1
Bioinformatics analysis and characterization of highly efficient 1
polyvinyl alcohol (PVA)-degrading enzymes from the novel PVA 2
degrader Stenotrophomonas rhizophila QL-P4 3
4
Yahong Weia#
, Jing Fub, c#
, Jianying Wua#
, Xinmiao Jiad#
, Yunheng Zhoua#
, Cuidan 5
Lib, c
, Mengxing Dongb, c
, Shanshan Wangb, c
, Ju Zhangb*
, Fei Chenb, c, e*
6
7
College of Life Sciences, Biomass Energy Center for Arid and Semi-Arid Lands, 8
State Key Laboratory of Crop Stress Biology for Arid Areas, Northwest A&F 9
University, Yangling, Shaanxi, Chinaa ; CAS Key Laboratory of Genome Sciences & 10
Information, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing, 11
Chinab; College of Life Sciences, University of Chinese Academy of Sciences, 12
Beijing, Chinac; Central Research Laboratory, Peking Union Medical College 13
Hospital, Peking Union Medical College & Chinese Academy of Medical Sciences, 14
Beijing, Chinad; Collaborative Innovation Center for Genetics and Development, 15
Shanghai, Chinae. 16
17
Running title: PVA degradation by Stenotrophomonas rhizophila QL-P4 18
19
#These authors contributed equally to this paper as the first authors.
20
AEM Accepted Manuscript Posted Online 27 October 2017Appl. Environ. Microbiol. doi:10.1128/AEM.01898-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
2
*Address correspondence to Fei Chen or Ju Zhang, [email protected] or 21
23
Abstract 24
Polyvinyl alcohol (PVA) is used widely in industry, and associated environmental 25
pollution is a serious problem. Herein, we report a novel, efficient PVA degrader, 26
Stenotrophomonas rhizophila QL-P4, isolated from fallen leaves from virgin forest in 27
the Qinling Mountains. The complete genome was obtained using single-molecule 28
real-time (SMRT) technology and corrected using Illumina sequencing. 29
Bioinformatics analysis revealed eight PVA/OVA (vinyl alcohol oligomer)-degrading 30
genes. Of these, seven genes were predicted to be involved in the classical 31
intracellular PVA/OVA degradation pathway, and one (BAY15_3292) was identified 32
as a novel PVA oxidase. Five PVA/OVA-degrading enzymes were purified and 33
characterised. Among which, BAY15_1712, a PVA dehydrogenase (PVADH), 34
displayed high catalytic efficiency towards PVA and OVA substrate. All reported 35
PVADHs only have PVA-degrading ability. Most importantly, we discovered a novel 36
PVA oxidase (BAY15_3292) that exhibited highest PVA-degrading efficiency than 37
the reported PVADHs. Further investigation indicated that BAY15_3292 plays a 38
crucial role in PVA degradation in S. rhizophila QL-P4. Knocking out BAY15_3292 39
resulted in a significant decline in PVA-degrading activity in S. rhizophila QL-P4. 40
Interestingly, we found that BAY15_3292 possesses exocrine activity, which 41
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
3
distinguishes it from classical PVADHs. Transparent circle experiments further 42
proved that BAY15_3292 greatly affects extracellular PVA degradation in S. 43
rhizophila QL-P4. The exocrine characteristics of BAY15_3292 facilitate its potential 44
application to PVA bioremediation. In addition, we report three new efficient 45
secondary alcohol dehydrogenases (SADHs) with OVA-degrading ability in S. 46
rhizophila QL-P4, compared with only one OVA-degrading SADH as reported 47
previously. 48
49
Importance 50
With the widespread application of PVA in industry, PVA-related environmental 51
pollution is an increasingly serious issue. Because PVA is difficult to degrade, it 52
accumulates in aquatic environments and causes chronic toxicity to aquatic organisms. 53
Biodegradation of PVA, as an economical and environment-friendly method, has 54
attracted much interest. To date, effective and applicable PVA-degrading bacteria/ 55
enzymes have not been reported. Herein, we report a new efficient PVA degrader (S. 56
rhizophila QL-P4) that has five PVA/OVA-degrading enzymes with high catalytic 57
efficiency, among which BAY15_1712 is the only reported PVADH with both PVA- 58
and OVA-degrading abilities. Importantly, we discovered a novel PVA oxidase 59
(BAY15_3292) that is not only more efficient than other reported PVA-degrading 60
PVADHs, but also has exocrine activity. Overall, our findings provide new insight 61
into PVA-degrading pathways in microorganisms, and suggest S. rhizophila QL-P4 62
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
4
and its enzymes have potential for application to PVA bioremediation to reduce or 63
eliminate PVA-related environmental pollution. 64
65
Keywords: Stenotrophomonas rhizophila; single-molecule real-time (SMRT); 66
PacBio; polyvinyl alcohol (PVA); vinyl alcohol oligomers (OVA); biodegradation; 67
high-throughout sequencing; environmental microorganism. 68
69
Introduction 70
Polyvinyl alcohol (PVA) is a water-soluble synthetic polymer with excellent 71
physical properties such as thermostability, viscosity, film-forming, emulsifying, 72
tensile strength and flexibility (1). PVA has been widely used in coatings, adhesives, 73
films, and emulsion polymerisation (1). According to the Grand View Research (GVR) 74
market analysis, the global PVA market size was estimated at 1.124 million tons in 75
2016, almost half of which was consumed in China 76
(http://www.grandviewresearch.com/). 77
With the widespread use of PVA in multiple areas such as textiles, foods, medicine, 78
industry, construction and chemicals, associated environmental pollution has reached 79
serious proportions (2, 3). PVA is difficult to degrade in natural environments (4, 5), 80
hence it accumulates, especially in aquatic environments, where it poses a risk by 81
inducing hypoxia and metal poisoning, and causes chronic toxicity to aquatic 82
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
5
organisms. Consequently, it harms the entire food chain (1, 2). It is therefore urgent to 83
develop effective methods for PVA degradation and bioremediation. 84
At present, PVA industrial degradation methods mainly include physical-chemical 85
degradation and biodegradation (6). Since physical-chemical degradation has several 86
drawbacks such as low efficiency, high cost, and secondary pollution (5), 87
biodegradation (including microbial and enzymatic degradation) is attracting 88
increasing interest due to its economic and environmental protection advantages (7). 89
Two PVA biodegradation mechanisms are present in bacteria: intracellular and 90
extracellular degradation (1). Intracellular degradation plays a major role in PVA 91
biodegradation, whereas extracellular degradation plays a secondary role (1). In 92
intracellular degradation, PVA (or partially depolymerised PVA) is assimilated into 93
the periplasm where it is oxidised by intracellular PQQ-dependent PVA 94
dehydrogenase (PVADH) with cytochrome C as an electron acceptor (the first step), 95
then hydrolysed by oxidized PVA (oxiPVA) hydrolase (OPH) (8) or β-diketone 96
