Molecular and Cellular Endocrinology 382 (2014) 915–925

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology

journal homepage: www.elsevier .com/locate /mce

Wnt/b-catenin signaling regulates follicular development by modulatingthe expression of Foxo3a signaling components q

0303-7207/$ - see front matter � 2014 Published by Elsevier Ireland Ltd.http://dx.doi.org/10.1016/j.mce.2013.11.007

Abbreviations: APC, adenomatosis polyposis coli; CTNNB1, b-catenin; DMSO,dimethylsulfoxide; CYP11A1, P450 cholesterol side chain cleavage; CYP19A1,cytochrome P450 aromatase; FBS, fetal bovine serum; Foxo, Forkhead box O; FZD,frizzled; GSK3b, glycogen synthase kinase 3b; 3b-HSD, 3b-hydroxysteroid dehy-drogenase; HMG-domain, high mobility group domain; IWR, inhibitors of Wntresponse; LRP, lipoprotein receptor-related proteins; PUMA, p53-upregulatedmodulator of apoptosis; StAR, steroidogenic acute regulatory protein; TCF/LEF, T-cell factor/lymphoid enhancer-binding protein; TUNEL, terminal deoxynucleotidyltransferase-mediated deoxyuridine triphosphate nick end labeling; Wnt, wingless-type mouse mammary tumor virus integration site family.

q This work was supported by the Major Research Plan ‘‘973’’ Project(2011CB944302, 2012CB944702), the National Technology Support Project(2012BAI31B00) and the National Nature Science Foundation of China (Nos.:31171380; 31071018; 31071271). The funders had no role in the study design, datacollection and analysis, decision to publish or preparation of the manuscript.⇑ Corresponding author. Tel.: +86 10 64807038; fax: +86 10 64807583.

E-mail address: liuyx@ioz.ac.cn (Y.-X. Liu).

Lei Li a,b, Shao-Yang Ji a,b, Jun-Ling Yang a,b, Xi-Xia Li a,b, Jun Zhang a,b, Yang Zhang a,b, Zhao-Yuan Hu a,Yi-Xun Liu a,⇑a State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, Chinab Graduate School of the Chinese Academy of Sciences, Beijing 100049, China

a r t i c l e i n f o

Article history:Received 26 May 2013Received in revised form 7 November 2013Accepted 8 November 2013Available online 15 November 2013

Keywords:Wnt/b-catenin signalingFollicle cultureLiClWnt3aIWR-1Foxo3a

a b s t r a c t

Wnt signaling is an evolutionarily conserved pathway that regulates cell proliferation, differentiation andapoptosis. To investigate the possible role of Wnt signaling in the regulation of ovarian follicular devel-opment, secondary follicles were isolated and cultured in vitro in the presence or absence of its activator(LiCl or Wnt3a) or inhibitor (IWR-1). We have demonstrated that activation of b-catenin signals byactivators dramatically suppressed follicular development by increasing granulosa cell apoptosis andinhibiting follicle steroidogenesis. In contrast, inhibition of Wnt signaling by IWR-1 was observed withbetter developed follicles and increased steroidogenesis. Further studies have shown that the transcrip-tion factor Forkhead box O3a (Foxo3a) and its downstream target molecules were modulated by the acti-vators or the inhibitor. These findings provide evidence that Wnt signaling might negatively regulatefollicular development potentially through Foxo3a signaling components.

� 2014 Published by Elsevier Ireland Ltd.

1. Introduction

The mammalian ovary is a multi-compartmental organ with theability to release mature oocytes from follicles and secrete steroidhormones. Follicular development is a continuous process thattakes place during the primordial, primary and secondary stagesbefore the development of an antral cavity. With further growthand differentiation, a preovulatory follicle forms and releases an

oocyte in response to the LH surge (Edson et al., 2009). Only afew follicles go through ovulation; most of the developing follicleswill be lost as a result of atresia (McGee and Hsueh, 2000). Theidentification of factors that regulate follicular growth has beenprimarily focused on a few endocrine and intraovarian factors(Couse et al., 2005; Lu et al., 2009a,b; Qu et al., 2012) as well asa variety of additional signaling cascades (Dong et al., 1996; Rich-ards et al., 2002; Fan et al., 2009).

Wnts are secreted glycoproteins that regulate multiplesignaling pathways through both b-catenin (CTNNB1)-dependentand CTNNB1-independent mechanisms (Anastas and Moon,2013). The canonical Wnt/b-catenin signaling pathway has beenintensely studied. In the absence of a Wnt signal, a multi-proteindestruction complex that includes the adenomatous polyposis coliprotein (APC) and a member of the Axin family facilitates thephosphorylation of b-catenin by GSK3b, resulting in the subse-quent ubiquitination and degradation of the protein with cellularproteosomal machinery. As a result, there is little or no free b-cate-nin in the cytoplasmic pool in the resting state. When a cell is ex-posed to Wnt, the Wnt ligand interacts with its receptor frizzled(FZD) and LRP co-receptor, and the resulting signal is then trans-duced via disheveled (DSH) to the destruction complex that allowsb-catenin to escape the complex in an unphosphorylated state. Un-der conditions of Wnt signaling, b-catenin therefore accumulatesand translocates to the nucleus, where it interacts with members

916 L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925

of the TCF/LEF family of HMG-domain transcription factors tostimulate the expression of target genes (MacDonald et al., 2009;Clevers and Nusse, 2012).

