otherwise.
3.3.2 Vector Construction and Plant Infiltration
The variable coding regions of the heavy (VH) and light (VL) chains of
trastuzumab (Carter et al., 1992) were synthesized as gene segments by the PBI/NRC
DNA/Peptide Synthesis Laboratory of the National Research Council of Canada
(Saskatoon, Canada), both incorporating preferred plant codons (Almquist et al., 2006;
McLean et al., 2007; Olea-Popelka et al., 2005), a 24 amino acid N-terminal murine SP
(GenBank accession no. AAA38889.1), and 5' Xbal and 3' Notl restriction sites. The
complete heavy chain coding sequence was assembled by subcloning murine SP-VH into
the XbaVNotl sites of pMM29 (McLean et al., 2007), a plasmid containing the tobacco
optimized coding region of a human gamma-1 heavy chain constant (CH) domain fused to
a six-Histidine and a KDEL tag. Three amino acids (ASP359, Leu36i, and Lys45o) differed
between the human gamma-1 heavy chain constant domain and the heavy chain of
trastuzumab. Site directed mutagenesis was used to change ASP359 to Glu and Leu36i to
Met and to remove the Notl site. The complete heavy chain coding sequence including
murine SP was then amplified by PCR to remove Lys45o, the six-Histidine, and KDEL C-
terminal tags using primers that contained Bsal sites and was subcloned into pICH21595
(Giritch et al., 2006; Icon Genetics) to generate pMTrasHC. The complete light chain
coding sequence was assembled by subcloning murine SP-VL into the XbaVNotl sites of
pMM29 (McLean et al., 2007). The Notl site was removed by site directed mutagenesis,
and the complete light chain coding sequence including murine SP was PCR amplified
46
using primers containing Bsal sites and subcloned into pICH25433 (Giritch et al., 2006;
Icon Genetics) to generate pMTrasLC. The Arabidopsis basic Chitinase SP (Samac et al.,
1990) later replaced the murine SP in both pMTrasHC and pMTrasLC, generating
pTrasHC and pTrasLC, respectively (Figure 3.1). All primers used for the development
of pTrasHC and pTrasLC are listed in Tables 3.1 and 3.2, respectively.
LB
Lf NOSt npt II NOSp int - SP HC
RB
3'TMV NOSt
B
LB
Lf NOSt npt II NOSp mt -SP LC
RB
3' PVX NOSt u
Figure 3.1 Schematic diagram of the constructs for expression of trastuzumab in N. benthamiana; pTrasHC (A) and pTrasLC (B). Both expression constructs contain the npt II gene under the control of the nopaline synthase promoter (NOSp). NOSt: nopaline synthase terminator; LB and RB: left and right borders, respectively; AttB: recombination site; int: intron; SP: Arabidopsis basic chitinase signal peptide; HC: coding sequence of the heavy chain of trastuzumab; LC: coding sequence of the light chain of trastuzumab; 3'TMV: 3' untranslated region; 3'PVX: 3' untranslated region.
47
Table 3.1 Nucleotide sequences of the primers used in the construction of pTrasHC.
Name Type Nucleotide Sequence
Removal of Notl site
TrasHC-NotI Forward 5'-GTGACAGTATCAAGTGCTTCCACCAAGGGACCAAGC-3'
Reverse 5 '-GCTTGGTCCCTTGGTGGAAGCACTTGATACTGTCAC-3'
Amino acid modification (ASPTSQ —» Glu; L e u ^ —» Met)
TrasHC-2AA Forward 5'-CACTTCCACCTTCTAGGGAAGAAATGACAAAGAACCAAGTG AGCC-3'
Reverse 5 '-GGCTC ACTTGGTTCTTTGTCATTTCTTCCCTAGAAGGTGGAA GTG-3'
Subcloning into pICH21595 (addition of Arabidopsis basic chitinase SP, removal of Lys4S0, 6xHis and KDEL tags)
TrasHC-S Forward 5'-TTTGGTCTCAAGGTATGGCTAAAACAAATCTCTTTTTATTCTT GATTTTCTCCCTTTTACTTTCCTTAAGCTCAGCGGAAGTTCAACT TGTTGAGAGTG-3'
Reverse 5 '-TTTGGTCTCAAAGCTCATTATCCTGGGCTAAGGCTAAG-3'
Table 3.2 Nucleotide sequences of the primers used in the construction of pTrasLC.
Name Type Nucleotide Sequence
Removal of Notl site
TrasLC-NotI Forward 5'-CAAAGTTGAGATCAAGAGGACCGTGGCTGCACCAAG-3'
Reverse 5 '-CTTGGTGCAGCCACGGTCCTCTTGATCTCAACTTTG-3'
Subcloning into pICH25433 (addition of Arabidopsis basic chitinase SP)
TrasLC-S Forward 5'-TTTGGTCTCAAGGTATGGCTAAAACAAATCTCTTTTTATTCTT GATTTTCTCCCTTTTACTTTCCTTAAGCTCAGCGGACATTCAAAT GACTCAATCCC-3'
Reverse 5 '-TTTGGTCTCAAAGCTCATTAACACTCTCCTCTATTGA-3'
48
The TMV-based 5' module (pICH20111), PVX-based 5' module (pICH24180),
and integrase (pICH14011) vectors (Giritch et al., 2006; Icon Genetics) were unaltered.
All five plasmids (pICHHOl 1, pICH20111, pICH24180, pTrasHC, and pTrasLC) were
introduced into the Agrobacterium tumefaciens strain At542 by electroporation. N.
benthamiana plants were vacuum infiltrated according to the protocol described in ref
(Marillonnet et al., 2005) with several modifications. Briefly, all cultures were grown at
28°C and 220 rpm to a final optical density at 600 nm (OD6oo) of 1.8. Equal volumes
were combined and pelleted by centrifugation at 8,000 rpm for 4 min, resuspended, and
diluted by 10 in infiltration buffer (10 mM l-(7V-morpholino)ethanesulphonic acid
(MES) at pH 5.5 and 10 mM MgSC^). The aerial parts of six-week-old N. benthamiana
plants were submerged in a desiccator containing the A. tumefaciens resuspension
solution under vacuum (0.5 to 0.9 bar) for 90 s followed by a slow release of the vacuum,
after which plants were returned to the greenhouse for 8 days before being harvested.
3.3.3 SDS-PAGE and Western Blot Analyses
Fresh leaf biomass from three N. benthamiana plants was harvested 8 days post-
infiltration (d.p.i), ground separately under liquid nitrogen, and combined with two
volumes of cold extraction buffer [40 mM phosphate buffer, 50 mM ascorbic acid, and 10
mM ethylenediaminetetraacetic acid (EDTA) disodium salt dihydrate, pH 7.0]. Crude
extracts were clarified by centrifugation at 10,000 rpm for 30 min and then 5,000 rpm for
10 min at 4°C. Total soluble protein (TSP) concentration was determined using the Bio-
Rad Protein Assay (Mississauga, Canada). Bovine serum albumin (BSA; Thermo
Scientific, Nepean, Canada) was used as the protein standard. Western immunoblots were
performed as described (Almquist et al., 2006), using a mixture of goat anti-human IgG
49
y- and K-chain specific probes conjugated to alkaline phosphatase (Sigma-Aldrich,
Oakville, Canada), diluted to 1:2500 in phosphate-buffered saline, pH 7.4, containing
0.05% Tween-20 (PBST).
3.3.4 Quantitative ELISA
Ninety-six-well microtiter plates (High-binding; Corning Inc. Life Sciences,
Lowell, MA) were coated overnight at 4°C with 0.3125 ug/mL of mouse anti-human IgG
y-chain specific antibody (Sigma-Aldrich) diluted in phosphate-buffered saline (PBS) at
pH 7.4. Plates were blocked with 4% (w/v) skim milk (EMD Biosciences, Newark, NJ)
dissolved in PBS for 24 h at 4°C and then washed five times with PBST. Serial dilutions
of clarified extract from N. benthamiana plants expressing trastuzumab were added to the
plate, which was incubated at 37°C for 1 h. Serial dilutions of human myeloma IgGl
(Athens Research & Technology Inc., Athens, GA), which is of the same antibody
isotype as Herceptin , were used as a quantification standard with 10 jug of TSP from
untreated N. benthamiana plants. The plate was washed five times with PBST before
adding polyclonal rabbit anti-human IgG (H + L)-horseradish peroxidase (HRP)
conjugate (Abeam, Cambridge, MA), diluted to 1 (ag/mL in PBS, for 1 h at 37°C. The
plate was washed five times with PBST before development with 1-Step™ Turbo TMB-
ELISA (Thermo Scientific). Color development was stopped with 1.8 M sulfuric acid,
and optical densities were measured at 450 nm using an En Vision 2100 Multilabel
microtiter plate reader (Perkin-Elmer, Woodbridge, Canada). Quantitative ELISAs to
determine the expression of antibody in plants were performed in triplicate. Three
independent expression experiments were performed, involving a total of 11 plants.
50
Overall expression of the antibody is reported as the average ± standard error of the mean
for all 11 plants.
3.3.5 Antibody Purification
Infiltrated N. benthamiana leaf tissue was harvested 8 d.p.i and stored at -80°C.
Frozen leaf tissue (250 g) was combined with two volumes (500 mL) of cold extraction
buffer in a food processor (Morphy Richards Inc., Mexborough, South Yorkshire, United
Kingdom) and disrupted for three 30 s pulses. Disrupted tissue was collected and
homogenized further using a benchtop Polytron® homogenizer (PT10/35, Kinematica
Inc., Bohemia, NY). Large plant debris was removed from the homogenate by dead-end
filtration through miracloth (Calbiochem, San Diego, CA). Solid ammonium sulfate was
slowly added to the filtered homogenate to a final concentration of 20%. The plant
homogenate was then incubated at 4°C for 1 h with gentle stirring. Insoluble material was
pelleted by centrifugation at 10,000 rpm for 30 min at 4°C and the resulting supernatant
collected. The concentration of ammonium sulfate in the resulting supernatant was
subsequently increased to 60%, incubated at 4°C for 2 hs with gentle stirring, and
centrifuged at 10,000 rpm for 30 min at 4°C. Pelleted protein was resuspended in 250 mL
of 20 mM sodium phosphate, pH 7.0, and then passed through a series of filters (2.7 urn
glass microfiber (GF/D), 1.2 urn glass microfiber (GF/C), 0.8 urn cellulose acetate, 0.45
um cellulose acetate; Whatman, Piscataway, NJ). The protein solution was dialyzed and
concentrated in a 250-mL Amicon ultrafiltration stirred cell (Millipore, Billerica, MA)
fitted with a molecular cutoff membrane of 30 kDa (Millipore), then applied (4 mL/min)
to a chromatography column (ID = 2.5 cm; Bio-Rad) containing 10 mL of Protein G
Sepharose 4 Fast Flow affinity media (GE Healthcare, Baie d'Urfe, Canada) pre-
51
equilibrated with 20 mM phosphate buffer at pH 7.0. A series of washings were
performed with 20 mM phosphate buffer, pH 7.0, to ensure the removal of all
contaminating solutes from the Protein G column. The antibody was eluted from the
column with 0.1 M glycine, pH 2.2, and immediately buffered with 1 M TrisCl, pH 9.0.
The buffered eluate was subsequently applied (2.5 mL/min) to a Protein A affinity
column (5 mL HiTrap™ Protein A HP column, GE Healthcare) connected to an AKTA-
FPLC (Amersham Pharmacia Biotech, Uppsala, Sweden). To ensure the removal of all
contaminating solutes from the Protein A column, a series of washings were performed
with 20 mM phosphate buffer, pH 7.0. The antibody was eluted from the column with 0.1
M glycine, pH 2.2, and immediately buffered with 1 M TrisCl, pH 9.0. The antibody
eluate was dialyzed against 20 mM phosphate buffer, pH 7.0, and concentrated using
polyethylene glycol 35,000. Coomassie-stained SDS-PAGE gels and western
immunoblots were used to analyze the purity and structural integrity of plant-produced
trastuzumab.
3.3.6 N-Terminal Sequence Analysis
Plant-purified trastuzumab (3 |u,g) was separated by reducing 12% SDS-PAGE
and then transferred to a Sequi-Blot™ PVDF membrane (Bio-Rad) which was treated
with Coomassie blue G-250. N-terminal sequencing analysis (Edman degradation) was
performed at the Hospital for Sick Children's Research Institute (The Advanced Protein
Technology Centre, University of Toronto, Canada).
3.3.7 Cell Culture
MCF-7, SK-BR-3 and BT-474 cell lysates were prepared from cell lines grown to
95% confluence. Cells were treated with a lx trypsin-EDTA solution (0.25% trypsin,
52
0.1% EDTA; SAFC Biosciences, Lenexa, KS) for dissociation from the cell culture
flasks, washed twice with ice-cold PBS, and lysed with NP40 cell lysis buffer (50 mM
Tris, pH 7.4, 250 mM NaCl, 5 mM EDTA, 50 mM NaF, 1 mM Na3V04, 1% Nonidet
P40, and 0.02% NaN3; Invitrogen) supplemented with 1 mM phenylmethanesulfonyl
fluoride solution (PMSF; Sigma Aldrich) and 10% protease inhibitor cocktail (4-[2-
aminoethyljbenzenesulfonyl fluoride, N-ftoms'-epoxysuccinylJ-L-leucine 4-
guanidinobutylamide, bestatin hydrochloride, leupeptin hemisulfate salt, aprotinin and
sodium EDTA; Sigma-Aldrich). TSP concentration was determined for each lysate using
the BCA Protein Assay (Thermo Scientific). Through western immunoblot analysis,
HER2 was detected in the cell lysate preparations using 0.1 |a,g/mL of either Herceptin®
or plant-produced trastuzumab in PBST. Antibody samples were detected using a mixture
of goat anti-human IgG y- and K-chain specific probes conjugated to alkaline phosphatase
(Sigma-Aldrich), diluted to 1:2500 in PBST.