hydrolase (BDH) (9). In extracellular degradation, PVA is oxidised by secreted 97
secondary alcohol oxidase (SAO; first step) with O2 as an electron acceptor, and 98
oxiPVA is hydrolysed by secreted BDH (second step) (9). 99
Although the biodegradation characteristics of PVA have been known for a long 100
time (10), our knowledge of microbial and enzymatic degradation of PVA is 101
insufficient, and currently limited to Pseudomonas and Sphingomonads (1), of which 102
only Sphingopyxis sp. strain 113P3 has been precisely characterised in terms of its 103
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
6
PVA-degrading operon (pva) (11, 12). Furthermore, application of effective 104
PVA-degrading enzymes has been hampered by the fact that PVADH is expressed 105
mainly in inclusion bodies, with only a small amount in the supernatant or secreted 106
into the culture medium (13). 107
Due to limitations of DNA sequencing, the genome of only a single 108
PVA-degrading strain (Sphingopyxis sp. 113P3) has been completed (14), which has 109
impeded the in-depth mechanistic analysis of PVA biodegradation. However, the 110
rapid development of high-throughput DNA sequencing technologies offers 111
opportunities for discovering new PVA-degrading bacteria and enzymes. In 112
particular, single-molecule real-time (SMRT) DNA sequencing developed by Pacific 113
Biosciences is more suitable for bacterial genome sequencing and assembly than other 114
methods due to advantages including a longer average read length and no GC bias 115
(15). 116
Herein, we report the complete genome of a novel PVA-degrader, 117
Stenotrophomonas rhizophila QL-P4, determined using SMRT DNA sequencing, and 118
assess its PVA degradation ability. Based on sequence alignment with genes 119
reportedly involved in PVA degradation (11, 12, 16-19), we identified eight 120
PVA/OVA-degrading genes in the genome (OVA is one of the products of PVA 121
degradation (20)). Five of these enzymes (two PVADHs and three SADHs) were 122
purified and characterised, and enzyme kinetics experiments showed that all could 123
efficiently degrade PVA/OVA. Importantly, BAY15_3292 not only displayed high 124
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
7
catalytic efficiency, but was also expressed highly and solubly in the supernatant, and 125
could also be directly secreted. These advantages could facilitate potential industrial 126
and PVA biodegradation applications. In addition, we identified the only reported 127
PVADH (BAY15_1712) with both PVA and OVA degrading-abilities. Overall, our 128
findings expand our understanding of PVA-degrading pathways in microorganisms, 129
and suggest S. rhizophila QL-P4 and its enzymes may provide a novel resource for 130
the degradation of PVA, and further show feasibility of biodegradation to reduce and 131
eliminate industrial polymer associated environmental pollution. 132
133
Results and discussion 134
Isolation and characterisation of the novel PVA degrader Stenotrophomonas 135
rhizophila QL-P4 136
The new PVA-degrading strain was isolated from fallen leaves from virgin forest in 137
Qinling Mountains, Xi’an, Shaanxi, China, and named Stenotrophomonas rhizophila 138
based on 16S rRNA gene sequences (99.81% identity to S. rhizophila strain 139
DSM14405T, NCBI accession number CP007597) (21). Scanning electron 140
microscopy (SEM) revealed morphological features and confirmed typical bacilliform 141
cells with a rough surface due to irregular wrinkles (Figure S1, scale bar = 500 nm). 142
Bacterial growth and PVA degradation curves of S. rhizophila QL-P4 were 143
measured with medium containing different initial concentrations of PVA as single 144
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
8
carbon source (Figure 1). These results demonstrated that the strain grew well in PVA 145
medium, indicating that it was able to efficiently degrade PVA and utilise it as a 146
carbon source. On the fifth day of culturing, the percentages of PVA-degradation 147
were 46.2% and 36.1% with an initial PVA concentration of 0.1% and 0.5%, 148
respectively. We then compared our strain with other reported PVA-degrading 149
bacteria (Table S1). The percentages of PVA-degradation (at 24h) by S. rhizophila 150
QL-P4 were ~35% and ~30% with an initial PVA concentration of 0.1% and 0.5%, 151
respectively. The degradation ability of our strain was higher than other reported PVA 152
degraders (11, 22-26). This is the only reported Stenotrophomonas strain with 153
PVA-degrading ability, although some other biological properties of this 154
Stenotrophomonas genus have been established previously, including degradation of 155
chlorpyrifos, organophosphorus pesticides, hexavalent chromate, 156
dichlorodiphenyltrichloroethane (DDT) and CI Acid Red 1 (27-31). 157
158
Bioinformatics analysis of S. rhizophila QL-P4 reveals eight genes encoding 159
potential PVA-degrading proteins 160
The complete genome of S. rhizophila QL-P4 was obtained by SMRT sequencing 161
and corrected using Illumina sequencing. Bioinformatics analysis provided general 162
genome information (Figure S2 and Table S2), including GC content (66.85%), 163
genome size (4.20 Mb), and the number of predicted protein-coding genes (3,659). 164
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
9
Based on sequence alignment of genes and corresponding protein domains 165
reportedly involved in PVA degradation (11, 12, 16-19), we identified eight putative 166
PVA/OVA-degrading genes in the S. rhizophila QL-P4 genome (BAY15_1712, 167
BAY15_2325, BAY15_3292, BAY15_0976, BAY15_3123, BAY15_3143, 168
BAY15_0160, and BAY15_0291) (Figure 2; Figure S3; Table S3). Among them, 169
seven genes (BAY15_1712, BAY15_2325, BAY15_0976, BAY15_3123, 170
BAY15_3143, BAY15_0160 and BAY15_0291) are identified to own the domains of 171
PVA/OVA-degrading enzymes in the classical intracellular pathway through domain 172
analysis (Figure 2A). And one gene (BAY15_3292) is directly annotated as a PVA 173
oxidase (Figure 2A; Figure S3). Of the seven classical intracellular 174
PVA/OVA-degrading genes, six genes (BAY15_1712, BAY15_2325, BAY15_0291, 175
BAY15_0976, BAY15_3123 and BAY15_3143) are likely to participate in oxidation 176
of PVA/OVA (the first step), while BAY15_0160 might mediate hydrolysis of 177
oxiPVA (oxidised PVA with a β-diketone structure) in the second step of PVA 178
degradation (Figure 2B). Since we failed to find any SAO genes in the genome, 179
intracellular degradation of PVA appears to play a dominant role in this strain. 180
The first step of intracellular PVA degradation is the oxidation of PVA and 181
conversion into oxiPVA by PVADHs (1, 32, 33). Two predicted PVADHs 182
(BAY15_1712 and BAY15_2325) were identified encoding two quinoprotein alcohol 183
dehydrogenases with two types of PVADH domains; a quinoprotein alcohol 184
dehydrogenase-like domain, and a domain with pyrroloquinoline quinone (PQQ) 185