Several members of the Wnts and Wnt signaling componentshave been reported to play a role during different stages of ovarianfollicular development (Hsieh et al., 2005; Chassot et al., 2008;Wang et al., 2010) and steroidogenesis (Lapointe and Boerboom,2011). For example, Wnt4 could not only impact functions in theembryonic gonad where it directs and specifies female gonaddevelopment (Vainio et al., 1999; Yao et al., 2004), but also inthe adult stage, as documents by a Wnt4 conditional knockout micein the granulosa cells that they are subfertile and exhibit impairedantral follicle development (Boyer et al., 2010a,b). Additional stud-ies describe the expression of other components of Wnt signalingsuch as Wnt2, Wnt2b, Wnt4, frizzled 1, frizzled 4 and Sfrp 4 ingranulosa cells and luteal cells (Hsieh et al., 2002; Ricken et al.,2002), suggestive of their roles in such stages. Mice null for frizzled4 are infertile and exhibit impaired function of the corpus luteum(Hsieh et al., 2005). Wnt2 is expressed in cultured granulosa cellsof 3-wk-mouse and could promote DNA synthesis (Wang et al.,2010).

b-catenin is a key molecule of the canonical Wnt/b-catenin sig-naling pathway. Conditional knockout mice of Ctnnb1 mediated byAmhr2-cre are infertile due to developmental defects of the oviductand the uterus. (Hernandez Gifford et al., 2009). Another condi-tional targeting of Ctnnb1, through the excision of its third exon,produces a functional b-catenin protein that lacks the series ofphosphorylation sites required for degradation. The Ctnnb1(Ex3)fl/fl;Amhr2-Cre mice, with the Cre recombinase activity from embry-onic d14 (Jamin et al., 2002), develop follicle-like lesions by6 weeks of age and granulosa cell tumors as old as 7.5 months(Boerboom et al., 2005, 2006). Interestingly, the mouse ovariesexhibited few growing follicles. Disorganized granulosa cells werecommonly observed with randomly distributed antrum-likespaces, suggestive of atretic follicles. However, analysis ofCtnnb1(Ex3)fl/fl;Cyp19-Cre mice with the Cre recombinase limited tothe granulosa cells in the small antral and preovulatory folliclesreveals that b-catenin facilitates FSH-induced follicular growth,decreases follicle atresia and represses LH-induced oocyte matura-tion, ovulation, luteinization and progesterone production (Fanet al., 2010). All of these studies target the function of the Wntsand Wnt signaling components including Ctnnb1 precisely to theovary in embryonic development or during later stages of postnatalfollicular development and luteinization. However, no availabledata indicate a role for Wnt signaling in the regulation of postnatalfollicular development at the earlier stages before the antral cavityforms.

Here we target the effects of the Wnt signaling to this specificstage and study preliminarily the means by which such signalingcan exert its function. Some factors have been shown to beinvolved in the Wnt signaling pathway (Parakh et al., 2006; Azzolinet al., 2012; Rosenbluh et al., 2012), which may regulate folliculardevelopment either directly or indirectly (Mizusaki et al., 2003;Lapointe et al., 2012). Foxo3a (also known as FKHRL1), adownstream effector of the PI3K/Akt pathway, is a transcriptionfactor that regulates cell cycle and apoptosis (Sunters et al.,2003; Yang et al., 2010). Evidence has shown that when Foxo3ais excluded from the nucleus, its function as a transcription factoris lost (Accili and Arden, 2004). Although interactions betweenFoxo3a and Wnt/b-catenin signaling have been identified(Manolagas and Almeida, 2007; Hoogeboom et al., 2008; Boyeret al., 2010a,b), the detailed relationship between these pathwaysremains unclear.

In this study, we performed in vitro culture of mouse secondaryfollicles with 2 layers of granulosa cells. This culture system hasbeen used successfully in our laboratory (Zhang et al., 2011). The

widely used activator of Wnt/b-catenin signaling, LiCl, whichinhibits GSK3b and mimics Wnt signaling by stabilizing b-catenin(Stambolic et al., 1996); the canonical Wnt signaling ligand Wnt3a(Kawaguchi et al., 2010); and the Wnt inhibitor IWR-1, whichantagonizes Wnt signaling by stabilizing the Axin destruction com-plex (Chen et al., 2009; Lu et al., 2009a,b), were added individuallyto the culture medium. The dosages used in this work have beenwell established in previous studies (Stambolic et al., 1996; Zhaoet al., 2008; Chen et al., 2009; Lu et al., 2009a,b; Kawaguchiet al., 2010). Here, we provide novel evidence that Wnt/b-cateninsignaling is involved in the regulation of early follicular develop-ment potentially through Foxo3a signaling and its associateddownstream factors.

2. Materials and methods

2.1. Animals

CD1 mice were purchased from Vital River Laboratories Co., Ltd.and were housed in a temperature- and light-controlled facilityand given free access to water and food. All experimental protocolswere approved by the Animal Ethical Committee of both the Insti-tute of Zoology at the Chinese Academy of Sciences and the Peo-ple’s Republic of China.

2.2. In vitro follicle culture

Follicle culture was performed as previously described(Adriaens et al., 2004; Sun et al., 2004) with some modifications(Zhang et al., 2011). The 14-day-old mice were killed by cervicaldislocation, and their ovaries were aseptically removed and freedfrom the connective tissues using the beveled edges of 2 syringeneedles in 2 ml of preincubated L15 Leibovitz-glutamax medium(Life Technologies, Merelbeke, Belgium) supplemented with 10%heat-inactivated fetal bovine serum (FBS), 100 lg/ml of streptomy-cin and 100 IU/ml of penicillin. The ovaries were mechanicallydissected using the beveled edges of 2 syringe needles. Follicleswith a diameter of 120–150 lm, 2 layers of granulosa cells, a cen-trally placed oocyte, an intact basal membrane and some attachedtheca cells were selected for individual culture in 10 ll droplets(Day 1) of culture medium, a-minimal essential medium (LifeTechnologies, Merelbeke, Belgium) supplemented with 5% FBS,100 lg/ml of streptomycin, 100 IU/ml of penicillin, 100 mIU/ml re-combinant human follicle stimulating hormone (hFSH) (NIH AFP-4822-B) and ITS mix (5 lg/ml insulin, 5 lg/ml transferrin and5 ng/ml selenium; Sigma–Aldrich, Bornem, Belgium) (Lenie andSmitz, 2009). LiCl (15 mM; dissolved in sterile water; Sigma–Al-drich, Bornem, Belgium), recombinant mouse Wnt3a (100 ng/ml;dissolved in sterile water; R&D Systems, Wiesbaden, Germany)and IWR-1 (10 lM; dissolved in DMSO; Sigma–Aldrich, Bornem,Belgium) were added at the beginning of the culture period, andDMSO was added as a control for IWR-1. The 60 mm culture dishes(Corning Inc., Corning, NY, USA) (20 droplets/dish) were kept in theincubator at 37 �C, 100% humidity and 5% CO2. After 24 h, eachdroplet was supplemented with another 10 ll of culture medium.Subsequent refreshments were performed every other day byremoving and replacing 10 ll of the culture medium. The spentmedium of each dish was pooled and stored at �20 �C for latersteroid secretion analysis. A pool of follicles was also cultured in35 mm dishes and harvested for real-time PCR and Western blot-ting analysis.