3.3.8 Cell Proliferation Assay
MCF-7 and SK-BR-3 cell lines were cultured in Dulbecco's modified Eagle's
medium (DMEM) supplemented with 1 mg/mL fungizone, 1% penicillin/streptomycin
(all from Invitrogen), and 10% fetal bovine serum (FBS; Sigma-Aldrich). The BT-474
cell line was cultured in Roswell Park Memorial Institute (RPMI) 1640 basal medium
(Invitrogen) supplemented with 1 mg/mL fungizone, 1% penicillin/streptomycin, and
10% FBS. SK-BR-3, BT-474 and MCF7 cells were seeded into 6-well plates (Corning,
Lowell, MA) (5 xlO4 cells/well). After allowing the cells to adhere, the cells were treated
with 2 ug/mL of non-specific plant-purified human IgGl (negative control; human
myeloma IgGl [Athens Research and Technology] was spiked into untreated N.
53
benthamiana plant extract and subsequently purified using the same scheme developed
for purification plant-produced trastuzumab), 2 ug/mL of plant-produced trastuzumab, or
2 [4g/mL of Herceptin®; untreated cells were also included as a control. Relative cell
proliferation was determined by viable cell counts using trypan blue stain (Invitrogen).
Cell counts were performed every two days for a total of eight days. Data are expressed
as a percentage of the untreated control.
3.4 Results
3.4.1 Accumulation of Trastuzumab in N. benthamiana Plants
Trastuzumab was expressed in N. benthamiana plants using the magnlCON®
viral-based transient expression system (Giritch et al., 2006). Six-week old N.
benthamiana plants were vacuum-infiltrated with A. tumefaciens clones transformed with
provectors containing the HC- and LC-coding sequences of trastuzumab. Results of
preliminary experiments determined that the murine signal peptide (SP) did not allow
much accumulation of trastuzumab; therefore, the murine SP was replaced by the
Arabidopsis basic Chitinase SP on both HC- and LC-expression constructs. The assembly
of trastuzumab with the Arabidopsis SP-containing constructs was examined 8 d.p.i on a
non-reducing western immunoblot treated with a mixture of anti-human IgG y- and K-
chain specific probes. As shown in Figure 3.2, the tetrameric form of the antibody (H2L2)
was the most prominent band. Trastuzumab expression was also determined by non-
reducing immunoblot and confirmed by quantitative ELISA through comparison with
known concentrations of a human IgGl standard. Plants expressed an average of 43.3 ±
4.7 mg of trastuzumab per kilogram of fresh leaf tissue (0.59 ± 0.08% total soluble
protein; TSP).
54
1 2 3 4 5 6 7 8 9 10 11 12
ml mtffg.**»**"*'"••- - l^fdtf ***
MW (kDa)
250 — 150— 1 0 0 — 75 —
50 —
3 7 —
25 _ 20
Figure 3.2 Quantification of trastuzumab expression in N. benthamiana. Trastuzumab was expressed in N. benthamiana using a viral vector-based transient expression system. Crude plant extracts were analyzed on a non-reducing immunoblot probed with a mixture of anti-human IgG y- and K-chain specific probes. Lane 1: protein molecular weight standard; Lane 2-8: human IgGl, 1000, 500, 250, 125, 62.5, 31.3, 15.1 ng, respectively + 10 |o,g total soluble protein (TSP) from untreated N. benthamiana; Lane 9: 10 ug TSP from untreated N. benthamiana; Lane 10-12: 10 \xg TSP from three replicate N. benthamiana plants expressing trastuzumab. Molecular weights of protein standards are indicated on the left. The tetrameric (H2L2) form of plant-produced trastuzumab is indicated by the arrow on the right.
3.4.2 Purification and Characterization of Plant-Produced Trastuzumab
A purification scheme was developed to facilitate the recovery of trastuzumab
from N. benthamiana plants. Primary plant extracts were treated with 20% ammonium
sulfate to remove high molecular weight contaminants, followed by 60% ammonium
sulfate to enrich antibody yield through precipitation. Trastuzumab was subsequently
purified by both Protein G and then Protein A affinity chromatography. Purified plant-
produced trastuzumab was compared with Herceptin using SDS-PAGE under reducing
conditions followed by staining with Coomassie blue. As seen in Figure 3.3A, the two
55
major bands observed at ca. 50 kDa and 25 kDa are the heavy and light chains of
trastuzumab, respectively. The heavy chain of plant-produced trastuzumab migrated
slightly faster than the heavy chain of Herceptin®, likely due to differences between plant
and mammalian post-translational glycosylation. As expected, there were no detectable
differences in the electrophoretic mobilities of the light chains of Herceptin and plant-
produced trastuzumab. In addition to the bands representing the heavy and light chains of
trastuzumab, two less prominent bands were observed that migrated between the 25 and
37 kDa markers; these bands were enhanced by immunoblotting (Figure 3.3B). A series
of non-reducing SDS-PAGE gels and immunoblots probed with y- or K-chain specific
probes revealed that these were heavy chain degradation products (not shown), likely
produced by protein degradation in planta since the addition of a protease inhibitor
cocktail to the extraction buffer had no effect on the antibody banding pattern in crude
plant extracts (not shown).
N-terminal sequencing by Edman degradation indicated 100% cleavage of the
Arabidopsis SP from both the heavy- and light-chains of the plant-produced trastuzumab.
The N-termini of both the HC and LC polypeptides of plant-produced trastuzumab (Glu-
Val-Gln-Leu-Val-Glu and Asp-Ile-Gln-Met-Thr-Gln, respectively) are identical to those
of Herceptin (Drug bank accession # BTD00098). This result, in combination with the
similarity in sizes between the HC and LC of plant-produced trastuzumab and
Herceptin®, strongly suggests that both mAbs have identical primary structures.
3.4.3 Specificity of Plant-Produced Trastuzumab
Qualitative binding analyses were performed to demonstrate the specificity of
plant-produced trastuzumab for HER2. MCF-7 and BT-474 cell lysates were resolved on
56
a western immunoblot that was subsequently probed with either plant-produced
trastuzumab or Herceptin . One major band was observed between 100 and 150 kDa on
both of the immunoblots probed with either mAb (Figure 3.4). The single band on both
immunoblots corresponds to HER2 from the BT-474 cell lysates. A large smear and a
less prominent band between 25 and 50 kDa were also observed on both immunoblots
and likely represent artifacts of the cell lysate preparation procedure. No bands were
observed in the lane containing the MCF-7 cells lysates, as this cell line does not
overexpress HER2.
MW MW
(kDa) 1 2 3 ( k°a)
250 , „ . 250 •
100 «—» 100 75 mmmm 75
50 mamk^gm^^^ 50
37 ssitil* 37
mi 2 5 ,___™ :^^^ 2 5
15 „ . _ . 15
Figure 3.3 Analysis of the purity of plant-produced trastuzumab. Reducing, Coomassie stained SDS-PAGE (A) and immunoblot (B). Lane 1: protein molecular weight standard; Lane 2: Herceptin®, 1.2 \xg; Lane 3: plant-produced trastuzumab, 1.2 ug. Immunoblot was probed with a mixture of anti-human IgG y- and K-chain specific probes. Molecular weights of protein standards are indicated on the left.
57
A B M W M W (kDa) 1 2 3 (kDa)
250 250 -150 150 -100 *"** 100 -75 75 -
50 50 -
37 37 -
25 25 -
20 20
Figure 3.4 Qualitative analysis of the binding of plant-produced trastuzumab to HER2 ligand. MCF-7 and BT-474 cell lysates were analyzed by non-reducing immunoblots probed with Herceptin® (A) or plant-produced trastuzumab (B). Lane 1: protein standard; Lane 2-3: 25 ug TSP of the MCF-7 and the BT-474 cell lysates, respectively.
3.4.4 Inhibition of Tumor Cell Proliferation
The effect of plant-produced trastuzumab on the growth of breast tumor cells that
overexpress HER2 was examined using a cell proliferation assay. Both HER2
overexpressing tumor cells (BT-474 and SK-BR-3) and normal HER2 expressing tumor
cells (MCF-7) were treated with Herceptin® or plant-produced trastuzumab. After 8 days,
both plant-produced trastuzumab and Herceptin® showed 52.5% and 48.8% inhibition of
BT-474 cell proliferation, respectively (Figure 3.5A). After 4 days, plant-produced
trastuzumab and Herceptin® showed 47.1% and 47.8% inhibition of SK-BR-3 cell
proliferation, respectively (Figure 3.5B). The growth of SK-BR-3 cells, but not BT-474
cells, rose after 6 days of treatment with both plant-purified trastuzumab and Herceptin®
(Figure 3.5B). This could be explained by the fact that SK-BR-3 cells have
58
A B
o
o
120
100
120
100
a so • "5 O H 60 • <a
o. 40 •
20 •
0
• • • • Human lgG1 from plant extract (-ve control)
• - A — Plant-produced trastuzumab
- B — Commercial trastuzumab
2 4 6 8
Time (days)
Figure 3.5 Effect of plant-produced trastuzumab on the proliferation of human breast tumor cells that overexpress HER2. BT-474 (A), SK-BR-3 (B) and MCF7 (C) cells were seeded into 6-well plates (5 x 104 cells/well) and treated with 2 p,g/mL of non-specific plant-purified human IgGl (negative control), 2 |j,g/mL of plant-produced trastuzumab or 2 (j.g/mL of Herceptin®. Cell counts were performed every two days to determine the relative cell proliferation. Data are expressed as a percentage of untreated control and are presented as means of triplicates ± SEM.
approximately two times more HER2 on their cell surfaces than BT-474 cells (Lewis et
al., 1993). As shown in Figure 3.5C, plant-produced trastuzumab and Herceptin® had no
anti-proliferative effect on MCF-7 cells. Thus, plant-produced trastuzumab selectively
59
inhibits the proliferation of both BT-474 and SK-BR-3 cells. As a negative control, all
breast tumor cell lines were also treated with a non-specific plant-purified human IgGl.
This non-specific plant-purified antibody had no effect on the breast tumor cell
proliferation, which demonstrates the absence of plant contaminants that could inhibit the
proliferation of breast tumor cells.
3.5 Discussion
Numerous researchers have shown that plant-produced mAbs retain biological
activities (i.e., specificity, cytotoxicity, and neutralization activity) that are similar to
parental mAbs produced in mammalian cell culture (reviewed in refs (De Muynck et al.,
2010; Fischer et al., 2009); however, no study has yet been conducted to characterize and
compare a plant-produced mAb to a clinically approved therapeutic antibody with the
identical primary structure. TheraCIM®, an anti-epidermal growth factor receptor (EGF-
R) antibody with conditional registry approval in Cuba, is a clinically approved mAb that
has also been produced in plants (Rodriguez et al , 2005). Although it was determined
that the plant-produced antibody and TheraCIM® have binding similar to A431 human-
tumor-culture cells, the plant-produced antibody was modified to remove glycosylation
sites and to add a KDEL ER-retention signal (Rodriguez et al., 2005). Another plant-
produced antibody, anti-HIV mAb 2G12, will soon enter human clinical trials (Gilbert,
2009; Ramessar et al., 2008), but its parent antibody has not yet had clinical approval.
Our research on the expression and purification of the anti-breast cancer antibody
trastuzumab contributes further evidence that plants can be used for the production of
biosimilar therapeutic mAbs, as we were able to produce trastuzumab in N. benthamiana
with identical primary structures to those of its mammalian cell-derived counterpart.
60
Although analysis of our primary plant extracts revealed that N. benthamiana plants
express an average of 43.3 ± 4.7 mg of trastuzumab per kg of fresh weight (0.59 ± 0.08%
TSP), optimization of this expression system should allow the production of 500 mg to 5
g per kg fresh weight (Bendandi et al., 2010; Giritch et al., 2006). Antibody expression
levels increase in a time-dependent manner, but antibody stability can also decrease over
time; heavy- and light-chain polypeptide expression levels increase until 10-11 d.p.i., and
antibody stability begins to decrease at 8-9 d.p.i (Giritch et al., 2006). We chose to
harvest plants 8 d.p.i. in order to obtain the most full-length IgG with the lowest amount
of antibody fragments/breakdown products.
A purification scheme was developed to facilitate the recovery of trastuzumab
from plants. Although analysis of plant-purified trastuzumab revealed the presence of
heavy chain degradation products, these products likely result from proteolytic
degradation inplanta (supported by the research in ref (Sharp and Doran, 2001)). These
impurities could thus be removed using an additional chromatography step such as gel
filtration or ion exchange chromatography. Most importantly, plant-produced
trastuzumab was found to have specificity similar to that of Herceptin for binding to
HER2 and was determined to be as effective as Herceptin® in inhibiting the growth of
cells overexpressing HER2.
One of the remaining major limitations of producing therapeutic mAbs in plants is
the addition plant-specific 7V-glycans, which may induce an immune response in human
treatment, especially with repeated immunotherapy (Cabanes-Macheteau et al., 1999;
Gomord et al., 2004; Sack et al., 2007). Antibody glycosylation is also essential for
structural stability, decreased protease sensitivity, complement activation, and effector
61
function (Cabanes-Macheteau et al., 1999; McLean et al., 2007). Several strategies are
currently being developed to generate genetically modified plants with humanized N-
glycan profiles (Strasser et al., 2008, 2009; Vezina et al., 2009). These strategies include
knocking out the endogenous glycosyltransferases responsible for the addition of the
plant-specific TV-glycans pl,2-xylose and al,3-fucose (Strasser et al., 2008, 2009) as well
as the expression of pi,4-galactosyltransferase (GalT) for the addition of terminal (31,4-
galactose (Bakker et al., 2006; Frey et al., 2009; Vezina et al., 2009). Future research on
plant-produced trastuzumab will require either the examination of the effect of plant-
specific ./V-glycans on its therapeutic efficacy in vivo as well as its potential
immunogenicity or the production of it in host plants modified to express proteins with
mammalian-like glycosylations.