repeats (violet and light grey bars in BAY15_1712/2325, Figure 2A) (18). These 186
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
10
genes may therefore play a role in the oxidation of PVA in S. rhizophila QL-P4. In 187
addition, BAY15_0291 encodes an apparent 128 amino acid (aa) cytochrome C (blue 188
bar in BAY15_0291, Figure 2A) sharing 37% sequence identity with cytC in the pva 189
operon of Sphingomonas sp. 113P3 (14), which is a primary electron acceptor for 190
PVADHs in PVA oxidation (Figure 2A) (19, 34). We predict that BAY15_1712, 191
BAY15_2325 (oxidation) and BAY15_0291 (electron acceptor) may work together to 192
implement the first step of the oxidation of PVA in S. rhizophila QL-P4 (Figure 2B). 193
The second step of intracellular PVA degradation is the hydrolysis of oxiPVA and 194
cleavage of the C-C bond of the β-diketone of oxiPVA by OPH or BPH (1, 32, 33). 195
Sequencing analysis revealed that BAY15_0160 encodes a 331 aa protein with an 196
/- hydrolase fold similar to OPH and BPH (brown bar in BAY15_0160, Figure 2A) 197
(9, 35-38). It also contains a serine hydrolase motif comprising the lipase box 198
sequence Gly-X-Ser-X-Gly located in the catalytic domain of OPH (8). This suggests 199
that BAY15_0160 participates in cleavage of the C-C bond of the β-diketone of 200
oxiPVA (Figure 2B). 201
After the above two-step reaction, PVA can be degraded to OVA (20, 39). 202
BAY15_0976, BAY15_3123 and BAY15_3143 share the same domains as a 203
secondary alcohol dehydrogenase (SADH) in Geotrichum fermentans WF9101 that 204
reportedly possess OVA oxidation ability (polymerisation degree <50; Figure 2A) (20, 205
39). Thus, we infer that these three genes may function in the oxidation of OVA in S. 206
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
11
rhizophila QL-P4, which likely contributes to the complete degradation of PVA in 207
this strain (Figure 2B). 208
Interestingly, BAY15_3292 shares high sequence similarity (more than 70% 209
identity) with annotated polyvinyl alcohol dehydrogenases (PVADHs) in 210
Stenotrophomonas and Xanthomonas (NCBI accession numbers 211
CP007597.1/CP018756.1 and CP018728.1/AE008922.1, respectively), suggesting 212
that it participates in the first step of PVA intracellular degradation. Since this enzyme 213
does not contain classical PVADH domains (including quinoprotein alcohol 214
dehydrogenase-like and PQQ repeat domains), it may be a novel PVA-degrading 215
enzyme (Figure 2A). 216
In summary, our study identifies a single strain with PVA and OVA degradation 217
genes, while all previously reported strains contain either PVA or OVA degradation 218
genes (1). For example, the well-characterised PVA degrader Sphingopyxis sp.113P3 219
possesses only PVA degradation genes (pvaA, oph, cytC) (12, 18). The presence of 220
the identified enzymes might account for the high efficiency of PVA degradation by S. 221
rhizophila QL-P4 (Figure 1). 222
223
Enzyme kinetic analysis of classical intracellular PVA/OVA-degrading enzymes 224
from S. rhizophila QL-P4 225
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
12
Seven new genes (BAY15_1712, BAY15_2325, BAY15_0976, BAY15_3123, 226
BAY15_3143, BAY15_0160 and BAY15_0291) were predicted to be involved in the 227
classical intracellular PVA/OVA degradation pathway. Among these, four enzymes 228
(BAY15_1712, BAY15_0976, BAY15_3123, BAY15_3143) were successfully 229
expressed and purified (Figure S4), but expression of the other three (BAY15_2325, 230
BAY15_0160, BAY15_0291) was unsuccessful. The PVA/OVA-degrading activities 231
of the four expressed enzymes were measured (Table 1). Kinetic parameters (kcat and 232
Km) were derived from Eadie-Hofstee plots, and catalytic efficiency was determined 233
as kcat/Km. 234
As shown in Table 1, the predicted PVADH enzyme BAY15_1712 showed high 235
catalytic efficiency for PVA degradation (kcat/Km = 5.19×108 M
-1 min
-1), which was 236
~5000-fold higher than that reported for PVADH from Sphingopyxis sp. 113P3 237
(kcat/Km = 1.06×105 M
-1 min
-1) (40). This was mainly due to a large increase in kcat 238
(kcat ~4175.39 min-1
vs. 2.50 min-1
for BAY15_1712 and PVADH from Sphingopyxis 239
sp. 113P3). Furthermore, the affinity of BAY15_1712 was increased ~3-fold over that 240
of PVADH from Sphingopyxis sp. 113P3 (Km ~8.04 M vs. 23.6 M for 241
BAY15_1712 and PVADH from Sphingopyxis sp. 113P3). To investigate the catalytic 242
efficiency of BAY15_1712 towards OVA, kinetic assays were performed in the 243
presence or absence of PQQ (Table 1). The reactions were performed with a fixed 244
concentration of BAY15_1712 and excess of OVA substrates (Data are the mean ± 245
SD of three replicates). BAY15_1712 displayed high catalytic efficiency towards 246
OVA (kcat/Km = 1.76×107 M
-1 min
-1), which was unsurprising given that it includes 247
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
13
the shorter quinoprotein alcohol dehydrogenase-like domain found in OVA-degrading 248
enzymes (violet bar in BAY15_1712, Figure 2A). Incidentally, BAY15_1712 appears 249
to be a PQQ-dependent PVADH, since no PVA/OVA-degrading activity was detected 250
in the absence of PQQ (data not shown). 251
The catalytic efficiency of the three predicted OVA-degrading SADHs 252
(BAY15_0976, BAY15_3123 and BAY15_3143) was measured with excess of PVA 253
or OVA substrates, and all displayed OVA-degrading activity but no PVA-degrading 254
ability (Table 1), in agreement with previous research (39). All three enzymes showed 255
relatively high catalytic efficiency, with BAY15_3123 the most efficient, possibly due 256
to the additional GroES-like domain (short red bar in BAY15_3123, Figure 2). To 257
date, only one reported SADH from Geotrichum fermentans WF9101 has 258
OVA-degrading ability (1,39). 259
260
Enzyme kinetic and exocrine function analysis of a novel PVA oxidase 261
(BAY15_3292) 262
Although BAY15_3292 does not contain any classical PVA-degrading domains, it 263
shares high sequence identity with annotated PVADHs in Stenotrophomonas and 264
Xanthomonas, suggesting it could be a novel PVA oxidase. The enzyme was 265
successfully expressed and purified, and its PVA-degrading efficiency was tested. As 266
shown in Table 2, BAY15_3292 degraded PVA with a similar efficiency in the 267
presence and absence of PQQ, indicating that it is PQQ-independent. The catalytic 268
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
14
efficiency was ~3-fold higher than that of BAY15_1712. Moreover, compared with 269
the reported PVADH from Sphingopyxis sp. 113P3 (40), BAY15_3292 displayed 270
much higher PVA degradation ability (kcat/Km = 1.58×109
M-1
min-1
vs. 1.06×105 M
-1 271
min-1
). This was mainly due to a significant increase in catalytic rate (kcat ~2719.5
272
min-1
vs. 2.5 min-1
). Overall, BAY15_3292 showed the highest PVA-degrading 273
efficiency among the three PVADHs (BAY15_3292, BAY15_1712 and PVADH 274