The follicle growth and diameter were analyzed using an Olym-pus (Tokyo, Japan) CKX41 inverted microscope with transmittedlight and phase objectives attached with an Olympus DP71 digitalcamera. Photographs of each follicle in the droplets were taken on

L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925 917

D2, D4, D6, D8 and D10 before the medium refreshment along witha photograph of a micrometer for calibration purposes. The photo-graphs were imported into ImageJ 1.33U (National Institutes ofHealth, Bethesda, MD), and the diameter of each follicle was mea-sured in units of pixels that were subsequently converted to unitsof micrometers based on the image of the calibrated micrometer.The follicles were measured from the outer layer of cells. Twomeasurements, including a measurement at the widest diameterof the follicle and another perpendicular to the first, were com-bined to generate a mean value for each follicle diameter, as re-ported previously by Xu et al. Follicles which grew graduallylarger in size and with multiple layers of granulosa cells tightlysurrounding the oocyte were considered to be well developed.Conversely, follicles were defined to be degenerating or abnormalif either the oocyte was no longer surrounded by a layer of granu-losa cells, or the oocyte was getting dark, the granulosa cells werefragmented, or the diameter of the follicles was largely decreased(Xu et al., 2009).

2.3. Bioactivity study

The levels of estradiol (E2) and testosterone (T) in the pooledspent media were measured using the commercial RIA kit at acommercial laboratory (Chemclin Co., Beijing) as previously re-ported (Lu et al., 2009a,b). The intra-assay coefficient of variation(intra-assay CV) was less than 10%, and the inter-assay coefficientof variation (inter-assay CV) was less than 15%. The sensitivity ofthe E2 assay was less than 3 pg/ml, and the sensitivity of the Tassay was less than 0.07 ng/ml.

2.4. Immunofluorescence staining

The immunofluorescence staining protocol was based on previ-ous methods (Cai et al., 2011) with some modifications (Zhanget al., 2011). Briefly, the ovaries of the 14-day-old and adult mice(8w) were fixed for 6 h in 4% paraformaldehyde (pH 7.5), equili-brated in 30% sucrose overnight at 4 �C, embedded in an optimumcutting temperature compound (OCT) and frozen at �80 �C. As thefollicles with 2 layers of granulosa cells that were cultured for 72 hwere not visible, the samples were rinsed in trypan blue for 10 sfor staining before being embedded in the OCT. Sections of10 lm each were cut and mounted on APES-coated slides. Theslides were incubated with a blocking solution (5% goat serum inphosphate-buffered saline) for 1 h at room temperature to reduceany nonspecific binding. The samples were then incubatedovernight at 4 �C with rabbit polyclonal anti-b-catenin (Cat. No.:sc-1496, Santa Cruz Biotechnology, Santa Cruz, CA; dilution1:200) or rabbit polyclonal anti-Ki67 (Cat. No.: 15580, Abcam,Cambridge, MA; dilution 1:200) that were diluted in blocking solu-tion. The negative controls were labeled in parallel and lacked theprimary antibody in 5% goat serum. The slides were then washed 3times in PBS and incubated with a secondary fluorescein isothiocy-anate-conjugated goat anti-rabbit IgG (1:200) for 1 h at room tem-perature. Hochest33342 was used to label the nuclei. The sampleswere imaged on a ZeissLSM510 Meta confocal microscope(Carl Zeiss MicroImaging, Inc., Jena, Germany).

2.5. TUNEL assay

The apoptosis of follicle cells cultured for 72 h was analyzedusing the DeadEnd™ Fluorometric TUNEL System (Promega, Mad-ison, USA) according to the manufacturer’s instructions with somemodifications (Zhang et al., 2011). Briefly, the slides were im-mersed in 4% formaldehyde in PBS for 25 min at 4 �C, and thenwashed twice in PBS. After being permeabilized with 0.2% TritonX-100 for 5 min, each slide was covered with an equilibration

buffer for 10 min. The buffer was then aspirated, and the slideswere incubated with terminal deoxynucleotidyl transferase (TdT)buffer at 37 �C for 1 h. The reaction was stopped with 2 � standardsaline citrate (SCC), and the slides were again washed 3 times. Thenuclei were stained with Hochest33342. The green fluorescence ofthe apoptotic cells against the blue background was examinedusing a Nikon Eclipse 80i fluorescence microscope (Tokyo, Japan).The level of apoptosis was quantified by determining the propor-tion of cells containing nuclei with complete TUNEL-associatedstaining. The follicles and slides for analysis were chosen ran-domly, and 3 different experiments were analyzed.