Validation of plant-produced mAbs as biosimilar therapeutics will require that
they be shown to have biological properties (i.e., bioactivity and biosafety) similar to
clinically-approved parental mAbs. This paper clearly shows that a plant-expression and
purification system can produce a therapeutic mAb with identical primary structures and
similar in vitro bioactivities to those of its clinically approved parental mAb, indicating
that agricultural biopharming could be an effective alternative to mammalian cell systems
for the production of biosimilar therapeutics such as mAbs.
3.6 Acknowledgements
We thank ICON Genetics, GmbH for the use of the magnlCON® expression
system. We are also grateful to Fernando Olea-Popelka for designing the plant-optimized
HC and LC coding sequences and to Ashley J. Meyers for her help in the laboratory, for
the development of the quantitative ELISA, and for critical review of this manuscript.
62
This work was funded by grants to JCH from the Ontario Ministry of Agriculture, Food
and Rural Affairs (OMAFRA), the Natural Sciences and Engineering Research Council
(NSERC), the Canada Research Chairs (CRC) Program, the SENTINEL Bioactive Paper
Network and PlantForm Corporation.
63
4 RESEARCH CHAPTER 2: PURIFICATION OF A PLANT-PRODUCED ANTIBODY USING HOLLOW FIBER TANGENTIAL FLOW MICROFILTRATION
4.1 Abstract
Genetically modified plants can be used as an alternative to traditional
mammalian cell expression systems for the large-scale production of therapeutic
antibodies. Current purification of mAbs from plant bioreactors, however, remains far
from ideal due to inefficient post-harvest processing and purification procedures. A
scalable scheme that combines hollow fiber tangential flow microfiltration with Protein A
affinity chromatography and SP Sepharose cation exchange chromatography was thus
developed. Initial clarification of crude plant extracts by hollow fiber tangential flow
microfiltration was effective at removing extraneous plant proteins and compounds
without a significant loss of trastuzumab (< 4%). Through a single Protein A affinity
chromatography step, 67% of plant-produced trastuzumab was recovered. A high level of
antibody purity was also achieved with minimal column fouling. Plant-produced
trastuzumab was subsequently polished by SP Sepharose cation exchange
chromatography. The purity and antibody banding-pattern of plant-produced trastuzumab
was confirmed by immunoblotting and was determined to be comparable to Herceptin®.
Results confirm that hollow fiber tangential flow microfiltration, Protein A affinity
chromatography, and SP sepharose cation exchange chromatography can be used to
achieve purification of therapeutic antibodies from plants.
64
4.2 Introduction
Over the past 20 years, genetically modified plants have shown tremendous
potential for the large-scale production of therapeutic antibodies. Compared to traditional
mammalian cell-expression systems, genetically modified plants provide the advantages
of decreased upstream production costs, scalability of agricultural production, and
biological safety due to the absence of animal pathogens and toxins (Arntzen, 2008;
Huang et al., 2010). Transient-based expression systems have also allowed for higher
expression levels to be achieved faster than with any other biopharmaceutical production
system (Bendandi et al., 2010; Faye and Gomord, 2010; Giritch et al., 2006). However,
despite the successful expression of a wide variety of novel and biosimilar therapeutic
antibodies in plants (De Muynck et al., 2010), the agricultural production of antibodies
has yet to be adopted by the pharmaceutical industry (Faye and Gomord, 2010).
The large-scale production of antibodies in plants is currently limited by costly
post-harvest processing and purification procedures, which can account for more than
80% of the total cost of plant biopharming (Evangelista et al., 1998; Hassan et al., 2008;
Mison et al., 2000). Inefficiency arises from the numerous purification steps that are
required to separate plant-produced antibodies from the complex mixture of plant
proteins, alkaloids, pigments, polyphenols, and mucilages (Platis and Labrou, 2006;
Valdes et al., 2003). Using a series of low efficiency clarification and concentration steps
also leads to greater product loss, longer processing times, and higher costs (Aguilar and
Rito-Palomares, 2010; Platis and Labrou, 2006; Pujol et al., 2005). Thus, the overall
economics of large-scale agricultural production and purification of therapeutic
antibodies remains to be determined.
65
To improve the purification of antibodies from plants, the inefficiency of initial
post-harvest clarification and concentration procedures must be addressed. The fewer
clarification and purification steps that are required, the more economical and efficient
the overall manufacturing process will become. Clarification of crude plant extracts is an
essential part of any purification scheme that employs chromatographic separation. Direct
application of a crude plant extract to a chromatography column causes fouling due to
non-specific binding of plant proteins and other compounds to the resin (Hassan et al.,
2008). As a result, column life and binding capacity are reduced, while overall production
costs are increased (Hassan et al., 2008; Pujol et al., 2005). A clarification step reduces
the burden of plant extracts on a chromatography column by removing extraneous
particles and macromolecules. Many techniques can be used, alone or in combination, to
clarify plant extracts including acidic precipitation (Woodard et al., 2009), ammonium
sulfate precipitation (Grohs et al., 2010; Huang et al., 2010), centrifugation, filtration, and
two-phase aqueous partitioning (Platis and Labrou, 2006; Platis et al., 2008). However,
many of these techniques can be costly, time consuming and are not easily scalable.
Tangential flow (cross-flow) microfiltration has been used as an alternative to
centrifugation, depth filtration, and expanded-bed chromatography for the initial
purification of therapeutic proteins from mammalian cell culture (van Reis and Zydney,
2001). In tangential flow microfiltration, the feed stream passes parallel to the membrane,
which reduces the adsorption of proteins and compounds to the surface of the membrane
(Hill and Bender, 2007). Tangential flow microfiltration can thus be used to clarify hard-
to-filter solutions such as crude plant extracts, which quickly cause membrane fouling
when conventional dead-end filtration methods are used (Stoger et al., 2004).
66
Furthermore, clarification by tangential flow microfiltration does not require any phase,
pH or temperature change, which can affect antibody stability and/or structural integrity
(i.e. through protein denaturation, deactivation, and/or degradation) (Zeman and Zydney,
1996a). Several different membrane configurations can be used for tangential flow
filtration, including hollow fiber modules, flat plate modules, spiral wound modules, and
tubular devices (Zeman and Zydney, 1996b). Hollow fiber modules are composed of
narrow-bore cylindrical membranes (fibers) and thus offer higher packing densities. The
small diameter of the fibers also allows high mass transfer rates to be achieved at low
volumetric flow rates. Conversely, hollow fiber modules are typically more susceptible to
plugging and can only be manufactured from certain polymers (Zeman and Zydney,
1996b).
In our previous research, the anti-breast cancer antibody, trastuzumab (Herceptin®),
was successfully expressed in Nicotiana benthamiana (Grohs et al., 2010). Purification of
plant-produced trastuzumab was achieved using a combination of ammonium sulfate
precipitation, Protein G and then Protein A affinity chromatography. Plant-purified
trastuzumab was determined to be just as effective as the innovator drug Herceptin® at
inhibiting the proliferation of HER2-overexpressing breast cancer cells. However, the
purification of plant-produced trastuzumab was impeded by long processing times.
Analysis of plant-purified trastuzumab also revealed the presence of antibody fragments
and/or degradation products, which were not removed by Protein G and/or Protein A
chromatography. Therefore, the purpose of this study was to develop a more efficient
scheme to purify and polish plant-produced trastuzumab. By combining hollow fiber
tangential flow microfiltration with Protein A affinity chromatography and SP sepharose
67
cation-exchange chromatography, trastuzumab was successfully purified from N.
benthamiana plants. Through immunoblot analysis, plant-purified trastuzumab was
determined to have an antibody-banding pattern and purity comparable to Herceptin®.
4.3 Materials and Methods
4.3.1 Plant Material
N. benthamiana plants expressing trastuzumab, an anti-HER2/new humanized
murine IgGlK antibody, were previously developed by Grohs et al. (2010), using the
magnlCON® expression system (Giritch et al., 2006; Icon Genetics).
4.3.2 Extraction and Clarification
Infiltrated N. benthamiana leaf tissue was harvested and extracted as previously
described in Grohs et al. (2010). Briefly, 100 g of frozen leaf tissue was disrupted in a
food processor containing 200 mL of cold extraction buffer [40 mM phosphate buffer, 50
mM ascorbic acid, and 10 mM ethylenediaminetetraacetic acid (EDTA) disodium salt
dihydrate at pH 7.0] for three 30 s pulses and subsequently homogenized using a
Polytron® homogenizer for 4 min 30 s. Insoluble material was removed by vacuum
filtration through two layers of Miracloth (EMD Biosciences, La Jolla, CA), followed by
centrifugation in a Sorvall RC-5B centrifuge (Sorvall GSA rotor; Thermo Scientific,
Nepean, Canada) at 12,000 rpm for 30 min at 4°C. The supernatant was collected and
adjusted to 350 mL with cold extraction buffer.
Micro filtration of the plant extract was achieved by passing the extract through a
hollow fiber tangential flow filtration (TFF) module with a pore rating of 0.05 um
(MiniKros® sampler M10S-320-01P; Spectrum Laboratories Inc., Rancho Dominguez,
CA) connected to a Watson Marlow 520SN/R2 peristaltic pump (Watson Marlow,
68
Georgetown, Canada) (Figure 4.1). Inlet, retentate, and permeate pressure were
monitored using three pressure transducers and KrosFlo® Digital Pressure Monitor
(Spectrum Laboratories Inc.). Permeate flow rate was monitored using a KrosFlo
Permeate Scale (Spectrum Laboratories Inc.). KF Comm Data Collection Software
(Spectrum Laboratories Inc.) was used to collect real time process data. Specifications for
the TFF module and system parameters are outlined in Table 4.1. Following each use,
the TFF module was cleaned using 0.5 M NaOH and then stored in 0.1 M NaOH at 4°C.
Prior to each use, the 0.1 M NaOH was drained from the module and the system was
flushed with 40 mM sodium phosphate buffer, pH 7. The module was subsequently
treated with 70% isopropyl alcohol for 1 h and then flushed with ultra-pure water (18.2
flM-cm) from a Diamond NANOpure water purification unit (Barnstead International,
Dubuque, IA).
PUMP
M
3—(p?y
© PERMEATE
PROCESS RESERVOIR
Figure 4.1 Schematic of the hollow fiber tangential flow microfiltration system flow-path. Pi, inlet pressure transducer; PR, retentate pressure transducer; PP, permeate pressure transducer; M, hollow fiber module.
69
Table 4.1 Specifications for the hollow fiber tangential flow filtration module (M10S-320-01P) used in the purification of trastuzumab from N. benthamiana.
Module Parameters
Filter type Area Fiber I.D. Pore rating
Polysulphone (PS) 420 cm2
0.5 mm 0.05 urn
System Parameters
Recirculation rate Shear Transmembrane pressure Average permeate flux
(TMP)
1150 mL/min 12,000 s"1
5 psi 27.1 LMH1
LMH: liters per square meter per hour.
4.3.3 Chromatography
The clarified plant extract was applied to a Protein A affinity column (5 mL
HiTrap™ Protein A HP column, GE Healthcare) at a flow rate of 1 mL/min using an
AKTA-FPLC system (Amersham Pharmacia Biotech, Uppsala, Sweden) at ambient
temperature. Following a series of washings with 20 mM phosphate buffer, pH 7.0, the
antibody was eluted from the column with 0.1 M glycine, pH 2.2, and immediately
neutralized with 1 M TrisCl, pH 9.0. The Protein A eluate was dialyzed against 20 mM
sodium acetate buffer, pH 5.0 using a 50-mL Amicon ultrafiltration stirred cell
(Millipore, Billerica, MA) fitted with a molecular cutoff membrane of 100 kDa
(Millipore).
The dialyzed Protein A eluate was applied to a chromatography column (ID = 2.5
cm; Bio-Rad) containing 25 mL of SP Sepharose cation exchange media (GE Healthcare,
Baie d'Urfe, QC) at a flow rate of 2.0 mL/min at ambient temperature. After washing the
70
column with 20 mM sodium acetate, pH 5.0, a multi-step elution (0, 70, 80, 100, 125, 250
mM, and 1 M NaCl) was performed using 20 mM sodium acetate, pH 5.0 containing 1 M
NaCl. All fractions collected throughout the SP Sepharose purification were analyzed by
western immunoblot. Fractions containing tetramer (H2L2) were pooled and compared to
Herceptin® (Roche, Mississauga, ON).
4.3.4 SDS PAGE and Immunoblot Analyses
Coomassie-stained SDS-PAGE gels and western immunoblots were used to
analyze each step of the purification scheme and to determine the integrity and purity of
plant-produced trastuzumab. TSP concentrations were determined with the Bio-Rad
Protein Assay, using Bovine Serum Albumin (BSA) (Thermo Scientific) as the protein
standard. Western immunoblots were probed using a mixture of goat anti-human IgG y-
and K-chain specific probes conjugated to alkaline phosphatase (Sigma-Aldrich; 1.5 uL of
eachinlOmLofPBST).
4.3.5 Quantitative ELISA
Antibody recovery was quantified using a direct sandwich ELISA. The quantitative
ELISA was performed as outlined in Grohs et al. (2010), with several modifications.