from Sphingopyxis sp. 113P3). Incidentally, BAY15_3292 showed no 275
OVA-degrading activity (Table 2). 276
In order to validate the influence of BAY15_3292 on the PVA-degrading ability of 277
this strain, PVA degradation curves of S. rhizophila QL-P4 were measured with and 278
without BAY15_3292 in 0.1% PVA medium (Figure 3). The results showed that 279
knocking out BAY15_3292 resulted in a significant decline of PVA-degrading ability 280
in S. rhizophila QL-P4. On the fifth day of culturing, the percentage of PVA 281
degradation were 50.4% and 21.9% in the presence and absence of BAY15_3292, 282
respectively. This indicates that BAY15_3292 plays a crucial role in PVA degradation 283
in S. rhizophila QL-P4. 284
Most interestingly, we found that BAY15_3292 was mainly expressed in soluble 285
form in the supernatant (data not shown), while the classical PVADHs (including 286
BAY15_1712 and PVADH from Sphingopyxis sp. 113P3) were expressed mainly in 287
inclusion bodies (13). This indicates higher solubility for BAY15_3292, making it 288
more applicable for PVA biodegradation. 289
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
15
Since BAY15_3292 was expressed mostly in the supernatant and has a relatively 290
low molecular weight, we inferred that it may possess exocrine activity. To test this 291
hypothesis, we implemented protein mass spectrometry analysis of collected 292
extracellular proteins. Using 2D-LC-MS/MS on an Orbitrap Fusion mass 293
spectrometer, BAY15_3292 was identified based on eight unique peptides from the 294
band of the corresponding molecular weight excised from the SDS-PAGE gel (Figure 295
4). This result demonstrated that BAY15_3292 could be secreted. SAO is the only 296
extracellularly secreted PVA-oxidising enzyme reported previously (1, 41-43), but an 297
SAO-encoding gene was not identified in our strain. Thus, BAY15_3292 may 298
function as an extracellular PVA oxidase in S. rhizophila QL-P4. To further confirm 299
the extracellular PVA degradation ability of the secreted BAY15_3292 from S. 300
rhizophila QL-P4, we performed a transparent circle experiment (44). As shown in 301
Figure S5, the width of the transparent circle narrowed markedly when BAY15_3292 302
was knocked out, suggesting this protein has a distinct effect on the extracellular PVA 303
degradation ability of S. rhizophila QL-P4. 304
305
Conclusions 306
We report the complete genome of S. rhizophila QL-P4, a new and efficient PVA 307
degrader that has five PVA/OVA-degrading enzymes with a high catalytic efficiency, 308
among which BAY15_1712 is the only reported PVADH with both PVA- and 309
OVA-degrading abilities. Most importantly, we discovered a novel PVA oxidase 310
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
16
(BAY15_3292) that is not only more efficient than other reported PVA-degrading 311
PVADHs, but also has exocrine activity. Overall, our findings provide new insight 312
into PVA-degrading pathways in microorganisms, and suggest S. rhizophila QL-P4 313
and its enzymes have potential for application to PVA bioremediation to reduce or 314
eliminate PVA-related environmental pollution. 315
316
Materials and Methods 317
Isolation of the PVA-degrading strain 318
Fallen leaves were collected from virgin forest in the Qinling Mountains (Xi’an, 319
Shaanxi, China). Samples were ground and diluted with physiological saline. 320
Suspensions were subsequently spread onto agar plates containing 1.0 g/L PVA 321
(Sinopharm Chemical Reagent Company, Shanghai, China), 16 g/L agar, 1.4 g/L 322
K2HPO4, 0.27 g/L KH2PO4, 0.25 g/L MgSO4, 0.05 g/L CaCl2, 0.02 g/L FeSO4, 0.02 323
g/L NaCl, 0.2 g/L NaNO3, 0.2 g/L NH4NO3 (pH = 7.0) (11, 26). PVA with an average 324
polymerisation degree of 1750 ± 50 was the sole carbon source in the medium. After 325
cultivating at 30C for 27 days, bacterial plaques were picked and streaked 326
repeatedly on PVA agar plates to obtain mono-clones. After 35 rounds of selection, 327
mono-clones with PVA-degrading activity were isolated (26). 328
329
Evaluation of PVA degradation ability 330
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
17
S. rhizophila QL-P4 was cultivated in medium containing PVA with or without 331
yeast extract (26). The initial concentration of PVA was 0.1% or 0.5% (11, 26). The 332
residual PVA in the medium and the growth rate of S. rhizophila QL-P4 cells were 333
synchronously monitored by iodometry and UV/vis spectrophotometry (OD600), 334
respectively (45). The percentage of PVA-degradation of cells at 24 h in medium 335
containing 0.05% yeast extract was determined in cultures with different initial PVA 336
concentrations (11, 22-26). 337
338
Whole-genome sequencing and assembly 339
Whole-genome sequencing was implemented using the Pacific Biosciences RSII 340
sequencing platform (Pacific Biosciences, Menlo Park, CA, USA) that utilises P6/C4 341
chemistry (46). A 10 kb SMRTbell library was prepared from sheared genomic DNA 342
(>5 g), using the 10 kb template library preparation workflow according to the 343
manufacturer’s recommendation, with an additional bead clean-up step before primer 344
annealing (15). 345
One SMRT cell yielded more than 1,364 Mb of DNA from 99,322 reads, with a 346
mean read length of 13,736 bases and an average genome coverage of 148-fold. De 347
novo assembly of the genome was performed using Hierarchical Genome Assembly 348
Process 3 (HGAP3) (47) within the SMRT Analysis v2.2.0 software. Gap closing was 349
completed by PBJelly, and circularisation was achieved by manual comparison and 350
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
18
removal of regions of overlap (48). The final genome was confirmed by remapping of 351
sequencing data. 352
To correct the polymer errors produced during PacBio sequencing, we 353
re-sequenced the isolate using next-generation sequencing. Paired-end libraries were 354
prepared from 5 g of isolated genomic DNA using a TruSeq DNA sample prep kit A 355
(Illumina Inc., San Diego, California, USA), and sequenced with a read length of 2× 356
150 nucleotides using an Illumina Genome Analyzer IIx according to the 357
manufacturer’s instructions. Image analysis and base calling were performed in the 358
standard Illumina pipeline. Raw Illumina sequencing reads were trimmed at a 359
threshold of 0.01 (Phred score of 20). Filtered reads were mapped onto genome 360
sequences, which were assembled the HGAP.3 algorithm in the SMRT Portal (version 361
2.2.0) using BWA version 0.5.9 (49), and converted to sorted BAM format using 362
SAMtools version 0.1.9 (50). Pilon v.1.13 was subsequently employed to polish 363
genome sequences using the obtained alignments (51). 364
365
Gene annotation and prediction of genes encoding PVA-degrading enzymes 366
Annotation of rRNAs and tRNAs was performed using RNAmmer (52) and 367
tRNAscan-SE (53), respectively. Protein-coding genes were predicted using Prodigal 368