2.6. Preparation of nuclear lysates

The nuclear fractions of the incubated follicles were isolatedusing a Nuclear Extraction Kit (Millipore Corp., Billerica, MA)according to the manufacturer’s instructions (Uckun et al., 2012).Briefly, follicles treated for 1 h with or without LiCl, Wnt3a orIWR-1 were collected, transferred to a clean tube, and centrifugedat 250�g for 5 min at 4 �C, and the supernatants were discarded.After estimating the volume of each follicle pellet, 5 pellet volumesof ice-cold 1� cytoplasmic lysis buffer containing 0.5 mM DTT anda 1/1000 dilution of the inhibitor cocktail were added. The pelletwas resuspended by gently inverting the tube. The suspensionwas incubated on ice for 15 min and centrifuged at 250�g for5 min at 4 �C. The supernatant was discarded. Two volumes ofice-cold 1� cytoplasmic lysis buffer were added to resuspendedthe pellet. The subsequent suspension was then ejected througha syringe with a 27-gauge needle into the sample tube. This proce-dure was repeated 5 times, after which the disrupted cell suspen-sion was centrifuged at 8000�g for 20 min at 4 �C. The remainingpellet therefore contained the nuclear portion of the cell lysate.This pellet was resuspended in 2/3 the original pellet volume ofice-cold nuclear extraction buffer containing 0.5 mM DTT and a1/1000 dilution of the protease inhibitor cocktail. The resuspensionwas filtered through a fresh 27-gauge syringe, incubated on icefor 30–60 min and centrifuged at 16000�g for 5 min at 4 �C. Thesupernatant was then transferred to a fresh tube. This fraction con-tained the nuclear extract to be used in Western blotting analysis.

2.7. Western blotting

Western blotting analysis was performed as described previ-ously (Chen et al., 2008). The follicles were cultured in differentconditions for 48 h, and then washed in ice-cold phosphate-buf-fered saline (PBS). The follicle lysates were prepared in a radioim-mune precipitation assay (RIPA) lysis buffer containing completeminiprotease-inhibitor and PhosSTOP Phosphatase Inhibitor cock-tail tablets (Roche, Mannheim, Germany). The solutions were cen-trifuged at 12,000�g for 10 min 4 �C, and the supernatants werecollected. The protein concentration of the supernatants was esti-mated using a Bradford assay (Bio-Rad Laboratories, Hercules,CA). Sixty micrograms of protein for each sample was subjectedto Western blotting. The samples were loaded onto a 12% sodiumdodecyl sulfate polyacrylamide gel and were electrophoreticallytransferred to nitrocellulose membranes. After blocking with 5%nonfat milk in Tris-buffered saline Tween-20 (TBST pH 7.4) for 1 hat room temperature, the membranes were incubated with the pri-mary antibodies at 4 �C overnight and then a 1:5000 fluorescentsecondary antibody in blocking solution: IRDye 800 anti-mouseMolecular Probes (Rockland Immunochemicals, PA) and IRDye800 anti-rabbit (Molecular Probes, OR). The molecular marker usedwas SM0671 (Fermentas International Inc., Canada). Images wereacquired with the Odyssey infrared imaging system and analyzedvia the software program as described in the Odyssey softwaremanual. The antibodies used were as follows: anti-b-catenin (Cat.

Table 1Primers used for quantitative real-time PCR analysis.

Gene Accession number Forward primer (50–30) Reverse primer (50–30) Product length (bp)

Cyclin D1 NM_007631 TTGTGCATCTACACTGACAACTC AGGGTGGGTTGGAAATGAACT 232Axin2 NM_015732 GATTCCCCTTTGACCAGGTGG CCCATTACAAGCAAACCAGAAGT 135Fgf9 NM_013518 TCTTCCCCAACGGTACTATCC CCGAGGTAGAGTCCACTGTC 124Bim NM_207680 CCCGGAGATACGGATTGCAC GCCTCGCGGTAATCATTTGC 96PUMA NM_133234 GACCTCAACGCACAGTA CTAATTGGGCTCCATCT 143p27 NM_009875 GCAGGAGAGCCAGGATGTCA CCTGGACACTGCTCCGCTAA 141Cyp19a1 NM_007810 CAAGTCCTCAAGCATGTTCCA AAGGCTCGGGTTGTTGTTAAATA 127Cyp11a1 NM_019779 AGGTCCTTCAATGAGATCCCTT TCCCTGTAAATGGGGCCATAC 137Gapdh NM_008084 TGATGACATCAAGAAGGTGGTGAAG TCCTTGGAGGCCATGTAGGCCAT 240

Cyclin D1, Axin2 and FGF9: Wnt/b-catenin signaling target genes; Bim, PUMA and p27: Foxo3a target genes; Bim: a BH3 domain protein capable of inducing cell apoptosis;PUMA: p53-upregulated apoptosis modulator; p27: the cyclin-dependent kinase (Cdk) inhibitor; Cyp11a1, P450 cholesterol side chain cleavage; Cyp19a1, cytochrome P450aromatase.

918 L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925

No.: sc-1496, 1:1000 dilution), anti-Histone H1 (Cat. No.: sc-8030,1:500 dilution) and anti-3b-HSD (Cat. No.: sc-30820, 1:1000 dilu-tion) (all from Santa Cruz Biotechnology); anti-Foxo3a (Cat. No.:24997S, 1:1000 dilution) and anti-p-Foxo1/Foxo3a (Cat. No.:9464, 1:1000 dilution) (both from Cell Signaling Technology); andanti-b-actin (Cat. No.: A5441, 1:2000 dilution) (from Sigma).

2.8. RNA extraction and real-time PCR

The follicles were harvested, washed in ice-cold PBS and lysedwith TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). The totalRNA was extracted according to the manufacturer’s instructionsas previously reported (Guo et al., 2007). A total of 2 lg of RNAwas reverse transcribed in a final reaction volume of 20 ll, whichcontained 100 ng random primers, 1 ll (200 units) of the Moloneymurine leukemia virus reverse transcriptase, 4 ll 5 � first standbuffer, 1 ll 10 mM deoxynucleotide triphosphates to cDNA(10 mM each dATP, dGTP, dCTP, and dTTP at neutral PH) and 1 ll(40 units/ll) of ribonuclease inhibitor (all from Invitrogen). Thereal-time PCR was carried out using the CFX 96 Real-Time PCRDetection System (Bio-Rad Laboratories, Hercules, CA) and a SYBRGreen PCR Kit (Takara Bio Inc., Otsu, Japan). Thermal cycling wasconducted at 95 �C for 10 min, followed by 40 cycles of amplifica-tion at 95 �C for 15 s, 60 �C for 45 s and 72 �C for 30 s. The thermalamplification was followed by a dissociation-curve analysis to con-firm the specificity of the amplification products. The mRNAexpression levels were normalized against the Gapdh levels andwere analyzed using the comparative Ct method (DDCt). The meanof the fold changes obtained from three independent experimentswas calculated. The primer pairs used for real-time PCR are shownin Table 1.