Briefly, microtiter plates (Corning Inc. Life Sciences, Lowell, MA) were coated with
0.625 ug/mL of mouse anti-human IgG y-chain specific antibody (Sigma-Aldrich) for 16
h at 4°C. Plates were blocked with 4% (w/v) skim milk (EMD Biosciences) for 5.5 h at
37°C and subsequently washed with PBST. Serial dilutions of samples collected
throughout the purification procedure were added to the plate, which was incubated at
37°C for 1 h. Serial dilutions of human myeloma IgGl (Athens Research & Technology
71
Inc., Athens, GA) were used as the standard. Antibody samples were detected with 1.5
(0,g/mL of polyclonal rabbit anti-human IgG (H+L)-horseradish peroxidase (HRP)
conjugate (Abeam, Cambridge, MA) for 1 h at 37°C.
4.4 Results
4.4.1 Purification of Trastuzumab from N. benthamiana
The purification of plant-produced trastuzumab was previously achieved by
clarifying crude plant extracts using a two-step precipitation with 20% and then 60%
ammonium sulphate (Chapter 3; Grohs et al., 2010). Trastuzumab was subsequently
purified by Protein G and then Protein A affinity chromatography. The structural integrity
of plant-produced trastuzumab was analyzed on a non-reducing immunoblot treated with
a mixture of y- and K-chain specific probes (Figure 4.2). Plant-produced trastuzumab was
also compared to human IgGl, Herceptin® and human serum IgG. All antibody samples
contained bands with similar electrophoretic mobilities; however, plant-produced
trastuzumab had additional bands (marked by asterisks in Figure 4.2A). Further
examination of plant-produced trastuzumab on an immunoblot probed with a y-chain
specific probe revealed that the band at ca. 50 kDa represents unassembled heavy chains
and the two bands between 25 and 37 kDa represent heavy chain degradation products
(Figure 4.2B). Plant-produced trastuzumab was also examined on an immunoblot probed
with a K-chain specific probe. It appears that the bands at ca. 45 kDa and 25 kDa
represent Fab fragments and unassembled light chains, respectively (Figure 4.2C).
In an attempt to improve the purity of plant-produced trastuzumab and to reduce
processing time, trastuzumab was purified from N. benthamiana tissue according to the
scheme outlined in Figure 4.3A. Samples from each step of the purification scheme were
72
A B MW (kDa)
250 -150 -100 -75 -
50 -
37 -
MW (kDa)
250 -150 -100 -
75 -
50 -
37 -
25
20
15
25
20
15
M W (kDa)
250-150 -100 -75 -
50 -
37 -
25
20
15
ure 4.2 Structural integrity of plant-produced trastuzumab purified using a combination of ammonium sulfate precipitation, Protein G, and Protein A chromatography (described in Chapter 3; Grohs et al., 2010). Non-reducing immunoblot analyses of plant-produced trastuzumab, compared with human IgGl, Herceptin® and human serum IgG. Immunoblots were probed with a mixture of anti-human IgG y- and K-chain specific probes (A), y-chain specific probe (B), and K-chain specific probe (C). Lane 1 protein standard; Lane 2: blank; Lane 3: human IgGl, 250 ng; Lane 4 Herceptin®, 250 ng; Lane 5: plant-produced trastuzumab, 250 ng; Lane 6 human serum IgG, 250 ng. Molecular weights of protein standards are indicated on the left. Asterisks mark the additional bands of plant-produced trastuzumab.
73
B Harvest Leaf Tissue
Grind & Homogenize
-0-Centrifuge
Lane # 1
Microfiltration (TFF)
Permeate
Lane #2
Protein A Chromatography
Rctentate
Flow through Elution
Lane #3 Lane #4
41 Ultrafiltration
SP Sepharose Chromatography
250 150 100 75
50
37
25
20
M 1
^••' -<W # # # * • -S«$» *
M
250 — 150 — 100 — 75 —
50 —
37 —
25 20
Figure 4.3 Purification scheme for the recovery of trastuzumab from 100 g of frozen N. benthamiana tissue (A). TFF: tangential flow filtration; SP: sulphopropyl. Samples from each purification step were collected and analyzed by non-reducing western immunoblot (B) and Coomassie-stained gel (C). The immunoblot was probed with a mixture of anti-human IgG y-and K-chain specific probes. M: protein standard, molecular weights are indicated on the left. The tetrameric (H2L2) form of plant-produced trastuzumab is indicated by the arrow on the right. Asterisks mark the bands that resemble those shown in Figure 4.1, where plant-produced trastuzumab was purified using ammonium sulfate precipitation, Protein G, and Protein A chromatography.
74
collected and analyzed by non-reducing immunoblot and Coomassie-stained SDS-PAGE
gel (Figure 4.3B and 4.3C, respectively). The concentration of trastuzumab recovered at
each step was also quantified using a direct sandwich ELISA (Table 4.2).
The conditions required to efficiently extract trastuzumab from N. benthamiana
were previously optimized (Grohs et al., 2010). Briefly, frozen leaf tissue was ground in a
blender with two volumes of cold extraction buffer, followed by homogenization with a
benchtop Polytron® homogenizer. Crude plant extracts were subsequently filtered
through Miracloth and centrifuged to remove insoluble plant material. To improve the
clarification of crude plant extracts hollow fiber tangential flow microfiltration was used,
as opposed to ammonium sulphate precipitation (described in Chapter 3; Grohs et al.,
2010). Microfiltration of the plant extract reduced the amount of TSP by 3-fold, while
96% of the trastuzumab was recovered (Table 4.2). Consequently, this clarification
method significantly reduced processing time and increased recovery. Furthermore,
clarification of the plant extract by microfiltration did not allow antibody degradation to
occur (Figure 4.3B, lane 2), as there was no change in the antibody-banding pattern when
compared to the crude plant extract (Figure 4.3B, lane 1). This was also observed when
ammonium sulfate was used for clarification.
Table 4.2 Analysis of the recovery of trastuzumab from 100 g of TV. benthamiana.
Total Soluble Antibody Volume Total Antibody Protein Concentration (mL) Antibody Recovery
(mg/mL) (ng/mL) (mg) (%)
Crude plant extract 3.28 5.96 175 1.05 100
Microfiltration Permeate 1.05 5.64 179 1.01 96
Protein A Elution 0.02 34.36 20 0.70 67
75
Plant-produced trastuzumab was subsequently purified using Protein A affinity
chromatography (Figure 4.4). Antibody fragments and/or breakdown products were
detected in the column flow through (immunoblot; Figure 4.3B, lane 3) along with
unwanted plant proteins and other contamiants (gel; Figure 4.3C, lane 3). Plant-produced
trastuzumab was of high purity (Figure 4.3C, lane 4), since no plant proteins were
observed in the Protein A eluate (Figure 4.3C, lane 4); however, some antibody
fragments/degradation products still remained (i.e. between 37 and 50 kDa; marked by
asterisks in Figure 4.3 C).These antibody bands are similar to those found using the
previous purification scheme that combined ammonium sulfate precipitation, Protein G,
and Protein A chromatography (marked by asterisks in Figure 4.2A). Total antibody
recovery following Protein A chromatography was 67% (Table 4.2).
I £
o
< >
3500
3000
2500
2000
1500
1000
500
0
0 100 200 300 400
Effluent Volume (mL)
Figure 4.4 Purification of trastuzumab from clarified N. benthamiana extract using Protein A affinity chromatography (binding buffer: 20 mM sodium phosphate buffer, pH 7.0; elution buffer: 0.1 M glycine pH 2.2; flow rate: 1.0 mL/min).
76
4.4.2 Polishing of Plant-Purified Trastuzumab
SP Sepharose cation exchange chromatography was used to polish plant-produced
trastuzumab previously purified by Protein A chromatography (Figure 4.5). Selective
elution of the undesired lower molecular weight antibody fragments between 37 and 50
kDa was achieved using a multi-step elution with NaCl. Following analysis of each
fraction by non-reducing immunoblot, it was determined that antibody fragments were
selectively eluted from the column between 100 and 125 mM NaCl (Figure 4.6B-E).
Increasing the concentration of NaCl to 250 mM and then 1 M eluted the remainder of
the antibody (Figure 4.6E and F). Fractions containing the tetrameric form of
trastuzumab were pooled for analysis and comparison with Herceptin (dotted lines mark
pooled fractions in Figure 4.6D-F).
4.4.3 Characterization of Antibody Integrity and Purity
The integrity and purity of plant-produced trastuzumab was determined by non-
reducing and reducing immunoblot analysis (Figure 4.7). Under non-reducing
conditions, plant-produced trastuzumab had the same banding pattern as Herceptin®, with
the tetramer being the most prominent band in both samples (Figure 4.7A). Comparison
of plant-produced trastuzumab and Herceptin® under reducing conditions showed that
only bands corresponding to the heavy and light chains were present in both samples
(Figure 4.7B).
77
uv Conductivity Concentration of NaCl
^1 00
mAU
30.0
40.0
30.0
20.0
10.0
0.0
roS/cm
K0
•3.0
/L
•2.0
1.0
JO.O
200 400 600 ml
Figure 4.5 Polishing of plant-purified trastuzumab by SP Sepharose cation exchange chromatography (flow rate: 2.0 mL/min). 20 mM sodium acetate, pH 5.0 was used as the binding buffer. A multi-step elution (0, 70, 80, 100, 125, 250 mM, and 1 M NaCl - indicated by green line) was performed using 20 mM sodium acetate, pH 5.0 containing 1 M NaCl.
B H 70 m M 80 niM
250 150 100 75
50
37
25 20
100 mM
100 m M D
250 150 100 75
50
37
25
20
125 m M
»»»»««»
125 m M 250 m M
250 150 100 75
50
37
250 m M 100 m M f » « « 9 « » « » « 9 S
25
20
Non-reducing immunoblot analysis of the fractions collected throughout the SP Sepharose purification of plant-produced trastuzumab (A-F). Immunoblots were probed with a mixture of anti-human IgG y- and K-chain specific probes. The concentrations of NaCl used in the multi-step elution are indicated above the immunoblots. The fractions that were pooled for further analysis are indicated by the dotted lines above the immunoblots. M: protein standard, molecular weights are indicated on the left.
79
M 1 B
M 1
250 — 150 — 100 — 75 —
50 —
37 —
25 — 20 — 15 —
250 — 150 — 100 — 75 —
50 —
37 —
25 — 20 — 15 —
Figure 4.7 Non-reducing (A) and reducing (B) immunoblot analyses of the purity of plant-produced trastuzumab. M: protein standard, molecular weights are indicated on the left; Lane 1: blank; Lane 2: plant-produced trastuzumab; Lane 3: Herceptin®, 100 ng. Immunoblots were probed with a mixture of anti-human IgG y- and K-chain specific probes.
4.5 Discussion
Previous work by Grohs et al. (2010) showed that biosimilar trastuzumab was
successfully expressed in 7Y. benthamiana. However, the purification of plant-produced
trastuzumab was time consuming and antibody recovery was low. Furthermore,
comparison of plant-purified trastuzumab to Herceptin®, using a non-reducing
immunoblot, revealed that plant-produced trastuzumab had additional antibody fragments
and/or degradation products (marked by asterisks in Figure 4.2A). To improve the
purification of plant-produced trastuzumab, ammonium sulfate precipitation was replaced
by hollow fiber tangential flow microfiltration. Hollow fiber tangential flow
microfiltration successfully decreased the amount of TSP in crude plant extracts without
80
a significant loss of trastuzumab. The addition of this clarification step to the purification
scheme also allowed for antibody purification to be achieved with minimal column
fouling as there was no observable discoloration of the resin or decreased binding
capacity. As a result, the lifespan of the resin was extended, thus reducing the costs
associated with replacing fouled columns. Clarification of the plant extract was also
achieved three times faster than ammonium sulfate precipitation, thus decreasing the
exposure of the antibody to proteases and phenolics released during tissue disruption
(Fischer et al., 1999). Furthermore, the use of hollow fiber tangential flow microfiltration
reduced the number of chromatography steps (i.e. Protein A chromatography versus
Protein G and then Protein A chromatography) required to obtain antibody of comparable
purity Herceptin". An additional polishing step with the SP Sepharose cation exchange
resin was added to remove undesirable antibody fragments, which were not removed by
Protein A chromatography (Figure 4.3B) or by using the method of Grohs et al. (2010)
(Figure 4.2A). Immunoblot analysis revealed the purity and antibody-banding pattern of
plant-produced trastuzumab to be comparable to Herceptin , when the new purification
scheme was used.
Costly downstream processing and purification procedures currently hinder the
large-scale production of antibodies in plants. Numerous strategies have been developed
to address the absence of efficient clarification and concentration procedures, which
contribute to the long processing times and the high cost of current purification schemes
(Aguilar and Rito-Palomares, 2010; Fischer et al., 1999; Platis and Labrou, 2006). An
aqueous two-phase partitioning system (ATPS), for example, has been optimized for the
purification of antibodies from transgenic tobacco plants (Platis and Labrou, 2006; Platis
81
et al., 2008). However, similar to the purification scheme developed for this study,
clarification of the crude plant extract by centrifugation and filtration was required prior
to the aqueous two-phase partitioning step (Platis and Labrou, 2006; Platis et al., 2008).
Flat membrane tangential flow microfiltration has also been used as an initial
clarification step in the purification of antibodies from plants (Fischer et al., 1999; Yu et
al., 2008a). Compared to hollow fiber modules, flat plate modules have lower membrane
packing densities (i.e. ratio of membrane area to device volume) and mass transfer rates
(Zeman and Zydney, 1996b). In contrast, hollow fiber modules are typically more
susceptible to plugging (i.e. plugging of hollow fibers) and can only be manufactured
from certain polymers (Zeman and Zydney, 1996b). The hollow fiber module used in this
study, for example, was made of polysulphone, a material with high protein binding
properties. As a result, the permeation flux (LMH) decreased over time and the module
had to be thoroughly cleaned with NaOH after each use.