version 2.60 (46). Their functions were annotated by comparison with the NCBI 369
non-redundant (NR) database, and classified by searching against the Clusters of 370
Orthologous Groups (COG) database (54). Annotated protein sequences were aligned 371
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
19
with those of known PVA-degrading enzymes and protein domain analysis was 372
performed using Pfam (http://pfam.xfam.org) and InterPro 373
(http://www.ebi.ac.uk/interpro/). The results of functional annotation, sequence 374
BLAST searches and domain analysis were integrated to identify PVA-degrading 375
genes. 376
377
Gene cloning 378
Genes were amplified from S. rhizophila QL-P4 genomic DNA using primers with 379
appropriate recognition sequences and restriction endonuclease sites (Table 3). 380
Amplified fragments were digested with NdeI and HindIII (New England Biolabs 381
Beijing LTD, USA), and purified with a SanPrep PCR Purification Kit (Sangon 382
Biotech, Shanghai, China). Fragments were ligated into the digested pET-28a (+) 383
plasmid vector using T4 ligase, and constructed plasmids were confirmed by 384
sequencing. 385
386
Protein expression and purification 387
Recombinant pET-28a (+) plasmids were transformed into competent Escherichia 388
coli BL21 (DE3) cells (TransGene Biotech, Beijing, China), and expression of 389
His-tagged fusion proteins was induced with 1 mM IPTG. Recombinant proteins were 390
purified with Ni-NTA resin using an Immobilized Metal Affinity Chromatography kit 391
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
20
(Shanghai Roche Pharmaceuticals Ltd, Switzerland) from cell lysates in buffer A (50 392
mM potassium phosphate, 300 mM NaCl), and eluted using a linear gradient of 393
elution buffer containing 25 mM to 250 mM imidazole. Protein purity was evaluated 394
by SDS-PAGE. 395
In order to attenuate the influence of imidazole on enzyme activity, elution buffer 396
was exchanged by ultrafiltration at 4C using a centrifugal concentrator (Millipore, 397
Shanghai, China) with 50 mM potassium phosphate buffer (pH 7.2) for putative 398
PVADH, and with TRIS-HCl buffer (pH 8.0) for putative SADH. Protein 399
concentration was determined with a Pierce BCA Protein Assay kit (Thermo Fisher 400
Scientific, Shanghai, China). 401
402
Enzyme kinetic analysis of PVA-degrading enzymes 403
For putative PVADHs, recombinant proteins were pre-incubated with PQQ and 404
CaCl2 at 30C for 10 min. The enzyme solution was then mixed with substrate and 405
reaction buffer. The final reaction mixture (pH 7.2) contained 0.2 mM 406
2,6-dichlorophenolindophenol (DCIP), 1 mM CaCl2, 6 μM PQQ, 50 mM potassium 407
phosphate, and 0.06252 mg/ml substrate (40). The enzyme reactions were performed 408
at 30C, and the initial rate of reaction was measured by the decrease in A600 due to 409
the reduction of DCIP (ϵ600=1.9×104 M
-1cm
-1) with a UV-1800 spectrophotometer 410
(18, 40, 55). A reaction without substrate was used as a control. Besides, activities of 411
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
21
the putative PVADHs were also assayed in the absence of PQQ to estimate the PQQ 412
dependence of the enzymes. 413
For the putative SADHs, the recombinant proteins were pre-incubated with NAD+ 414
at 30C for 10 min. The final reaction mixture (pH 8.0) contained 5 mM NAD+, 50 415
mM Tris-HCl and 0.05-2 mg/mL substrate (39). The initial rate of reaction was 416
measured by the decrease in absorbance at 340 nm (A340) due to the reduction of 417
NAD+ (340 = 6.2×10
3 M
-1 cm
-1) with a UV-1800 spectrophotometer (39). A reaction 418
without substrate was used as a control. 419
All recombinant proteins were reacted with both PVA1750 and OVA with an 420
average polymerisation degree of ~20. OVA20 was prepared from PVA according to 421
the method reported by Mori et al. (1996) (20). Kinetic constants (Km, kcat and kcat/Km) 422
of enzymes were calculated from the initial velocities using the Michaelis-Menten 423
equation and Eadie-Hofstee plots, data are the mean ± SD of three replicates. 424
425
Genetic manipulation and mutagenesis of S. rhizophila QL-P4 426
In-frame, non-polar deletion of BAY15_3292 was performed by overlap extension 427
PCR. XhoI and XbaI restriction sites were engineered into the outer pair of primers for 428
cloning. The amplicon containing deletion was digested with the restriction 429
endonucleases and cloned into the suicide vector pDM4 using T4 ligase at 4C. 430
Recombinant plasmids were firstly transformed into E. coli S17-1, and subsequently 431
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
22
into S. rhizophila QL-P4 via conjunction with E. coli S17-1. Integrants in S. 432
rhizophila QL-P4 were selected with chloromycetin. Counterselection with sucrose 433
was performed, and clones (ΔBAY15_3292-QL-P4) was verified by sequencing of 434
PCR amplicons. 435
436
2D-LC-MS/MS identification of the secreted BAY15_3292 protein 437
Proteins secreted from S. rhizophila QL-P4 were precipitated from culture medium 438
containing 0.1% PVA with 90% ethanol at -80C overnight. Precipitated proteins 439
were re-dissolved in 50 mM potassium phosphate buffer (pH 7.2) and separated by 440
SDS-PAGE. Proteins with a molecular weight close to that expected for 441
BAY15_3292 were reduced, alkylated, and digested with trypsin at 37C for 16 h. 442
Peptides were extracted with acetonitrile (ACN) containing 0.1% formic acid (FA), 443
dried by vacuum, dissolved in 0.1% FA, delivered onto a nano RP column, and eluted 444
with a gradient (50–80%) of ACN over 60 min at a flow rate of 400 nL/min. Fractions 445
were injected into an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific, 446
Waltham, MA, USA) set to work in a data-dependent manner. Raw MS/MS data were 447
converted to MGF format using Proteome Discoverer 1.2 (Thermo Fisher Scientific, 448
Waltham, MA, USA). Exported MGF files were searched with Mascot v 2.3.01 449
against the annotated S. rhizophila QL-P4 protein database of with a tryptic 450
specificity allowing one missed cleavage. 451
452
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
23
PVA plate assay 453
S. rhizophila QL-P4 and ΔBAY15_3292_QL-P4 cells were suspended in 454
physiological saline and spread on 0.1% PVA agar plates containing 0.05% yeast 455
extract. Plates were cultivated at 30C for 5 days, and residues were stained as 456
described previously by Song et al. (2016) (44). The width of transparent circles 457
surrounding bacterial plaques were measured to estimate the extracellular 458
PVA-degrading ability (56). E. coli cells incapable of degrading PVA were used as a 459
negative control. 460
461
Strain and nucleotide sequence submission 462
The S. rhizophila QL-P4 strain has been deposited in the China General 463
Microbiological Culture Collection Center (CGMCC) under accession number 464
CGMCC 1.15515. The complete genome sequence of QL-P4 has been deposited at 465