2.9. Statistical analysis

The experiments were repeated at least 3 times from differentpreparations. The data were analyzed using the SPSS statisticalsoftware (SPSS Inc., Chicago, IL). All values were presented as themeans ± S.E.M. For statistical comparisons between 2 groups, anindependent sample t-test was used. For statistical comparisonsamong multiple groups, a one-way ANOVA followed by a least-sig-nificant-difference test was used. A P value < 0.05 was consideredsignificant.

3. Results

3.1. b-catenin is expressed in postnatal ovary follicles

The localization of b-catenin in the ovaries of postnatal mice atdifferent developmental stages was assessed by immunofluores-cence staining. As shown in Fig. 1, the b-catenin protein was de-

tected in the cytoplasm of granulosa cells of 14-day-old ovaries,but no measurable staining was observed in either the nuclei orthe oocytes. A strong b-catenin expression was also detectedin the cytoplasm of granulosa cells, as well as in the theca cellsof the adult antral follicles.

3.2. The effects of LiCl, Wnt3a and IWR-1 on Wnt/b-catenin signalingmolecules

To validate the effects of LiCl, Wnt3a and IWR-1 on Wnt/b-cate-nin signaling, the nuclear b-catenin protein level and the mRNAlevels of several Wnt/b-catenin signaling target genes (Cyclin D1,Axin2 and FGF9) were analyzed. As shown in Fig. 2, the level ofb-catenin in the nuclei of the cultured follicles was increased by132.9% and 170.6% respectively 1 h after LiCl or Wnt3a treatment(both P < 0.01; Fig. 2A). The mRNA level of Cyclin D1 in LiCl orWnt3a treated follicles was also significantly increased by 631.8%and 540.1% respectively (both P < 0.01), as well as the Axin2expression increased by 225.4% and 150.2% and the FGF9 expres-sion increased by 162.6% and 187.5%, respectively (all P < 0.05;Fig. 2B), indicating that Wnt/b-catenin signaling could be activatedby either of the activators. In contrast, the level of nuclear b-cate-nin protein in the IWR-1 treated follicles was significantly reducedby 56.7% (P < 0.01, Fig. 2C). Real-time PCR analysis also revealed asignificant reduction in the mRNA levels of Cyclin D1 (by 70.5%;P < 0.01), Axin2 (by 46.3%; P < 0.001) and FGF9 (by 31.6%;P < 0.01) (Fig. 2D), confirming the inhibitory effect of IWR-1 onWnt/b-catenin signaling.

3.3. Wnt/b-catenin signaling is essential for follicular development

To investigate the potential involvement of Wnt/b-catenin sig-naling in the regulation of follicular development, we took advan-tage of our well-established in vitro culture system (Zhang et al.,2011). Secondary follicles were isolated from the ovaries of 14-day-old mice and cultured in droplets. Two activators of Wnt/b-catenin signaling, LiCl (15 mM) and Wnt3a (100 ng/ml), and oneinhibitor, IWR-1(10 lM), were added to the culture medium, andDMSO was used as a control for IWR-1. The follicles were incu-bated for 10 days, and the resulting morphology of the folliclesincubated in the different conditions was shown in Fig. 3. For thefollicle culture data, one representative picture of the results ofthree independent experiments is presented.

On Day 1, follicles were chosen and placed individually in thedroplets. On Days 2 and 4, the incubated follicles were surroundedby a clearly visible basal membrane, with some theca cells startingto attach to bottom of the dish. The morphology of follicles in thedifferent treatment conditions was approximately the same(Fig. 3A), and the follicle diameters were also similar among thegroups (Fig. 3B). On Day 6, however, the follicle phenotypes began

Fig. 1. The immunofluorescence localization of b-catenin in the ovarian follicles of postnatal mice. Confocal sections of ovaries from 14-day-old (A) and adult mice (B) werelabeled with Hochest33342 (blue) for the nuclei and with b-catenin antibody (green) or with no antibody as a negative control (C). Scale bar = 100 lm. GR, granulosa cells; Oo,oocytes; TC, theca cells. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 2. The effects of LiCl, Wnt3a and IWR-1 on Wnt/b-catenin signaling molecules. (A) LiCl and Wnt3a stimulated the translocation of b-catenin into the nuclei of the cells inthe cultured follicles. Nuclear protein was extracted from follicles incubated with LiCl (15 mM) and Wnt3a (100 ng/ml) for 1 h. Western blot analysis demonstrated increasingamounts of nuclear b-catenin protein. (B) The real-time PCR showed an elevated expression of the b-catenin signaling downstream effectors, Cyclin D1, Axin2 and FGF9. (C)IWR-1 inhibited the nuclear accumulation of b-catenin. The nuclear protein was prepared from follicles incubated with IWR-1 (10 lM) for 1 h. DMSO was used as a control.(D) The expression of Cyclin D1, Axin2 and FGF9 mRNA was decreased after 24 h cultured with IWR-1. Each experiment was repeated 3 times. � P < 0.05. �� P < 0.01.��� P < 0.001.