Validation of plant bioreactors for the production of therapeutic antibodies will
require a purification scheme that is identical or superior to those currently used for
mammalian cell culture systems (Woodard et al., 2009). Our initial clarification of the
plant extract through hollow fiber tangential flow microfiltration allowed for the use of a
purification scheme identical to the standard purification sequence of Genentech, which
is used to purify antibodies from animal cell-based bioreactors (i.e., centrifugation, depth
filtration, Protein A chromatography, and cation-exchange chromatography) (Fontes and
van Reis, 2009). Although improvements and alternatives to Protein A chromatography
are currently being investigated (Fontes and van Reis, 2009), any adaptations to the
82
standard purification and polishing sequence could also be applied to the scheme
developed in this study.
Future research on this purification scheme will involve testing the scalability of
the tangential flow system to ensure removal of unwanted plant proteins and
contaminants while still achieving the same level or improved antibody recovery. The
versatility of the scheme will also be tested through purification of other plant-produced
therapeutic antibodies. A more versatile purification strategy for plant-produced
antibodies would facilitate process development by decreasing the required time and
resources (Shukla et al., 2007).
This study clearly shows that a purification system that combines hollow fiber
tangential flow filtration, Protein A affinity chromatography, and SP Sepharose cation
exchange chromatography can be used to generate plant-produced trastuzumab with the
same antibody-banding pattern and purity as Herceptin®. This study provides further
evidence that plant expression systems are effective alternatives to mammalian cell
systems for the efficient production of therapeutic mAbs.
4.6 Acknowledgements
We would like to thank ICON Genetics, GmbH for the use of the magnlCON®
expression system. We also thank Drs. Dennis Yu, Mukesh Muyani, and Raja Ghosh of
McMaster University for helpful discussions. This project was funded by grants to JCH
from the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA), the
Natural Sciences and Engineering Research Council (NSERC) of Canada, the Canada
Research Chairs (CRC) Program, the SENTINEL Bioactive Paper Network, and
PlantForm Corporation.
83
5 GENERAL CONCLUSIONS AND FUTURE DIRECTIONS
The first research objective of this thesis was to express biosimilar trastuzumab in
N. benthamiana plants using the magnlCON® viral-based transient expression system.
Immunoblot analyses of crude plant extracts revealed that trastuzumab accumulates
within plants mostly in the fully assembled tetrameric form. Using a series of ELISAs, N.
benthamiana plants were determined to express 43.3 ± 4.7 mg of trastuzumab per kg of
fresh leaf tissue (0.59 ± 0.08 % TSP).
Although low expression of biosimilar trastuzumab inplanta was sufficient for
preliminary characterizations, future research will require improvement of this expression
system since high antibody concentrations are required for plant bioreactors to achieve an
economic advantage over mammalian cell cultures (Evangelista et al., 1998; Sharp et al.,
2001). Antibody expression levels as high as 500 mg to 5 g per kg fresh weight of N.
benthamiana have previously been reported using the magnlCON® system (Bendandi et
al., 2010; Giritch et al., 2006). Therefore, optimization of this system should allow for
increased bioaccumulation of trastuzumab. In this study for example, it was found that
switching from a murine signal sequence to the Arabidopsis basic Chitinase signal
sequence increased expression of trastuzumab (data not shown). Plant development and
age can also have a profound effect on antibody expression and stability in planta
(Stevens et al., 2000). Plant growth conditions that favor increased biomass production
(i.e. light and temperature) could thus be examined to ensure optimum antibody
expression is achieved (Stevens et al., 2000). Finally, although the tetrameric form of
trastuzumab was the most prominent band observed through immunoblotting, decreasing
the concentration of lower molecular weight fragments would be ideal. Co-expression of
84
protease inhibitors in the apoplast might improve the structural integrity of plant-
produced trastuzumab and thus facilitate the final polishing step of the purification
scheme (Komarnytsky et al., 2006).
The second research objective of this thesis was to characterize plant-produced
trastuzumab and compare to the innovator drug Herceptin®. The structural integrity and
specificity of plant-produced trastuzumab was confirmed by immunoblotting. Plant-
produced trastuzumab and Herceptin® were found to bind the same target in extracts of
HER2 overexpressing cells, and functional assays revealed that both mAbs elicit similar
anti-proliferative effects on HER2-overexpressing breast cancer cells.
In the future, more extensive biochemical and biological analyses need to be
conducted to validate plant-produced trastuzumab. Analytical methods such as IEF,
reverse-phase HPLC (RP-HPLC), and SPR should be conducted to confirm the identity,
consistency, and stability of plant-produced trastuzumab using Herceptin® as the standard
(Beck et al., 2005). An analysis of the glycosylation pattern of plant-produced
trastuzumab could also be performed. Trastuzumab has numerous proposed mechanisms
of action including both cytostatic (i.e. cell cycle arrest, receptor endocytosis, inhibition
of HER2 ECD cleavage, and reduced tyrosine phosphorylation) and cytolytic effects (i.e.
ADCC). However, preliminary research in this thesis only examined the anti-proliferative
effects of plant-produced trastuzumab on breast tumor cells that overexpress HER2.
Conducting cell-based assays to examine the biological effect induced by plant-produced
trastuzumab (i.e. downstream signalling effects and immune effector functions) would
thus confirm that plant-produced trastuzumab retains the exact biological activity of
85
Herceptin . Following completion of these assays, a pre-clinical mouse trial should be
conducted to test the efficacy of the plant-produced antibody in vivo.
One of the shortcomings of antibody production in plants is the high costs
associated with post-harvest processing and purification procedures for plant-produced
antibodies. In the first half of this thesis purification of plant-produced trastuzumab was
achieved by treating primary plant extracts with 20% ammonium sulfate to remove high
molecular weight proteins, followed by 60% ammonium sulfate to enrich antibody yield
through precipitation. Trastuzumab was subsequently purified by Protein G and then
Protein A affinity chromatography. This purification scheme was limited by long
processing times and low antibody recovery. Plant-purified trastuzumab also contained
antibody fragments and/or breakdown products that were not present in Herceptin®. The
final research objective of this thesis was thus to improve the purity of plant-produced
trastuzumab. Initial clarification of crude plant extracts by hollow fiber tangential flow
microfiltration was effective at removing extraneous plant proteins and compounds
without a significant loss of plant-produced trastuzumab (< 4%). Through a single
Protein A affinity chromatography step, 67% of plant-produced trastuzumab was
recovered. Similar to the first purification scheme, antibody purification was achieved
with minimal column fouling. Finally, SP Sepharose cation exchange chromatography
was used to polish plant-produced trastuzumab.
Although trastuzumab was successfully purified using hollow fiber tangential
flow microfiltration, Protein A affinity chromatography, and SP Sepharose cation
exchange chromatography, numerous challenges remain. First, the tangential flow
microfiltration step must be scalable. Hollow fiber tangential flow microfiltration can
86
easily be scaled by increasing the filtration surface area, which is accomplished by
increasing the number of hollow fibers and the diameter of the module. However,
experiments should be conducted to ensure the accuracy of this statement, and to
optimize the system on a larger scale. Different types of filtration (i.e. continuous and
discontinuous filtration or concentration) can also be conducted using hollow fiber TFF
modules. A second hollow fiber TFF step could thus be used on a large scale to reduce
the volume of the plant extract prior to the chromatography step.
Numerous purification schemes have been developed to address the inefficiency
of post-harvest processing and purification of plant-produced antibodies. However, a
scalable scheme that can be used to purify a broad range of full-length antibodies from
various plant tissues would thus be extremely valuable. The versatility of the purification
scheme outlined in this thesis should thus be examined by purifying another therapeutic
antibody from N. benthamiana plants or by purifying trastuzumab from N. tabacum
plants.
In conclusion, this thesis provides evidence that trastuzumab, an important
antibody used in human cancer therapy, can be both efficiently produced and purified
from N. benthamiana plants.
87
6 LITERATURE CITED
Aguilar, O., and Rito-Palomares, M. (2010). Aqueous two-phase systems strategies for the recovery and characterization of biological products from plants. J. Sci. Food Agric. 90, 1385-1392.
Akerstrom, B., and Bjorck, L. (1989). Protein L: an immunoglobulin light chain-binding bacterial protein. Characterization of binding and physicochemical properties. J. Biol. Chem. 264, 19740-19746.
Almquist, K. C , McLean,, M. D., Niu, Y., Byrne, G., Olea-Popelka, F. C, Murrant, C, Barclay, J., and Hall, J. C. (2006). Expression of an anti-botulinum toxin A neutralizing single-chain Fv recombinant antibody in transgenic tobacco. Vaccine 24, 2079-2086.
Alroy, I., and Yarden, Y. (1997). The ErbB signaling network in embryogenesis and oncogenesis: signal diversification through combinatorial ligand-receptor interactions. FEBS Lett. 410, 83-86.
Arnould, L., Gelly, M., Penault-Llorca, F., Benoit, L., Bonnetain, F., Migeon, C, Cabaret, V., Fermeaux, V., Bertheau, P., Gamier, J., et al. (2006). Trastuzumab-based treatment of HER2-positive breast cancer: an antibody-dependent cellular cytotoxicity mechanism? Br. J. Cancer 94, 259-267.
Arntzen, C. J. (2008). Plant science: using tobacco to treat cancer. Science 321, 1052-1053.
Bakker, H., Rouwendal, G. J. A., Karnoup, A. S., Florack, D. E. A., Stoopen, G. M., Helsper, J. P. F. G., van Ree, R., van Die, I., and Bosch, D. (2006). An antibody produced in tobacco expressing a hybrid (3-1,4-galactosyltransferase is essentially devoid of plant carbohydrate epitopes. Proc. Natl. Acad. Sci. U.S.A. 103, 7577-7582.
Balasubramaniam, D., Wilkinson, C, Van Cott, K., and Zhang, C. (2003). Tobacco protein separation by aqueous two-phase extraction. J. Chromatogr. A 989, 119-129.
Ballew, H. W., Clark, D., Crooks, G., Ho, S. V., Markee, C , Martinez, F. J., Milner, D., Partee, J., and Simmons, J. (2002). The ABCs of filtration and bioprocessing for the third millennium (Ballew, H.W., Martinez, F.J., Markee, C, and Eddleman, R.T. eds) Rancho Dominguez, CA: Spectrum Laboratories, Inc.
88
Baselga, J., Norton, L., Albanell, J., Kim, Y. M., and Mendelsohn, J. (1998). Recombinant humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel and doxorubicin against HER2/neu overexpressing human breast cancer xenografts. Cancer Res. 58, 2825-2831.
Baselga, J., Tripathy, D., Mendelsohn, J., Baughman, S., Benz, C. C, Dantis, L., Sklarin, N. T., Seidman, A. D., Hudis, C. A., Moore, J., et al. (1996). Phase II study of weekly intravenous recombinant humanized anti-pl85HER2 monoclonal antibody in patients with HER2/neu-overexpressing metastatic breast cancer. J. Clin. Oncol. 14, 737-744.
Baselga, J., and Albanell, J. (2001). Mechanism of action of anti-HER2 monoclonal antibodies. Ann. Oncol. 12, 35-41.
Baselga, J., and Swain, S. M. (2009). Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat. Rev. Cancer 9, 463-475.
Baulida, J., Kraus, M. H., Alimandi, M., Fiore, P. P. D., and Carpenter, G. (1996). All ErbB receptors other than the epidermal growth factor receptor are endocytosis impaired. J. Biol. Chem. 271, 5251 -5257.
Beano, A., Signorino, E., Evangelista, A., Brusa, D., Mistrangelo, M., Polimeni, M. A., Spadi, R., Donadio, M., Ciuffreda, L., and Matera, L. (2008). Correlation between NK function and response to trastuzumab in metastatic breast cancer patients. J. Transl. Med. 6, 1-10.
Beck, A., Bussat, M., Zorn, N., Robillard, V., Klinguer-Hamour, C, Chenu, S., Goetsch, L., Corvaia, N., Van Dorsselaer, A., and Haeuw, J. (2005). Characterization by liquid chromatography combined with mass spectrometry of monoclonal anti-IGF-1 receptor antibodies produced in CHO and NS0 cells. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 819, 203-218.
Belfort, G., Davis, R. H., andZydney, A. L. (1994). The behavior of suspensions and macromolecular solutions in crossflow microfiltration. J. Memb. Sci. 96, 1-58.
Ben-Kasus, T., Schechter, B., Lavi, S., Yarden, Y., and Sela, M. (2009). Persistent elimination of ErbB-2/HER2-overexpressing tumors using combinations of monoclonal antibodies: relevance of receptor endocytosis. Proc. Natl. Acad. Sci. U.S.A 106, 3294-3299.
Bendandi, M., Marillonnet, S., Kandzia, R., Thieme, F., Nickstadt, A., Herz, S., Frode, R., Inoges, S., Lopez-Diaz de Cerio, A., Soria, E., et al. (2010). Rapid, high-yield production in plants of individualized idiotype vaccines for non-Hodgkin's lymphoma. Ann. Oncol. DOI: 10.1093/annonc/mdq256.
89
Birch, J. R., and Racher, A. J. (2006). Antibody production. Adv. Drug Deliv. Rev. 58, 671-685.
Bjorck, L., and Kronvall, G. (1984). Purification and some properties of streptococcal Protein G, a novel IgG-binding reagent. J. Immunol. 133, 969-974.
Cabanes-Macheteau, M., Fitchette-Laine, A. C, Loutelier-Bourhis, C , Lange, C, Vine, N. D., Ma, J. K., Lerouge, P., and Faye, L. (1999). N-Glycosylation of a mouse IgG expressed in transgenic tobacco plants. Glycobiology 9, 365-372.
Carter, P., Presta, L., Gorman, CM. , Ridgway, J. B. B., Henner, D., Wong, W. L. T., Rowland, A. M., Kotts, C, Carver, M. E., and Shepard, H. M. (1992). Humanization of an anti-pl85HER2 antibody for human cancer therapy. Proc. Natl. Acad. Sci. U.S.A. 89, 4285-4289.