GenBank under accession number CP016294. 466
467
Conflict of Interest 468
The authors declare that they are inventors on the patent applications covering 469
various of S. rhizophila QL-P4 strain and the PVA/OVA-degrading enzymes. 470
Correspondence and requests for the materials should be addressed to F.C 471
([email protected]). 472
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
24
473
Acknowledgements 474
This research is funded by the Science & Technology Innovation Project of the 475
Yangling Agriculture High-tech Industrial Demonstration zone (No. 2015NY-07). The 476
funders had no role in study design, data collection and interpretation, or the decision 477
to submit the work for publication. Sincere thanks are also given to Prof. Hu Xiaoping 478
for giving constructive suggestion to this research. 479
480
References 481
1. Kawai F, Hu X. 2009. Biochemistry of microbial polyvinyl alcohol 482
degradation. Applied Microbiology and Biotechnology 84:227. 483
2. Chiellini E, Corti A, D'Antone S, Solaro R. 2003. Biodegradation of poly 484
(vinyl alcohol) based materials. Progress in Polymer Science 28:963-1014. 485
3. Stoica-Guzun A, Jecu L, Gheorghe A, Raut I, Stroescu M, Ghiurea M, Danila 486
M, Jipa I, Fruth V. 2011. Biodegradation of Poly(vinyl alcohol) and Bacterial 487
Cellulose Composites by Aspergillus niger. Journal of Polymers and the 488
Environment 19:69-79. 489
4. Cao Y, Hua Z, Chen J. 2005. Improvement of Biodegradability of Polyvinyl 490
Alcohol by Pre-treatment with Fenton Oxidation. Journal of Wuxi University 491
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
25
of Light Industry. 492
5. Xie B. 2002. PRACTICE OF TREATING PVA-BEARING DESIZING 493
WASTEWATER. Environmental Engineering 20:7-9. 494
6. Li C, Fan X, Wang Q, Jin H. 2007. Effects of poly (vinyl alcohol) in desizing 495
wasterwater and its degradation performance. TEXTILE AUXILIARIES 496
24:7-10. 497
7. Du G, Liu L, Song Z, Hua Z, Zhu Y, Chen J. 2007. Production of polyvinyl 498
alcohol-degrading enzyme with Janthinobacterium sp. and its application in 499
cotton fabric desizing. Biotechnology Journal 2:752-758. 500
8. Klomklang W, Tani A, Kimbara K, Mamoto R, Ueda T, Shimao M, Kawai F. 501
2005. Biochemical and molecular characterization of a periplasmic hydrolase 502
for oxidized polyvinyl alcohol from Sphingomonas sp. strain 113P3. 503
Microbiology (Reading, England) 151:1255-1262. 504
9. Sakai K, Hamada N, Watanabe Y. 1986. Degradation Mechanism of 505
Poly(vinyl alcohol) by Successive Reactions of Secondary Alcohol Oxidase 506
and β-Diketone Hydrolase from Pseudomonas sp. . Agricultural and 507
Biological Chemistry 50:989-996. 508
10. Nord FF. 1936. Über die Dehydrierungsleistungen von Fusarium lini B. 509
Naturwissenschaften 24:763-763. 510
11. Hu X, Mamoto R, Shimomura Y, Kimbara K, Kawai F. 2007. Cell surface 511
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
26
structure enhancing uptake of polyvinyl alcohol (PVA) is induced by PVA in 512
the PVA-utilizing Sphingopyxis sp. strain 113P3. Archives of Microbiology 513
188:235. 514
12. Hu X, Mamoto R, Fujioka Y, Tani A, Kimbara K, Kawai F. 2008. The pva 515
operon is located on the megaplasmid of Sphingopyxis sp. strain 113P3 and is 516
constitutively expressed, although expression is enhanced by PVA. Applied 517
microbiology and biotechnology 78:685-693. 518
13. Jia D, Yang Y, Peng Z, Zhang D, Li J, Liu L, Du G, Chen J. 2014. High 519
efficiency preparation and characterization of intact poly(vinyl alcohol) 520
dehydrogenase from Sphingopyxis sp.113P3 in Escherichia coli by inclusion 521
bodies renaturation. Applied biochemistry and biotechnology 172:2540-2551. 522
14. Ohtsubo Y, Nagata Y, Numata M, Tsuchikane K, Hosoyama A, Yamazoe A, 523
Tsuda M, Fujita N, Kawai F. 2015. Complete Genome Sequence of Polyvinyl 524
Alcohol-Degrading Strain Sphingopyxis sp. 113P3 (NBRC 111507). Genome 525
announcements. 3(5):doi:10.1128/genomea.01169-15. 526
15. Zhu L, Zhong J, Jia X, Liu G, Kang Y, Dong M, Zhang X, Li Q, Yue L, Li C, 527
Fu J, Xiao J, Yan J, Zhang B, Lei M, Chen S, Lv L, Zhu B, Huang H, Chen F. 528
2016. Precision methylome characterization of Mycobacterium tuberculosis 529
complex (MTBC) using PacBio single-molecule real-time (SMRT) technology. 530
Nucleic acids research 44:730-743. 531
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
27
16. Shimao M, Tamogami T, Kishida S, Harayama S. 2000. The gene pvaB 532
encodes oxidized polyvinyl alcohol hydrolase of Pseudomonas sp. strain 533
VM15C and forms an operon with the polyvinyl alcohol dehydrogenase gene 534
pvaA. Microbiology (Reading, England) 146 ( Pt 3):649-657. 535
17. Toyama H, Mathews FS, Adachi O, Matsushita K. 2004. Quinohemoprotein 536
alcohol dehydrogenases: structure, function, and physiology. Archives of 537
biochemistry and biophysics 428:10-21. 538
18. Hirota-Mamoto R, Nagai R, Tachibana S, Yasuda M, Tani A, Kimbara K, 539
Kawai F. 2006. Cloning and expression of the gene for periplasmic poly(vinyl 540
alcohol) dehydrogenase from Sphingomonas sp. strain 113P3, a novel-type 541
quinohaemoprotein alcohol dehydrogenase. Microbiology (Reading, England) 542
152:1941-1949. 543
19. Mamoto R, Hu X, Chiue H, Fujioka Y, Kawai F. 2008. Cloning and expression 544
of soluble cytochrome c and its role in polyvinyl alcohol degradation by 545
polyvinyl alcohol-utilizing Sphingopyxis sp. strain 113P3. Journal of 546
bioscience and bioengineering 105:147-151. 547
20. Tatsuma M, Michio S, Takashi K, Takuo S. 1996. Degradation of Vinyl 548
Alcohol Oligomers by Geotrichum sp. WF9101. Bioscience, biotechnology, 549
and biochemistry 60:1188-1190. 550
21. Alavi P, Starcher MR, Thallinger GG, Zachow C, Müller H, Berg G. 2014. 551
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
28
Stenotrophomonas comparative genomics reveals genes and functions that 552
differentiate beneficial and pathogenic bacteria. BMC genomics. 15(482. 553
doi:10.1186/1471-2164-15-482. 554
22. Suzuki T. 1973. Some characteristics of Pseudomonas O-3 which utilizes 555
polyvinyl alcohol. Report of the Fermentation Research Institute:23-37. 556
23. Sakazawa C, Shimao M, Taniguchi Y, Kato N. 1981. Symbiotic utilization of 557
polyvinyl alcohol by mixed cultures. Applied and environmental microbiology 558
41:261-267. 559
24. Tokiwa Y, Kawabata G, Jarerat A. 2001. A modified method for isolating 560
poly(vinyl alcohol)-degrading bacteria and study of their degradation patterns. 561
Biotechnology Letters 23:1937-1941. 562
25. Qian D, Du G, Chen J. 2004. Isolation and Culture Characterization of a New 563
Polyvinyl Alcohol-Degrading Strain: Penicillium sp. WSH02-21. World 564
Journal of Microbiology and Biotechnology 20:587. 565
26. Yamatsu A, Matsumi R, Atomi H, Imanaka T. 2006. Isolation and 566
characterization of a novel poly(vinyl alcohol)-degrading bacterium, 567
Sphingopyxis sp. PVA3. Applied Microbiology and Biotechnology 72:804. 568