L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925 919

Fig. 3. The effects of LiCl, Wnt3a and IWR-1 on follicular development. (A) The morphological analysis of follicle growth over 10 days’ culture. Photographs of Control, DMSO,LiCl (15 mM), Wnt3a (100 ng/ml) and IWR-1 (10 lM) treated follicles were taken on days 2, 4, 6, 8, 10 and the representative photograghs of three independent experimentswere presented. Scale bar = 100 lm. (B) The effects of LiCl, Wnt3a and IWR-1 on the diameter of the cultured follicles. The data are presented as the mean ± S.E.M. (C) Thenumber of total cultured follicles, well-developed and abnormal follicles from the different treatment conditions. The percentage of each follicle type is shown in parentheses.

920 L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925

to differ among the groups. The IWR-1 treated follicles grew themost and had the largest diameter, with multiple layers of granu-losa cells tightly surrounding the oocyte. In contrast, the LiCl- andWnt3a-treated follicles were smaller, with fewer granulosa cellscompared with the control. During the next 4 days, the diameterof the IWR-1 treated follicles continued to increase, and multiplelayers of follicle cells spread out on the bottom of the dish. How-ever, follicles incubated with LiCl and Wnt3a grew more slowly,reaching a smaller size and with only few layers of granulosa cells.After 10 days, most of the follicles in the control (87%), DMSO (89%)and the IWR-1-treated (95%) groups were well developed, whereasmost of the follicles in the LiCl- (89%) and Wnt3a-treated (86%)groups appeared abnormal (Fig. 3C).

To further characterize the LiCl- and Wnt3a-induced defects onfollicle development, a TUNEL assay and a Ki67 immunostainingwere performed. As shown in Fig. 4, compared with the control(2%), the proportion of TUNEL-positive cells (green) was signifi-cantly increased in the LiCl (42%) and Wnt3a (51%) conditions(both P < 0.01; Fig. 4A and B), whereas the proportion of the Ki67staining proliferating cells (green) was reduced significantly (from64% to 18% and 23%) (both P < 0.05; Fig. 4C and D), indicating that

activation of Wnt/b-catenin signaling was capable of inducinggranulosa cell apoptosis while suppressing their proliferation.

3.4. The effects of LiCl, Wnt3a and IWR-1 on follicular steroidogenesis

The follicle culture media in the droplets was half refreshed,and the spent media was pooled for analysis of the estradiol andtestosterone concentrations. As shown in Fig. 5, after 72 h culture,the follicle estradiol concentrations in the LiCl and Wnt3a condi-tioned media were significantly decreased from 27.59 pg/ml to0.36 pg/ml and 1.42 pg/ml respectively (Fig. 5A). The concentra-tions of testosterone were also significantly decreased from1.72 ng/dl to 0.54 ng/dl and 0.43 ng/dl respectively (Fig. 5B) (allP < 0.01). Conversely, in the IWR-1-conditioned media, estradiolsecretion was increased from 35.96 pg/ml to 119.7 pg/ml and tes-tosterone secretion was increased from 0.92 ng/dl to 1.93 ng/dl(both P < 0.05; Fig. 5C and D). To further examine the expressionof steroidogenesis-related enzymes, real-time PCR and Westernblot analysis were performed to assess the levels of Cyp19a1 (aro-matase), Cyp11a1 and 3b-HSD. The results showed that the expres-sion of these 3 molecules was significantly reduced by 72%

Fig. 4. The apoptosis and proliferation of cultured follicles following LiCl and Wnt3a treatment. The follicles were incubated with LiCl (15 mM) and Wnt3a (100 ng/ml) for72 h, then collected and embedded in OCT. Confocal sections were used for subsequent staining. Compared with the control follicles, the number of TUNEL-positive cells(green) was significantly increased following the LiCl and Wnt3a treatment (A and B). Immunolocalization of Ki67 indicated that the number of proliferating cells (green) wasreduced after LiCl and Wnt3a treatment compared with the control group (C); the differences were both significant (D). The graphs represent the average granulosa cellcounts of the follicles cultured in 3 independent experiments. � P < 0.05. �� P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred tothe web version of this article.)

L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925 921

(P < 0.01), 51.6% (P < 0.05) and 67.3% (P < 0.01) respectively afterLiCl treatment, and also reduced by 65.9% (P < 0.01), 77.3%(P < 0.05) and 55.4% (P < 0.05) respectively after Wnt3a treatment(Fig. 5E, G, H); in contrast, IWR-1 treatment increased the expres-sion of these molecules by 80.8% (P < 0.05), 65.4% (P < 0.01) and71.4% (P < 0.001), respectively (Fig. 5F–H).

3.5. The effect of Wnt/b-catenin signaling on Foxo3a activation and itsdownstream target molecules

To determine whether Foxo3a is a downstream effector of Wntsignaling, Western blot analysis was performed. As shown in Fig. 6,the level of Foxo3a phosphorylation was significantly decreased bythe Wnt/b-catenin signaling activators LiCl (by 68.2%, P < 0.001)and Wnt3a (by 52.7%, P < 0.05) and increased by the inhibitorIWR-1 (by 43.3%, P < 0.05), indicating that the activation of Foxo3awas regulated by Wnt/b-catenin signaling. To further demonstrate

how Foxo3a activation could influence follicular survival andgrowth, the expression of 3 important Foxo3a target molecules,Bim, PUMA, and p27, was examined. As shown in Fig. 7, the expres-sion levels of Bim, PUMA and p27 were significantly increased inthe presence of LiCl by 95.9% (P < 0.05), 152.7% (P < 0.01) and117.8% (P < 0.05), respectively and also increased in the presenceof Wnt3a by 110.3% (P < 0.05), 91.5% (P < 0.01) and 74.2%(P < 0.05), respectively. Conversely, in the presence of IWR-1, theywere separately decreased by 39.2% (P < 0.05), 53.3% (P < 0.01) and33.6% (P < 0.01), respectively, implying that Foxo3a and its targetmolecules were downstream effectors of Wnt/b-catenin signaling.