Chadd, H. E., and Chamow, S. M. (2001). Therapeutic antibody expression technology. Curr. Opin. Biotechnol. 12, 188-194.
Chames, P., Van Regenmortel, M., Weiss, E., and Baty, D. (2009). Therapeutic antibodies: successes, limitations and hopes for the future. Br. J. Pharmacol. 157, 220-233.
Chargelegue, D., Vine, N. D., van Dolleweerd, C. J., Drake, P. M., and Ma, J. K. (2000). A murine monoclonal antibody produced in transgenic plants with plant-specific glycans is not immunogenic in mice. Transgenic Res. 9, 187-194.
Churchill, R. L. T., Sheedy, C, Yau, K. Y. F., and Hall, J. C. (2002). Evolution of antibodies for environmental monitoring: from mice to plants. Anal. Chim. Acta 468, 185-197.
Citri, A., and Yarden, Y. (2006). EGF-ERBB signalling: towards the systems level. Nat. Rev. Mol. Cell Biol. 7, 505-516.
Clonis, Y. D. (2006). Affinity chromatography matures as bioinformatic and combinatorial tools develop. J. Chromatogr. A 1101, 1-24.
Cobleigh, M. A., Vogel, C. L., Tripathy, D., Robert, N. J., Scholl, S., Fehrenbacher, L., Wolter, J. M., Paton, V., Shak, S., Lieberman, G., et al. (1999). Multinational study of the efficacy and safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast cancer that has progressed after chemotherapy for metastatic disease. J. Clin. Oncol. 17, 2639-2648.
90
Conley, A. J., Joensuu, J. J., Jevnikar, A. M., Menassa, R., and Brandle, J. E. (2009). Optimization of elastin-like polypeptide fusions for expression and purification of recombinant proteins in plants. Biotechnol. Bioeng. 103, 562-573.
Covic, A., and Kuhlmann, M. (2007). Biosimilars: recent developments. Int. Urol. Nephrol. 39, 261-266.
Cox, K. M., Regan, J. T., Sterling, J. D., Wingate, V. P., and Dickey, L. F. (2009). Production of antibodies in plants. In: Therapeutic Monoclonal Antibodies (An, Z., ed.), pp. 651-674. Hoboken, NJ: John Wiley & Sons, Inc.
Czermak, P., Nehring, D., and Wickramasinghe, R. (2007). Membrane filtration in animal cell culture. In: Animal Cell Biotechnology (Portner, R., ed.), pp. 397-420. Humana Press.
De Muynck, B., Navarre, C, and Boutry, M. (2010). Production of antibodies in plants: status after twenty years. Plant Biotechnol. J. 8, 529-563.
De Santes, K., Slamon, D., Anderson, S. K., Shepard, M., Fendly, B., Maneval, D., and Press, O. (1992). Radiolabeled antibody targeting of the HER-2/neu oncoprotein. Cancer Res. 52, 1916 -1923.
Deisenhofer, J. (1981). Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of Protein A from Staphylococcus aureus at 2.9- and 2.8-A resolution. Biochemistry 20, 2361-2370.
Dimitrov, D. S., and Marks, J. D. (2009). Therapeutic antibodies: current state and future trends - is a paradigm change coming soon? In: Therapeutic Antibodies (Dimitrov, A.S., ed), pp. 1-27. New York: Humana Press.
DrugBank (2009). Trastuzumab (DG00072). http://www.drugbank.ca/drugs/DB00072. Accessed November 4, 2010.
Evangelista, R. L., Kusnadi, A. R., Howard, J. A., andNikolov, Z. L. (1998). Process and economic evaluation of the extraction and purification of recombinant (3-glucuronidase from transgenic corn. Biotechnol. Prog. 14, 607-614.
Faye, L., and Gomord, V. (2010). Success stories in molecular farming-a brief overview. Plant Biotechnol. J. 8, 525-528.
Fendly, B. M., Winget, M., Hudziak, R. M., Lipari, M. T., Napier, M. A., and Ullrich, A. (1990). Characterization of murine monoclonal antibodies reactive to either the human epidermal growth factor receptor or HER2/neu gene product. Cancer Res. 50, 1550-1558.
91
Fischer, R., Liao, Y. C , and Drossard, J. (1999). Affinity-purification of a TMV-specific recombinant full-size antibody from a transgenic tobacco suspension culture. J. Immunol. Methods 226, 1-10.
Fischer, R., Schillberg, S., and Twyman, R. M. (2009). Molecular farming of antibodies in plants. In: Recent Advances in Plant Biotechnology (Kirakosyan, A. and Kaufman, P., eds.), pp 35-63. New York: Springer US.
Floss, D. M., Schallau, K., Rose-John, S., Conrad, U., and Scheller, J. (2010). Elastin-like polypeptides revolutionize recombinant protein expression and their biomedical application. Trends Biotechnol. 28, 37-45.
Fontes, N., and van Reis, R. (2009). Advances in technology and process development for industrial-scale monoclonal antibody purification. In: Process Scale Purification of Antibodies (Gottschalk, U. ed.), pp. 203-222. Hoboken, NJ: John Wiley & Sons, Inc.
Frey, A. D., Karg, S. R., and Kallio, P. T. (2009). Expression of rat (3(1,4)-N-acetylglucosaminyltransferase III in Nicotiana tabacum remodels the plant-specific N-glycosylation. Plant Biotechnol. J. 7, 33-48.
Fry, W. H., Kotelawala, L., Sweeney, C , and Carraway III, K. L. (2009). Mechanisms of ErbB receptor negative regulation and relevance in cancer. Exp. Cell Res. 315, 697-706.
Gilbert, N. (2009). Fees delay pharmed drug. Nature 458, 951.
Giritch, A., Marillonnet, S., Engler, C , Eldik, G. V., Botterman, J., Klimyuk, V., and Gleba, Y. (2006). Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors. Proc. Natl. Acad. Sci. U.S.A. 103, 14701-14706.
Gomord, V., Fitchette, A., Menu-Bouaouiche, L., Saint-Jore-Dupas, C , Plasson, C , Michaud, D., and Faye, L. (2010). Plant-specific glycosylation patterns in the context of therapeutic protein production. Plant Biotechnol. J. 8, 564-587.
Gomord, V., Sourrouille, C , Fitchette, A., Bardor, M., Pagny, S., Lerouge, P., and Faye, L. (2004). Production and glycosylation of plant-made pharmaceuticals: the antibodies as a challenge. Plant Biotechnol. J. 2, 83-100.
Gottlieb, S. (2008). Biosimilars: policy, clinical, and regulatory considerations. Am. J. Health Syst. Pharm. 65, S2-8.
Gouda, H., Torigoe, H., Saito, A., Sato, M., Arata, Y., and Shimada, I. (1992). Three-dimensional solution structure of the B domain of staphylococcal Protein A: comparisons of the solution and crystal structures. Biochemistry 31, 9665-9672.
92
Graille, M., Stura, E. A., Housden, N. G., Beckingham, J. A., Bottomley, S. P., Beale, D., Taussig, M. J., Sutton, B. J., Gore, M. G., and Charbonnier, J. B. (2001). Complex between Peptostreptococcus magnus Protein L and a human antibody reveals structural convergence in the interaction modes of Fab binding proteins. Structure 9, 679-687.
Graille, M., Stura, E. A., Corper, A. L., Sutton, B. J., Taussig, M. J., Charbonnier, J., and Silverman, G. J. (2000). Crystal structure of a Staphylococcus aureus Protein A domain complexed with the Fab fragment of a human IgM antibody: structural basis for recognition of B-cell receptors and superantigen activity. Proc. Natl. Acad. Sci. U.S.A. 97, 5399-5404.
Grohs, B. M., Niu, Y., Veldhuis, L. J., Trabelsi, S., Garabagi, F., Hassell, J. A., McLean, M. D., and Hall, J. C. (2010). Plant-produced trastuzumab inhibits the growth of HER2 positive cancer cells. J. Agric. Food Chem. 51, 10056-10063.
Guy, P. M., Platko, J. V., Cantley, L. C, Cerione, R. A., and Carraway, K. L. (1994). Insect cell-expressed pi80erbB3 possesses an impaired tyrosine kinase activity. Proc. Natl. Acad. Sci. U.S.A. 91, 8132 -8136.
Hage, D.S. (1998). Affinity chromatography. In: Handbook of HPLC (Katz, E., Eksteen, R., Shoenmakers, P., and Miller, N., eds.), pp. 483-498. New York: Marcel Dekker.
Hage, D.S., Bian, M., Burks, R., Karle, E., Ohnmact, C , and Wa, C. (2006a). Bioaffimty chromatography. In: Handbook of Affinity Chromatography (Hage, D.S., ed.), pp. 101-126. Boca Raton, FL: Taylor and Francis Group.
Hage, D.S., and Ruhn, P.F. (2006). An introduction to affinity chromatography. In: Handbook of Affinity Chromatography (Hage, D.S., ed.), pp 3-13. Boca Raton, FL: Taylor and Francis Group.
Hage, D.S., Xuan, H., and Nelson, M.A. (2006b). Application and elution in affinity chromatography. In: Handbook of Affinity Chromatography (Hage, D.S., ed.), pp. 79-97. Boca Raton, FL: Taylor and Francis Group.
Hassan, S., van Dolleweerd, C. J., Ioakeimidis, F., Keshavarz-Moore, E., and Ma, J. K. (2008). Considerations for extraction of monoclonal antibodies targeted to different subcellular compartments in transgenic tobacco plants. Plant Biotechnol. J. 6, 733-748.
Hefferon, K. L. (2010). Scale-up of plant-derived pharmaceuticals: prospects for commercial production and for global health. In: Biopharmaceuticals in Plants: Toward the Next Century of Medicine, pp. 117-146. Boca Raton, FL: Taylor and Francis Group.
93
Hiatt, A., Cafferkey, R., and Bowdish, K. (1989). Production of antibodies in transgenic plants. Nature 342, 76-78.
Hill, P., and Bender, J. (2007). Cell harvesting. In: Medicines from Animal Cell Culture (Stacey, G. and Davis, J., eds.), pp. 305-330. West Sussex, England: John Wiley & Sons, Inc.
Hober, S., Nord, K., and Linhult, M. (2007). Protein A chromatography for antibody purification. J. Chromatogr. B 848, 40-47.
Huang, Z., Phoolcharoen, W., Lai, H., Piensook, K., Cardineau, G., Zeitlin, L., Whaley, K. J., Arntzen, C. J., Mason, H. S., and Chen, Q. (2010). High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system. Biotechnol. Bioeng. 106, 9-17.
Hudziak, R. M., Lewis, G. D., Shalaby, M. R., Eessalu, T. E., Aggarwal, B. B., Ullrich, A., and Shepard, H. M. (1988). Amplified expression of the HER2/ERBB2 oncogene induces resistance to tumor necrosis factor alpha in NIH 3T3 cells. Proc. Natl. Acad. Sci. U.S.A. 85, 5102-5106.
Hudziak, R. M., Lewis, G. D., Winget, M., Fendly, B. M., Shepard, H. M., and Ullrich, A. (1989). pl85HER2 monoclonal antibody has antiproliferative effects in vitro and sensitizes human breast tumor cells to tumor necrosis factor. Mol. Cell. Biol. 9, 1165-1172.
Huse, K., Bohme, H., and Scholz, G. H. (2002). Purification of antibodies by affinity chromatography. J. Biochem. Biophys. Methods 51, 217-231.
Hussack, G., Grohs, B. M., Almquist, K. C , McLean, M. D., Ghosh, R., and Hall, J. C. (2010). Purification of plant-derived antibodies through direct immobilization of affinity ligands on cellulose. J. Agric. Food Chem. 58, 3451-3459.
Hynes, N. E., and Stern, D. F. (1994). The biology of erbB-2/neu/HER-2 and its role in cancer. Biochim. Biophys. Acta 1198, 165-184.
Janson, J., and Jonsson, J. (1998). Introduction to chromatography. In: Protein Purification: Principles, High-Resolution Methods, and Applications (Janson, J. and Ryden, L., eds.), pp. 43-78. New York, NY: John Wiley & Sons, Inc.
Jansson, B., Uhlen, M., and Nygren, P. A. (1998). All individual domains of staphylococcal Protein A show Fab binding. FEMS Immunol. Med. Microbiol. 20, 69-78.
Jendeberg, L., Persson, B., Andersson, R., Karlsson, R., Uhlen, M., and Nilsson, B. (1995). Kinetic analysis of the interaction between Protein A domain variants and human Fc using plasmon resonance detection. J. Mol. Recognit. 8, 270-278.
94
Jones, R. B., Gordus, A., Krall, J. A., and MacBeath, G. (2006). A quantitative protein interaction network for the ErbB receptors using protein microarrays. Nature 439, 168-174.
Jurado, L., Oak, A., Gadgil, H., Moxley, R., and Jarret, H. (2006). Affinity chromatography in molecular biology. In: Handbook of Affinity Chromatography (Hage, D., ed.), pp. 547-570. Boca Raton, FL: Taylor and Francis Group.
Karg, S. R., and Kallio, P. T. (2009). The production of biopharmaceuticals in plant systems. Biotechnol. Adv. 27, 879-894.
Karimi, A., Matsumura, M., Wright, P. E., and Dyson, H. J. (1999). Characterization of monomeric and dimeric B domain of staphylococcal Protein A. JPept. Res. 54, 344-352.
Kindt, T., Goldsby, R., and Osbourne, B. (2007). Cell-mediated cytotoxic responses. In: Immunology (Ahr, K., Tymoczko, N., and Tascheck, K., eds.), pp. 351-370. New York, NY: Freeman and Company.