27. Liu R, Jiang H, Xu P, Qiao C, Zhou Q, Yang C. 2014. Engineering 569
chlorpyrifos-degrading Stenotrophomonas sp. YC-1 for heavy metal 570
accumulation and enhanced chlorpyrifos degradation. Biodegradation 571
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
29
25:903-910. 572
28. Deng S, Chen Y, Wang D, Shi T, Wu X, Ma X, Li X, Hua R, Tang X, Li QX. 573
2015. Rapid biodegradation of organophosphorus pesticides by 574
Stenotrophomonas sp. G1. Journal of hazardous materials 297:17-24. 575
29. Ge S, Ge S, Zhou M, Dong X. 2015. Bioremediation of hexavalent chromate 576
using permeabilized Brevibacterium sp. and Stenotrophomonas sp. cells. 577
Journal of environmental management 157:54-59. 578
30. Pan X, Lin D, Zheng Y, Zhang Q, Yin Y, Lin C, Fang H, Yu Y. 2016. 579
Biodegradation of DDT by Stenotrophomonas sp. DDT-1: Characterization 580
and genome functional analysis. Sci Rep 6:21332. 581
31. Kumari L, Tiwary D, Mishra PK. 2016. Biodegradation of C.I. Acid Red 1 by 582
indigenous bacteria Stenotrophomonas sp. BHUSSp X2 isolated from dye 583
contaminated soil. Environmental science and pollution research international 584
23:4054-4062. 585
32. Matsumura S, Tomizawa N, Toki A, Toshima K. 1999. Enzymatic degradation 586
of poly(vinyl alcohol) and its copolymer, p 230-238. In Alexander S (ed), 587
Biochemical principles and mechanisms of biosynthesis and biodegradation of 588
polymers. Wiley-VCH, Weinheim. 589
33. Matsumura S, Tomizawa N, Toki A, Kimihito Nishikawa A, Toshima K. 1999. 590
Novel Poly(vinyl alcohol)-Degrading Enzyme and the Degradation 591
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
30
Mechanism. Macromolecules 32:7753-7761. 592
34. Shimao M, Onishi S, Kato N, Sakazawa C. 1989. Pyrroloquinoline 593
Quinone-Dependent Cytochrome Reduction in Polyvinyl Alcohol-Degrading 594
Pseudomonas sp. Strain VM15C. Applied and environmental microbiology 595
55:275-278. 596
35. Sakai K, Morita M, Hamada N, Watanabe Y. 1981. Purification and Properties 597
of Oxidized Poly(vinyl a1cohol)-Degrading Enzyme. Agricultural & 598
Biological Chemistry 45:63-71. 599
36. Sakai K, Hamada N, Watanabe Y. 1985. A New Enzyme, β-Diketone 600
Hydrolase: a Component of a Poly(vinyl alcohol)-degrading Enzyme 601
Preparation. Agricultural & Biological Chemistry 49:1901-1902. 602
37. Suzuki T, Tsuchii A. 1983. Degradation of diketones by polyvinyl 603
alcohol-degrading enzyme produced by Pseudomonas sp. .vol 18. 604
38. Kawagoshi Y, Fujita M. 1997. Purification and properties of the polyvinyl 605
alcohol-degrading enzyme 2,4-pentanedione hydrolase obtained from 606
Pseudomonas vesicularis var. povalolyticus PH. World Journal of 607
Microbiology and Biotechnology 14:95-100. 608
39. Mori T, Sakimoto M, Kagi T, Sakai T. 1998. Secondary alcohol dehydrogenase 609
from a vinyl alcohol oligomer-degrading Geotrichum fermentans; stabilization 610
with Triton X-100 and activity toward polymers with polymerization degrees 611
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
31
less than 20. World journal of microbiology & biotechnology 14:349-356. 612
40. Jia D, Li J, Liu L, Zhang D, Yang Y, Du G, Chen J. 2013. High-level 613
expression, purification, and enzymatic characterization of truncated 614
poly(vinyl alcohol) dehydrogenase in methylotrophic yeast Pichia pastoris. 615
Applied Microbiology and Biotechnology 97:1113-1120. 616
41. Morita M, Watanabe Y. 1977. A Secondary Alcohol Oxidase: a Component of 617
a Polyvinyl Alcohol Degrading Enzyme Preparation. Agricultural & 618
Biological Chemistry 41:1535-1537. 619
42. Shimao M, Taniguchi Y, Shikata S, Kato N, Sakazawa C. 1982. Production of 620
polyvinyl alcohol oxidase by a symbiotic mixed culture. Applied and 621
environmental microbiology 44:28-32. 622
43. Veteikytė A, Aštrauskaitė M, Gruškienė R, Tekorienė R, Matijošytė I. 2013. 623
Secondary alcohol oxidase activity identified in genus of Pseudomonas 624
isolated from the oil polluted soil. Biocatalysis and Agricultural Biotechnology 625
2:89-95. 626
44. Song Y, Zhou Y, Li S, Liu Y, Wei Y. 2016. Optimization of Poly(Vinyl 627
Alcohol)-Degrading Enzyme Production Condition in Bacillus 628
amyloliquefaciens HK1. Chinese Agricultural Science Bulletin. 629
45. Finley JH. 1961. Spectrophotometric determination of polyvinyl alcohol in 630
paper coatings. Analytical Chemistry 33:1925-1927. 631
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
32
46. Hyatt D, Chen G-L, LoCascio PF, Land ML, Larimer FW, Hauser LJ. 2010. 632
Prodigal: prokaryotic gene recognition and translation initiation site 633
identification. BMC Bioinformatics 11:119. 634
47. Chin CS, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C, Clum A, 635
Copeland A, Huddleston J, Eichler EE. 2013. Nonhybrid, finished microbial 636
genome assemblies from long-read SMRT sequencing data. Nature Methods 637
10:563. 638
48. English AC, Richards S, Han Y, Wang M, Vee V, Qu J, Qin X, Muzny DM, 639
Reid JG, Worley KC, Gibbs RA. 2012. Mind the gap: upgrading genomes with 640
Pacific Biosciences RS long-read sequencing technology. PloS one 7:e47768. 641
49. Li H, Durbin R. 2010. Fast and accurate long-read alignment with 642
Burrows-Wheeler transform. Bioinformatics (Oxford, England) 26:589-595. 643
50. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, 644
Abecasis G, Durbin R, Genome Project Data Processing S. 2009. The 645
Sequence Alignment/Map format and SAMtools. Bioinformatics (Oxford, 646
England) 25:2078-2079. 647
51. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo 648
CA, Zeng Q, Wortman J, Young SK, Earl AM. 2014. Pilon: an integrated tool 649
for comprehensive microbial variant detection and genome assembly 650
improvement. PloS one. 9(11):e112963. doi:10.1371/journal.pone.0112963. 651
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
33
52. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, Ussery DW. 652
2007. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. 653
Nucleic acids research 35:3100-3108. 654
53. Schattner P, Brooks AN, Lowe TM. 2005. The tRNAscan-SE, snoscan and 655
snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids 656
Research 33:686-9. 657
54. Galperin MY, Makarova KS, Wolf YI, Koonin EV. 2015. Expanded microbial 658
genome coverage and improved protein family annotation in the COG 659
database. Nucleic acids research 43:D261-9. 660
55. Hatanaka T, Asahi N, Tsuji M. 2008. Purification and Characterization of 661
Poly(vinyl alcohol) Dehydrogenase from Pseudomonas sp. 113P3. Bioscience 662
Biotechnology & Biochemistry 59:1813-1816. 663
56. Hao XH, Yi XP, Li D. 2015. Research on the Screening of Degrading Fungi 664
for Poly (vinyl alcohol) Film and the Effect of Additives. Advanced Materials 665
Research 1096:80-88. 666
667
668
Table and Figure legends 669
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
34
Figure 1. Cell growth and polyvinyl alcohol (PVA) degradation curves of 670
Stenotrophomonas rhizophila QL-P4 with an initial PVA concentration of (A) 0.1% 671