4. Discussion

Increasing evidence has shown that the Wnts and Wnt signalingcomponents are differentially expressed in the mammalian ovary

Fig. 5. The secretion of estradiol and testosterone by follicles treated with LiCl, Wnt3a and IWR-1 and the expression of steroidogenesis-related enzymes. (A and B) After 72 hof culture (Day 4), the secretion of estradiol (A) and testosterone (B) was decreased significantly by LiCl and Wnt3a. (C and D) the secretion of estradiol (C) and testosterone(D) was increased significantly by IWR-1 as compared with the control. (E and F) The total RNAs from the cultured follicles in the presence or absence of LiCl, Wnt3a and IWR-1 were isolated after 24 h of culture, and real-time PCR was conducted. The expression of Cyp19a1 and Cyp11a1 was decreased by LiCl and Wnt3a (E), and increased by IWR-1(F). (G) Western blot analysis showed the decreased expression of steroidogenesis-related enzymes 3b-HSD by LiCl and Wnt3a and the increased expression of 3b-HSD byIWR-1. (H) The bar graphs represent the results of the densitometric analysis of 3b-HSD protein levels. The statistical evaluation used data from 3 independent experiments.� P < 0.05. �� P < 0.01. ��� P < 0.001.

922 L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925

(Hsieh et al., 2002). Previous studies have demonstrated the phys-iological importance of the signaling in the regulation of ovarianfunction at different developmental stages (Boerboom et al.,2005, 2006; Fan et al., 2010). However, the role of this pathwayin regulation of early follicular development remains unknown.

Wnt signaling has divergent roles in the tissue development in atime- and cell type-specific manner (Benchabane and Ahmed,2009; van Amerongen and Nusse, 2009; Poschl et al., 2013). It ap-pears possible that Wnt activation at different time points of devel-opment has different or even opposing effects (Ivaniutsin et al.,2009; Lorenz et al., 2011). For example, Ctnnb1(Ex3)fl/fl;Cyp19-Cremice reveal FSH-induced follicle growth (Fan et al., 2010), butCtnnb1(Ex3)fl/fl;Amhr2-Cre mice show few matured follicles. It is ob-served in the Ctnnb1(Ex3)fl/fl;Amhr2-Cre mice that the probably atre-tic follicles, disorganized granulosa cells and less PCNA-positivelesion cells are present before the tumor forms (Boerboom et al.,2005). These differences may be because of the activation of b-catenin at the different follicle developmental stages, as Cyp19-Cre mediated recombinase activity is limited to the small antraland preovulatory follicles, whereas the expression of Amhr2 is asearly as embryonic d14. Moreover, the differences may also beattributed to the modulation of pituitary hormones as well as thedifferent physiological characteristics between preantral and an-tral follicles. Therefore, it is critical to understand the function of

Wnt/b-catenin signaling at defined stages and use appropriatemodels to investigate its function.

Here we employed in vitro follicle culture system to explore thepossible role of Wnt/b-catenin signaling in the regulation of earlyfollicular development. Using this approach, it will be possible tosurvey the influence of factors on follicle development, maintainnormal cell contact and follicle integrity, and also facilitate theobservation of follicle morphology and survival at any given cul-ture period (Zhang et al., 2011). In the current study, the well-rec-ognized Wnt/b-catenin signaling activators LiCl and Wnt3a and theinhibitor IWR-1 were separately added to the medium. We demon-strated for the first time that the activation of this pathwayproduced a dramatic dysgenesis of the follicles, whereas the sup-pression of this pathway promoted follicular growth. Taken to-gether, these data suggest that Wnt/b-catenin signaling may beessential for negatively controlling early follicular development.

The canonical Wnt/b-catenin pathway transduces signalsthrough the linchpin b-catenin molecule into the nuclei. b-cateninis a dual-function protein, providing a mechanical link between thecell-to-cell junctional proteins (E-cadherin) and the cytoskeletalproteins near the cell surface (Reynolds and Roczniak-Ferguson,2004). Importantly, b-catenin can also be imported into the cell nu-clei as a nuclear transcription co-factor, where it mediates targetgene transcription. Our data (Fig. 2) suggest that LiCl and Wnt3a

Fig. 6. The effect of LiCl, Wnt3a and IWR-1 on Foxo3a phosphorylation. (A) The follicles were treated with LiCl (15 mM), Wnt3a (100 ng/ml) or IWR-1 (10 lM) for 48 h. Eachof the lysates was subjected to Western blot analysis using antibodies specific to phospho-Foxo3a and Foxo3a. b-actin served as an internal loading control. (B) A summary ofthe Western blot results showing in (A). The bars represent the mean ± S.E.M. of the intensities of the signals detected by the phospho-Foxo3a and Foxo3a antibodies. Thestatistical evaluation used data from 3 independent experiments. � P < 0.05. �� P < 0.01. ��� P < 0.001.

Fig. 7. The expression profiles of Foxo3a downstream targets revealed by real-timePCR. The total RNA was isolated from the cultured follicles. The expression of Bim,PUMA and p27 was assessed at the mRNA level by real-time PCR. All data werenormalized to the GAPDH levels. The mRNA levels of these 3 Foxo3a downstreamtargets were elevated after LiCl or Wnt3a treatment (A). In sharp contrast, the IWR-1 treatment produced significant lower mRNA levels (B). � P < 0.05. �� P < 0.01.

L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925 923

can elevate the nuclear b-catenin protein levels and thereby in-crease the mRNA levels of downstream signaling targets CyclinD1, Axin2 and FGF9. This finding indicates the activation of Wnt/b-catenin signaling and the nuclear trans-localization of b-cateninby LiCl and Wnt3a. In contrast, the IWR-1 treatment produced theopposite effect.