Klapper, L. N., Glathe, S., Vaisman, N., Hynes, N. E., Andrews, G. C, Sela, M., and Yarden, Y. (1999). The ErbB-2/HER2 oncoprotein of human carcinomas may function solely as a shared coreceptor for multiple stroma-derived growth factors. Proc. Natl. Acad. Sci. U.S.A. 96, 4995-5000.
Ko, K., Brodzik, R., and Steplewski, Z. (2009). Production of antibodies in plants: approaches and perspectives. In: Plant-Produced Microbial Vaccines (Karasev, A., ed.), pp.55-78. Berlin, Heidelberg: Springer-Verlag.
Komarnytsky, S., Borisjuk, N., Yakoby, N., Garvey, A., and Raskin, I. (2006). Cosecretion of protease inhibitor stabilizes antibodies produced by plant roots. Plant Physiol. 141, 1185-1193.
Kronvall, G., and Williams, R. C. (1969). Differences in anti-Protein A activity among IgG subgroups. J. Immunol. 103, 828-833.
Kumar, R., Shepard, H. M., and Mendelsohn, J. (1991). Regulation of phosphorylation of the c-erbB-2/HER2 gene product by a monoclonal antibody and serum growth factor(s) in human mammary carcinoma cells. Mol. Cell. Biol. 11, 979-986.
Lane, H., Motoyama, A., Beuvink, I., and Hynes, N. (2001). Modulation of p27/Cdk2 complex formation through 4D5-mediated inhibition of HER2 receptor signaling. Ann. Oncol. 12, S21-S22.
Larsson, P. (1993). Support materials for affinity chromatography. In: Handbook of Affinity Chromatography (Kline, T., ed.) pp. 61-75. New York, NY: Marcel Dekker Inc.
95
Lazzara, M.J., and Lauffenburger, D.A. (2009). Quantitative modeling perspectives on the ErbB system of cell regulatory processes. Exp. Cell Res. 315, 717-725.
Le, X., Claret, F., Lammayot, A., Tian, L., Deshpande, D., LaPushin, R., Tari, A. M., and Bast, R. C. (2003). The role of cyclin-dependent kinase inhibitor p27Kipl in anti-HER2 antibody-induced Gl cell cycle arrest and tumor growth inhibition. J. Biol. Chem. 278, 23441-23450.
Le, X., McWatters, A., Wiener, J., Wu, J., Mills, G. B., and Bast, R. C. (2000). Anti-HER2 antibody and heregulin suppress growth of HER2-overexpressing human breast cancer cells through different mechanisms. Clin. Cancer Res. 6, 260-270.
Lemmon, M. A. (2009). Ligand-induced ErbB receptor dimerization. Exp. Cell Res. 315, 638-648.
Lenferink, A. E., Pinkas-Kramarski, R., van de Poll, M. L., van Vugt, M. J., Klapper, L. N., Tzahar, E., Waterman, H., Sela, M., van Zoelen, E. J., and Yarden, Y. (1998). Differential endocytic routing of homo- and hetero-dimeric ErbB tyrosine kinases confers signaling superiority to receptor heterodimers. EMBO J. 17, 3385-3397.
Leong, S. S., and Chen, W. N. (2008). Preparing recombinant single chain antibodies. Chem. Eng. Sci. 63, 1401-1414.
Lewis, G. D., Figari, I., Fendly, B., Lee Wong, W., Carter, P., Gorman, C , and Shepard, H. M. (1993). Differential responses of human tumor cell lines to anti-pl85HER2 monoclonal antibodies. Cancer Immunol. Immunother. 37, 255-263.
Li, Y. M., Pan, Y., Wei, Y., Cheng, X., Zhou, B. P., Tan, M., Zhou, X., Xia, W., Hortobagyi, G. N., Yu, D., et al. (2004). Upregulation of CXCR4 is essential for HER2-mediated tumor metastasis. Cancer Cell 6, 459-469.
Linhult, M., Gulich, S., Graslund, T., Simon, A., Karlsson, M., Sjoberg, A., Nord, K., and Hober, S. (2004). Improving the tolerance of a Protein A analogue to repeated alkaline exposures using a bypass mutagenesis approach. Proteins 55, 407-416.
Liu, H., Gaza-Bulseco, G., Faldu, D., Chumsae, C , and Sun, J. (2008). Heterogeneity of monoclonal antibodies. J. Pharm. Sci. 97, 2426-2447.
Marillonnet, S., Thoeringer, C, Kandzia, R., Klimyuk, V., and Gleba, Y. (2005). Systemic Agrobacterium tumefaciens-mQdiatQd transfection of viral replicons for efficient transient expression in plants. Nat. Biotechnol. 23, 718-723.
96
Marty, M., Cognetti, F., Maraninchi, D., Snyder, R., Mauriac, L., Tubiana-Hulin, M., Chan, S., Grimes, D., Anton, A., Lluch, A., et al. (2005). Randomized phase II trial of the efficacy and safety of trastuzumab combined with docetaxel in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer administered as first-line treatment: the M77001 study group. J. Clin. Oncol. 23, 4265-4274.
McLean, M. D., Almquist, K. C., Niu, Y., Kimmel, R., Lai, Z., Schreiber, J. R., and Hall, J. C. (2007). A human anti-Pseudomonas aeruginosa serotype 06ad immunoglobulin Gl expressed in transgenic tobacco is capable of recruiting immune system effector function in vitro. Antimicrob. Agents Chemother. 51, 3322-3328.
Menkhaus, T. J., Bai, Y., Zhang, C., Nikolov, Z. L., and Glatz, C. E. (2004). Considerations for the recovery of recombinant proteins from plants. Biotechnol. Prog. 20, 1001-1014.
Miele, L. (1997). Plants as bioreactors for biopharmaceuticals: regulatory considerations. Trends Biotechnol. 15, 45-50.
Mison, D., and Curling, J. (2000). The industrial production cost of recombinant therapeutic proteins expressed in transgenic corn. Biopharm. 13, 48-54.
Mohr, P., and Pommerening, K. (1985a). General considerations of the adsorption and elution step. In: Affinity Chromatography: Practical and Theoretical Aspects, pp. 85-119. New York: Marcel Dekker Inc.
Mohr, P., and Pommerening, K. (1985b). Solid matrix support. In: Affinity Chromatography: Practical and Theoretical Aspects, pp. 19-39. New York: Marcel Dekker Inc.
Mohsin, S. K., Weiss, H. L., Gutierrez, M. C , Chamness, G. C , Schiff, R., DiGiovanna, M. P., Wang, C , Hilsenbeck, S. G., Osborne, C. K., Allred, D. C, et al. (2005). Neoadjuvant trastuzumab induces apoptosis in primary breast cancers. J. Clin. Oncol. 23, 2460-2468.
Molina, M. A., Codony-Servat, J., Albanell, J., Rojo, F., Arribas, J., and Baselga, J. (2001). Trastuzumab (Herceptin), a humanized anti-HER2 receptor monoclonal antibody, inhibits basal and activated Her2 ectodomain cleavage in breast cancer cells. Cancer Res. 61,4744-4749.
Mori, K., Iida, S., Yamane-Ohnuki, N., Kanda, Y., Kuni-Kamochi, R., Nakano, R., Imai-Nishiya, H., Okazaki, A., Shinkawa, T., Natsume, A., et al. (2007). Non-fucosylated therapeutic antibodies: the next generation of therapeutic antibodies. Cytotechnology 55, 109-114.
97
Narayanan, S. R. (1994). Preparative affinity chromatography of proteins. J. Chromatogr. A 658, 237-258.
Nelson, D., and Cox, M. (2005). Protein function. In: Lehninger Principles of Biochemistry (Ahr, K., Ryan, M., O'Neill, J., and Wong, V., eds.), pp. 160-161. New York, NY: Freeman and Company.
Nikolov, Z. L., Regan, J. T., Dickey, L. F., and Woodard, S. L. (2009). Purification of antibodies from transgenic plants. In: Process Scale Purification of Antibodies (Gottschalk, U., ed.), pp. 387-406. Hoboken, NJ: John Wiley & Sons, Inc.
Nilson, B. H., Solomon, A., Bjorck, L., and Akerstrom, B. (1992). Protein L from Peptostreptococcus magnus binds to the kappa light chain variable domain. J. Biol. Chem. 267, 2234 -2239.
Nilsson, B., Moks, T., Jansson, B., Abrahmsen, L., Elmblad, A., Holmgren, E., Henrichson, C, Jones, T., and Uhlen, M. (1987). A synthetic IgG-binding domain based on staphylococcal Protein A. Protein Eng. 1, 107-113.
Nissim, A., and Chernajovsky, Y. (2008). Historical development of monoclonal antibody therapeutics. In: Therapeutic Antibodies (Chernajovsky, Y. and Nissim, A., eds.), pp. 3-18. Berlin, Heidelberg: Springer-Verlag.
Olea-Popelka, F., McLean, M. D., Horsman, J., Almquist, K., Brandle, J. E., and Hall, J. C. (2005). Increasing expression of an anti-picloram single-chain variable fragment (ScFv) antibody and resistance to picloram in transgenic tobacco (Nicotiana tabacum). J. Agric. Food Chem. 53, 6683-6690.
Ostrove, S. (1990). Affinity chromatography: general methods. Methods Enzymol. 182, 357-371.
Parmenter, D. L., Boothe, J. G., Rooijen, G. J. H., Yeung, E. C, and Moloney, M. M. (1995). Production of biologically active hirudin in plant seeds using oleosin partitioning. Plant Mol. Biol. 29, 1167-1180.
Pegram, M. D., Lipton, A., Hayes, D. F., Weber, B. L., Baselga, J. M., Tripathy, D., Baly, D., Baughman, S. A., Twaddell, T., Glaspy, J. A., et al. (1998). Phase II study of receptor-enhanced chemosensitivity using recombinant humanized anti-pi 85HER2/neu monoclonal antibody plus cisplatin in patients with HER2/neu-overexpressing metastatic breast cancer refractory to chemotherapy treatment. J. Clin. Oncol. 16,2659-2671.
Phillips, T.M. (2006). Affinity chromatography in antibody and antigen purification. In: Handbook of Affinity Chromatography (Hage, D.S., ed.), pp. 367-397. New York, NY: Taylor and Francis Group.
98
Phillips, T.M, and Dickens, B.F. (2000a). Affinity and immunoaffinity separations. In: Affinity and Immunoaffinity Purification Techniques (Weaver, S. and McAndrews, C , eds.), pp. 1-18. Natick, MA: Eaton Publishing.
Phillips, T.M., and Dickens, B.F. (2000b). Factors Influencing Separation. In: Affinity and Immunoaffinity Purification Techniques (Weaver, S. and McAndrews, C , eds.), pp. 55-84. Natick, MA: Eaton Publishing.
Phillips, T., Queen, W., More, N., and Thompson, A. (1985). Protein A-coated glass beads: universal support medium for high-performance immunoaffinity chromatography. J. Chromatogr. A 327, 213-219.
Platis, D., Drossard, J., Fischer, R., Ma, J., and Labrou, N. (2008). New downstream processing strategy for the purification of monoclonal antibodies from transgenic tobacco plants. J. Chromatogr. A 1211, 80-89.
Platis, D., and Labrou, N. E. (2006). Development of an aqueous two-phase partitioning system for fractionating therapeutic proteins from tobacco extract. /. Chromatogr. ,4 1128, 114-124.
Pujol, M., Ramirez, N. I., Ayala, M., Gavilondo, J. V., Valdes, R., Rodriguez, M., Brito, J., Padilla, S., Gomez, L., Reyes, B., et al. (2005). An integral approach towards a practical application for a plant-made monoclonal antibody in vaccine purification. Vaccine 23, 1833-1837.
Ramessar, K., Rademacher, T., Sack, M., Stadlmann, J., Platis, D., Stiegler, G., Labrou, N., Altmann, F., Ma, J., Stoger, E., et al. (2008). Cost-effective production of a vaginal protein microbicide to prevent HIV transmission. Proc. Natl. Acad. Sci. U.S.A 105, 3727-3732.
Reed, S. I. (2003). Ratchets and clocks: the cell cycle, ubiquitylation and protein turnover. Nat. Rev. Mol. Cell Biol. 4, 855-864.
van Reis, R., and Zydney, A. (2001). Membrane separations in biotechnology. Curr. Opin. Biotechnol. 12, 208-211.
Rodriguez, M., Ramirez, N. I., Ayala, M., Freyre, F., Perez, L., Triguero, A., Mateo, C, Selman-Housein, G., Gavilondo, J. V., and Pujol, M. (2005). Transient expression in tobacco leaves of an aglycosylated recombinant antibody against the epidermal growth factor receptor. Biotechnol Bioeng. 89, 188-194.
Rooijen, G. J. H. V., and Moloney, M. M. (1995). Plant seed oil-bodies as carriers for foreign proteins. Nat. Biotech. 13, 72-77.
Roque, A., Lowe, C , and Taipa, M. (2004). Antibodies and genetically engineered related molecules: production and purification. Biotechnol. Prog. 20, 639-654.
99
Roque, A. C , Silva, C. S., and Taipa, M. A. (2007). Affinity-based methodologies and ligands for antibody purification: advances and perspectives. J. Chromatogr. A 1160, 44-55.
Sack, M., Paetz, A., Kunert, R., Bomble, M., Hesse, F., Stiegler, G., Fischer, R., Katinger, H., Stoeger, E., and Rademacher, T. (2007). Functional analysis of the broadly neutralizing human anti-HIV-1 antibody 2F5 produced in transgenic BY-2 suspension cultures. FASEB J. 21, 1655-1664.
Sahin, O., and Wiemann, S. (2009). Functional genomics and proteomics approaches to study the ERBB network in cancer. FEBSLett. 583, 1766-1771.
Samac, D. A., Hironaka, C. M., Yallaly, P. E., and Shah, D. M. (1990). Isolation and characterization of the genes encoding basic and acidic chitinase in Arabidopsis thaliana. Plant Physiol. 93, 907-914.