and (B) 0.5% as a sole carbon source. The PVA concentration (g/L) was measured 672
based on a standard curve of PVA (g/L) vs. absorbance at 690 nm (OD690). Bacterial 673
growth was measured by the OD600 value. 674
675
Figure 2. Eight genes in the S. rhizophila QL-P4 genome predicted to participate in 676
PVA degradation: (A) Identification of eight putative PVA-degrading enzymes 677
through domain comparison. The three predicted PVA oxidases, one predicted 678
electron acceptor, one predicted hydrolase and three predicted vinyl alcohol oligomer 679
(OVA)-degrading enzymes are separately shown as blue, red and orange bold letters 680
on the left. As controls, PVADH/Cytochrome C/OPH from Sphingopyxis sp. 113P3, 681
the annotated PVADH (WP_019184176.1) from Stenotrophomonas maltophilia, and 682
SADH from Thermoanaerobacter ethanolicus are displayed as black bold letters. 683
Domains were searched against the InterPro database (http://www.ebi.ac.uk/interpro/), 684
and are shown as different coloured bars. Different domains are colour-coded and 685
shown at the bottom. Each grey rectangle represents a protein predicted to participate 686
in PVA degradation, and IDs of their corresponding genes are included on the left. 687
Numbers under grey rectangles indicate the relative positions of amino acids counting 688
from the N-terminus. (B) Proposed roles of the eight predicted PVA degradation 689
pathway genes. The first step of intracellular PVA degradation is the oxidation of 690
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
35
PVA by PVADHs (BAY15_2325/1712/3292) with cytochrome C as an electron 691
acceptor (BAY15_0291). The second step is the hydrolysis of the β-diketone of 692
oxiPVA by OPH or BPH (BAY15_0160) to produce a methyl ketone and an aldehyde. 693
OVA, another product of PVA degradation, is intracellularly degraded by SADHs 694
(BAY15_3143/3123/0976). 695
696
Figure 3. PVA degradation curves of S. rhizophila QL-P4 with and without 697
BAY15_3292 in the presence of 0.1% PVA as a sole carbon source. 698
699
Figure 4. SDS-PAGE identification of the secretion of BAY15_3292 by 700
2D-LC-MS/MS. (A) Secreted S. rhizophila QL-P4 proteins in medium containing 0.1% 701
PVA. Lane M, protein markers; Lane BAY15_3292, purified BAY15_3292; Lane 702
Secreted proteins, S. rhizophila QL-P4 secreted proteins. (B) 2D-LC-MS/MS 703
identification of BAY15_3292 among proteins secreted from S. rhizophila QL-P4. 704
The two representative spectra show the b-/y- ions used for identification of unique 705
BAY15_3292 peptides. 706
707
Table 1. Kinetic parameters of the four classical PVA degradation enzymes 708
identified in S. rhizophila QL-P4a. 709
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
36
aKinetic analysis of enzymes was performed with an excess of PVA or OVA substrate. 710
The initial velocity at each substrate concentration was used to produce an 711
Eadie-Hofstee plot, and kcat and Km values were obtained from the y-intercept and 712
slope, respectively. Data are the mean ± SD of three replicates. 713
bThe enzyme do not show the catalytic activity for the substrate. 714
715
Table 2. Kinetics parameters of the novel PVA oxidase (BAY15_3292) with 716
different substratesa. 717
aKinetics analysis of this enzymes were proceeded with an excess amount of the 718
different substrates. The initial velocities at each substrate concentration were used to 719
generate an Eadie-Hofstee plot. The kcat and Km values were deduced from the y 720
intercepts and slopes, respectively. All the data represent mean ± SD of three 721
replicates. 722
bThe enzyme do not show the catalytic activity for the substrate. 723
724
Table 3. Primers used in this research. 725
Note: underlined sequences indicate restriction enzyme cleavage sites 726
727
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 1. Kinetics parameters of four classical PVA degradation enzymes in S.
rhizophila QL-P4a
Substrate Km (μM) kcat(min-1
) kcat/Km
(M-1
min-1
)
BAY15_1712
PVA(1750) 8.0±0.7 4175.4±315.1 5.2×108
OVA(20) 139.8±20.7 2462.0±230.9 1.8×107
BAY15_3123
PVA(1750) Nb N N
OVA(20) 360.3±8.0 1093.6±18.3 3.0×106
BAY15_3143
PVA(1750) N N N
OVA(20) 524.4±25.0 107.3±2.7 2.1×105
BAY15_0976
PVA(1750) N N N
OVA(20) 168.8±2.0 396.7±23.4 2.4×106
aKinetics parameters of four classical PVA degradation enzymes found in S. rhizophila QL-P4.
Kinetics analysis of these enzymes were proceeded with an excess amount of the different
substrates (PVA/OVA). The initial velocities at each substrate concentration were used to produce
an Eadie-Hofstee plot. The kcat and Km values were obtained from the y intercepts and slopes,
respectively. All the data represent mean ± SD of three replicates.
bThe enzyme do not show the catalytic activity for the substrate.
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Table 2. Kinetics parameters of a novel PVA oxidase (BAY15_3292) in S. rhizophila
QL-P4a
Substrate Cofactor Km(μM) kcat (min-1
)
kcat/Km
(M-1
min-1
)
BAY15_3292
PVA(1750) PQQ 1.7±0.1 2719.5±83.7 1.6×109
PVA(1750) / 1.7±0.3 2684.0±282.4 1.6×109
OVA(20) PQQ Nb N N
OVA(20) / N N N
aKinetics parameters of the novel PVA oxidase (BAY15_3292) with different substrates. Kinetics
analysis of this enzymes were proceeded with an excess amount of the different substrates. The
initial velocities at each substrate concentration were used to generate an Eadie-Hofstee plot. The
kcat and Km values were deduced from the y intercepts and slopes, respectively. All the data
represent mean ± SD of three replicates.
b The enzyme do not show the catalytic activity for the substrate.
Table 3. Primers used in this research
Oligo Name Sequence Length (bp)
BAY15_1712-sense GGAATTCCATATGATG AAG CAG ATG GTC ATG ATC AAG 1209
BAY15_1712-antise CCCAAGCTTTTA TTG TGC CAA CCG GAA TGC
BAY15_2325-sense GGAATTCCATATGATG TCC GCT GTG CCG A 2550
BAY15_2325-antise CCCAAGCTTCTA CCG CGG GCT CTG AC
BAY15_0291-sense GGAATTCCATATGATG CGG TTA CCG CGC CG 387
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
BAY15_0291-antise CCCAAGCTTCTA CGG CTG TTC CTT CAG GTA TT
BAY15_3292-sense GGAATTCCATATGATG GCG GCT TTG CAG CAG 858
BAY15_3292-antise CCCAAGCTTTCA GCG CGC CGC CTT G
BAY15_0976-sense GGAATTCCATATGATG GCG CAG CAA ACA ATG A 1038
BAY15_0976-antise CCCAAGCTTTCA GTT CCA GCT CAG GAC C
BAY15_3123-sense GGAATTCCATATGATG AAA TCC CGT GCT GCC 1110
BAY15_3123-antise CCCAAGCTTTCA GTA GTG GAC GAC CGA G
BAY15_3143-sense GGAATTCCATATGATG TCC CTC GCC CAT GGC TAT 1053
BAY15_3143-antise CCCAAGCTTTCA TGC CGC CAA CGT TGC C
BAY15_0160-sense GGAATTCCATATGATG CGT TGC GCT GTG TTG 996
BAY15_0160-antise CCCAAGCTTTCA TGG CGC CTT CTC CC
3292F1 GCTCTAGACATTCATGGCGACTCTTC
290
3292R1 CTGATCCTCACCTGACCGAACGTATTC
3292F2 CGGTCAGGTGAGGATCAGGCTGTTGGT
303
3292R2 CCGCTCGAGCACGGCTTCAGTTGATTC
Note: underlined sequences indicate restriction enzyme cleavage sites
on Novem
ber 23, 2020 by guesthttp://aem
.asm.org/
Dow
nloaded from
Top Related