Samanta, A., LeVea, C. M., Dougall, W. C, Qian, X., and Greene, M. I. (1994). Ligand and pl85c-neu density govern receptor interactions and tyrosine kinase activation. Proc. Natl. Acad. Sci. U.S.A. 91, 1711-1715.
Sanbe, H., and Haginaka, J. (2003). Uniformly sized molecularly imprinted polymers for bisphenol A and P-estradiol: retention and molecular recognition properties in hydro-organic mobile phases. J. Pharm. Biomed. Anal. 30, 1835-1844.
Sarup, J. C, Johnson, R. M., King, K. L., Fendly, B. M., Lipari, M. T., Napier, M. A., Ullrich, A., and Shepard, H. M. (1991). Characterization of an anti-pl85HER2 monoclonal antibody that stimulates receptor function and inhibits tumor cell growth. Growth Regul. 1, 72-82.
Sauer-Eriksson, A. E., Kleywegt, G. J., Uhlen, M., and Jones, T. A. (1995). Crystal structure of the C2 fragment of streptococcal Protein G in complex with the Fc domain of human IgG. Structure 3, 265-278.
Saxena, A., Tripathi, B. P., Kumar, M., and Shahi, V. K. (2009). Membrane-based techniques for the separation and purification of proteins: an overview. Adv. Colloid. Interface Sci. 145, 1-22.
Schillberg, S., Fischer, R., and Emans, N. (2003). Molecular farming of recombinant antibodies in plants. Cell Mol. Life. Sci. 60, 433-445.
Schmitz, K. R., and Ferguson, K. M. (2009). Interaction of antibodies with ErbB receptor extracellular regions. Exp. Cell Res. 315, 659-670.
Seon, J., Szarka, S., and Moloney, M. (2002). A unique strategy for recovering recombinant proteins from molecular farming: affinity capture on engineered oilbodies. J. Plant Biotechnol. 4, 95-101.
100
Sharp, J. M., and Doran, P. M. (2001). Characterization of monoclonal antibody fragments produced by plant cells. Biotechnol. Bioeng. 73, 338-346.
Shepard, H., and Lewis, G. (1988). Resistance of tumor cells to tumor necrosis factor. J. Clin. Immunol. 8, 333-341.
Shepard, H. M., Brdlik, C. M., and Schreiber, H. (2008). Signal integration: a framework for understanding the efficacy of therapeutics targeting the human EGFR family. J. Clin. Invest. 118, 3574-3581.
Sherr, C. J., and Roberts, J. M. (1999). CDK inhibitors: positive and negative regulators of Gl-phase progression. Genes Dev. 13, 1501-1512.
Shukla, A. A., Hubbard, B., Tressel, T., Guhan, S., and Low, D. (2007). Downstream processing of monoclonal antibodies-application of platform approaches. J. Chromatogr. B 848, 28-39.
Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L. (1987). Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182.
Slamon, D. J., Godolphin, W., Jones, L. A., Holt, J. A., Wong, S. G., Keith, D. E., Levin, W. J., Stuart, S. G., Udove, J., and Ullrich, A. (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244, 707-712.
Slamon, D. J., Leyland-Jones, B., Shak, S., Fuchs, H., Paton, V., Bajamonde, A., Fleming, T., Eiermann, W., Wolter, J., Pegram, M., et al. (2001). Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N. Engl. J. Med. 344, 783-792.
Sliwkowski, M. X., Lofgren, J. A., Lewis, G. D., Hotaling, T. E., Fendly, B. M., and Fox, J. A. (1999). Nonclinical studies addressing the mechanism of action of trastuzumab (Herceptin). Semin. Oncol. 26, 60-70.
Stahl, S., Nygren, P. A., Sjolander, A., and Uhlen, M. (1993). Engineered bacterial receptors in immunology. Curr. Opin. Immunol. 5, 272-277'.
Starovasnik, M. A., Skelton, N. J., O'Connell, M. P., Kelley, R. F., Reilly, D., and Fairbrother, W. J. (1996). Solution structure of the E-domain of staphylococcal Protein A. Biochemistry 35, 15558-15569.
Stevens, L. H., Stoopen, G. M., Elbers, I. J., Molthoff, J. W., Bakker, H. A., Lommen, A., Bosch, D., and Jordi, W. (2000). Effect of climate conditions and plant developmental stage on the stability of antibodies expressed in transgenic tobacco. Plant Physiol. 124, 173-182.
101
Stoger, E., Sack, M., Nicholson, L., Fischer, R., and Christou, P. (2005). Recent progress in plantibody technology. Curr. Pharm. Des. 11, 2439-2457.
Stoger, E., Sack, M., Fischer, R., and Christou, P. (2002). Plantibodies: applications, advantages and bottlenecks. Curr. Opin. Biotechnol. 13, 161-166.
Stoger, E., Schillberg, S., Twyman, R. M., Fischer, R., and Christou, P. (2004). Antibody production in transgenic plants. In: Antibody Engineering - Methods and Protocols (Lo, B. K., ed.), pp. 301-318. Totowa, NJ: Humana Press Inc.
Strasser, R., Castilho, A., Stadhnann, J., Kunert, R., Quendler, H., Gattinger, P., Jez, J., Rademacher, T., Altmann, F., Mach, L., et al. (2009). Improved virus neutralization by plant-produced anti-HIV antibodies with a homogeneous pi,4-galactosylated N-glycan profile. J. Biol. Chem. 284, 20479-20485.
Strasser, R., Stadlmann, J., Schahs, M., Stiegler, G., Quendler, H., Mach, L., Glossl, J., Weterings, K., Pabst, M., and Steinkellner, H. (2008). Generation of glyco-engineered Nicotiana benthamiana for the production of monoclonal antibodies with a homogeneous human-like N-glycan structure. Plant Biotechnol. J. 6, 392-402.
Suzuki, E., Niwa, R., Saji, S., Muta, M., Hirose, M., Iida, S., Shiotsu, Y., Satoh, M., Shitara, K., Kondo, M., et al. (2007). A nonfucosylated anti-HER2 antibody augments antibody-dependent cellular cytotoxicity in breast cancer patients. Clin. Cancer Res. 13, 1875-1882.
Tashiro, M., Tejero, R., Zimmerman, D. E., Celda, B., Nilsson, B., and Montelione, G. T. (1997). High-resolution solution NMR structure of the Z domain of staphylococcal Protein A. /. Mol. Biol. 272, 573-590.
Terman, D. S. (1985a). Protein A and staphylococcal products in neoplastic disease. Crit. Rev. Oncol. Hematol. 4, 103-124.
Terman, D. S. (1985b). Antitumor effects of immobilized Protein A and staphylococcal products: linkage between toxicity and efficacy, and identification of potential tumoricidal reagents. Eur. J. Cancer Clin. Oncol. 21, 1115-1122.
Torigoe, H., Shimada, I., Saito, A., Sato, M., and Arata, Y. (1990). Sequential 1H NMR assignments and secondary structure of the B domain of staphylococcal Protein A: structural changes between the free B domain in solution and the Fc-bound B domain in crystal. Biochemistry 29, 8787-8793.
Turkova, J. (1999). Oriented immobilization of biologically active proteins as a tool for revealing protein interactions and function. J. Chromatogr. B Biomed. Sci. Appl. 722, 11-31.
102
Twyman, R. M, Schillberg, S., and Fischer, R. (2005). Transgenic plants in the biopharmaceutical market. Expert Opin. Emerg. Drugs 10, 185-218.
Twyman, R. M., Schillberg, S., and Fischer, R. (2007). Molecular farming of antibodies in plants. In: Improvement of Crop Plants for Industrial End Uses (Ranalli, P., ed.), pp. 435-469. Dordrecht, The Netherlands: Springer Netherlands.
Uhlen, M., and Moks, T. (1990). Gene fusions for purpose of expression: an introduction. Methods Enzymol. 185, 129-143.
United States Food and Drug Administration (FDA) Center for Drug Evaluation and Research (2009). Therapeutic Biologic Applications (BLA) - Trastuzumab Product Approval Information - Licensing Action 9/25/98. http://www.fda.gov/Drugs/DevelopmentApprovalProcess/HowDrugsareDevelope dandApproved/ApprovalApplications/TherapeuticBiologicApplications/ucm0805 91.htm. Accessed November 4, 2010.
Valdes, R., Gomez, L., Padilla, S., Brito, J., Reyes, B., Alvarez, T., Mendoza, O., Herrera, O., Ferro, W., Pujol, M., et al. (2003). Large-scale purification of an antibody directed against hepatitis B surface antigen from transgenic tobacco plants. Biochem. Biophys. Res. Commun. 308, 94-100.
Vanhaesebroeck, B., and Waterfield, M. D. (1999). Signaling by distinct classes of phosphoinositide 3-kinases. Exp. Cell Res. 253,239-254.
Varchetta, S., Gibelli, N., Oliviero, B., Nardini, E., Gennari, R., Gatti, G., Silva, L. S., Villani, L., Tagliabue, E., Menard, S., et al. (2007). Elements related to heterogeneity of antibody-dependent cell cytotoxicity in patients under trastuzumab therapy for primary operable breast cancer overexpressing HER2. Cancer Res. 67, 11991-11999.
Vezina, L., Faye, L., Lerouge, P., D'Aoust, M., Marquet-Blouin, E., Burel, C, Lavoie, P., Bardor, M., and Gomord, V. (2009). Transient co-expression for fast and high-yield production of antibodies with human-like N-glycans in plants. Plant Biotechnol. J. 7, 442-455.
Vivanco, I., and Sawyers, C. L. (2002). The phosphatidylinositol 3-kinase-AKT pathway in human cancer. Nat. Rev. Cancer 2, 489-501.
Vogel, C. L., Cobleigh, M. A., Tripathy, D., Gutheil, J. C., Harris, L. N., Fehrenbacher, L., Slamon, D. J., Murphy, M., Novotny, W. F., Burchmore, M., et al. (2002). Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER2-overexpressing metastatic breast cancer. J. Clin. Oncol. 20, 719-726.
103
Wen, X., Yang, G., Mao, W., Thornton, A., Liu, J., Bast, R. C., and Le, X. (2006). HER2 signaling modulates the equilibrium between pro- and antiangiogenic factors via distinct pathways: implications for HER2-targeted antibody therapy. Oncogene 25, 6986-6996.
Wideback, K., and Kronvall, G. (1982). Surface receptors for serum albumin in group C and G streptococci show three different types of albumin specificity. Infect. Immun. 38, 1154-1163.
Wideback, K., Seal, U. S., and Kronvall, G. (1982). Receptor in group C and G streptococci detects albumin structures present in mammalian species. Infect. Immun. 36, 469-475.
Wikstrom, M., Drakenberg, T., Forsen, S., Sjobring, U., and Bjorck, L. (1994). Three-dimensional solution structure of an immunoglobulin light chain-binding domain of Protein L. Comparison with the IgG-binding domains of Protein G. Biochemistry 33, 14011-14017.
Woodard, S. L., Wilken, L. R., Barros, G. O., White, S. G., andNikolov, Z. L. (2009). Evaluation of monoclonal antibody and phenolic extraction from transgenic Lemna for purification process development. Biotechnol. Bioeng. 104, 562-571.
Worthylake, R., Opresko, L. K., and Wiley, H. S. (1999). ErbB-2 amplification inhibits down-regulation and induces constitutive activation of both ErbB-2 and epidermal growth factor receptors. J. Biol. Chem. 21 A, 8865 -8874.
Yakes, F. M., Chinratanalab, W., Ritter, C. A., King, W., Seelig, S., and Arteaga, C. L. (2002). Herceptin-induced inhibition of phosphatidylinositol-3 kinase and Akt Is required for antibody-mediated effects on p27, cyclin Dl, and antitumor action. Cancer Res. 62,4132-4141.
Yang, H., Zhou, B. P., Hung, M., and Lee, M. (2000). Oncogenic signals of HER-2/neu in regulating the stability of the cyclin-dependent kinase inhibitor p27. J. Biol. Chem. 275, 24735-24739.
Yarden, Y., and Sliwkowski, M. X. (2001). Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2, 127-137.
Yu, D., McLean, M. D., Hall, J. C , and Ghosh, R. (2008a). Purification of a human immunoglobulin Gl monoclonal antibody from transgenic tobacco using membrane chromatographic processes. J. Chromatogr. A 1187, 128-137.
Yu, D., McLean, M. D., Hall, J. C., and Ghosh, R. (2008b). Purification of monoclonal antibody from tobacco extract using membrane-based bioseparation techniques. J. Memb. Sci. 323, 159-166.
104
Zeman, L., and Zydney, A. (1996a). Biotechnological applications. In: Microfiltration and Ultrafiltration - Principles and Applications, pp. 544-563. New York, NY: Marcel Dekker Inc.
Zeman, L., and Zydney, A. (1996b). Module Design and Membrane Configurations. In: Microfiltration and Ultrafiltration - Principles and Applications, pp. 327-349. New York, NY: Marcel Dekker Inc.
Zheng, D., Aramini, J., and Montelione, G. (2004). Validation of helical tilt angles in the solution NMR structure of the Z domain of staphylococcal Protein A by combined analysis of residual dipolar coupling and NOE data. Protein Set 13, 549-554.
Zhou, B. P., Liao, Y., Xia, W., Spohn, B., Lee, M. H., and Hung, M. C. (2001). Cytoplasmic localization of p21Cipl/WAFl by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nat. Cell Biol. 3,245-252.
Zhou, B. P., Hu, M. C , Miller, S. A., Yu, Z., Xia, W., Lin, S., and Hung, M. (2000). HER-2/neu blocks tumor necrosis factor-induced apoptosis via the Akt/NF-icB pathway. J. Biol. Chem. 275, 8027-8031.
105
Top Related