Ovarian follicle growth and development depends largely ongranulosa cell proliferation. Of the primordial follicles, only a lim-ited number begin to activate during a given estrous cycle, and fewfollicles will go through ovulation; most follicles are lost throughatresia (McGee and Hsueh, 2000). As shown in Fig. 3, the granulosacells formed multiple layers and expanded within 6–10 days inboth the control and the IWR-1 groups. However, the diametersof the LiCl- and Wnt3a-treated follicles decreased dramatically,with only few layers of granulosa cells surrounding the oocytes.Based on this result, we hypothesized that the developmentalrepression of the activator-treated follicles was partially due to adefect in granulosa cell proliferation. The Wnt signaling pathwaymight therefore be important for granulosa cell proliferation andapoptosis. For the relationship of Wnt/b-catenin and cellular apop-tosis and proliferation, it has been previously demonstrated thatover expression of b-catenin promotes apoptosis or inhibits prolif-eration in several mouse models or mammalian cell lines (Kimet al., 2000; Olmeda et al., 2003). For example, Wnt3a was a canon-ical Wnt with pro-apoptotic action that significantly increased cel-lular caspase activities and TUNEL staining in H9C2 cells (Zhanget al., 2009). Moreover, transfection with b-catenin small interfer-ing RNA or expression of dominant negative TCF inhibited apopto-sis, whereas expression of dominant stable b-catenin causedsignificant apoptosis in human ovarian surface epithelial cells(Pon and Wong, 2006). These observations clearly support a rolefor canonical Wnt/b-catenin signaling in mediating apoptosis andproliferation in specific cells. Similar results were also obtainedin our study that a TUNEL assay and a Ki67 immunostaining wereperformed (Fig. 4). As expected, an increase in the number of TUN-EL-positive cells and a corresponding decrease in the number ofKi67-positive follicles were observed in the LiCl and Wnt3a treat-ment conditions.

In addition to follicle growth and survival, follicle steroidsecretion was found to be regulated by Wnt/b-catenin signaling.

924 L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925

Estradiol and testosterone production decreased significantly upontreatment with the activators LiCl and Wnt3a and increased signif-icantly upon treatment with the inhibitor IWR-1. The expressionlevels of Cyp19a1 (aromatase), Cyp11a1 and 3b-HSD were also dif-ferentially affected by the activators and the inhibitor.

We next explored the possible mechanism responsible for reg-ulating follicular development and aimed to identify the relevantsignal pathways. The Foxo3a signaling pathway was reported tobe of close relevance due to several studies. Castrillon et al. havedemonstrated that Foxo3a functioned at the primordial stage as asuppressor of follicular growth (Castrillon et al., 2003). Our previ-ous work comfirmed the result that Foxo3a might be a key stepin the activation of primordial follicles (Yang et al., 2010). Liuet al. demonstrated that Foxo3a activation could prevent folliclesfrom developing into the next stage, indicating that Foxo3a mighthave a decisive role in repressing follicle development (Liu et al.,2007). In our current study, Foxo3a was found to be regulated byWnt/b-catenin signaling. The phosphorylation of Foxo3a was de-creased by the activators, LiCl and Wnt3a, indicating that it wasconsiderably activated and might exert its negative role in follicledevelopment. In contrast, Foxo3a was significantly inhibited bythe inhibitor IWR-1, restricting its negative effect and thus promot-ing the development of follicles. To further explore the role of theFoxo3a signal in controlling follicular development, 3 Foxo3a tar-get molecules, Bim, PUMA, and p27, were also investigated. LikeFoxo3a, the expression of these molecules increased after LiCland Wnt3a treatment and decreased after IWR-1 treatment. Giventhat Bim and PUMA are pro-apoptosis factors (Dijkers et al.,2000a,b; Gilley et al., 2003; You et al., 2006) and that p27 is a cellcycle inhibitor (Fero et al., 1996; Dijkers et al., 2000a,b), we couldnot exclude the possibility that the Foxo3a signaling componentsmight be involved in regulating the proliferation and apoptosis offollicular granulosa cells and Wnt/b-catenin signaling might re-press follicular growth partially through the Foxo3a signaling.

In summary, our study provides the first demonstration of therole of Wnt signaling in the regulation of early follicular develop-ment. The activation of Wnt/b-catenin signaling by LiCl and Wnt3aresulted in a follicular growth defect and a decreased secretion ofsteroid hormones. We also found that Wnt/b-catenin signalingcould promote granulosa cell apoptosis and repress their prolifer-ation, likely through the activation of Foxo3a and its downstreameffectors. In contrast, the inhibition of Wnt/b-catenin signaling byIWR-1 had the opposite effect, promoting the growth of better-developed follicles. These findings provide useful informationabout the role of Wnt/b-catenin signaling in early follicle develop-ment. However, how activated b-catenin modulates the activationof Foxo3a as well as the complex regulatory mechanisms of varioussignal pathways involved will require further investigation.

Acknowledgments

We thank Dr. Chenxi Zhou of the Department of Obstetrics andGynecology at the University of Ottawa Faculty of Medicine (Email:czhou@ohri.ca; Tel.: +1 (613) 798 5555x13062), for reviewing thismanuscript.

References

Accili, D., Arden, K.C., 2004. FoxOs at the crossroads of cellular metabolism,differentiation, and transformation. Cell 117, 421–426.

Adriaens, I., Cortvrindt, R., Smitz, J., 2004. Differential FSH exposure in preantralfollicle culture has marked effects on folliculogenesis and oocyte developmentalcompetence. Hum. Reprod. 19, 398–408.

Anastas, J.N., Moon, R.T., 2013. WNT signalling pathways as therapeutic targets incancer. Nat. Rev. Cancer 13, 11–26.

Azzolin, L., Zanconato, F., Bresolin, S., Forcato, M., Basso, G., Bicciato, S., Cordenonsi,M., Piccolo, S., 2012. Role of TAZ as mediator of Wnt signaling. Cell 151, 1443–1456.

Benchabane, H., Ahmed, Y., 2009. The adenomatous polyposis coli tumor suppressorand Wnt signaling in the regulation of apoptosis. Adv. Exp. Med. Biol. 656, 75–84.

Boerboom, D., Paquet, M., Hsieh, M., Liu, J., Jamin, S.P., Behringer, R.R., Sirois, J.,Taketo, M.M., Richards, J.S., 2005. Misregulated Wnt/beta-catenin signalingleads to ovarian granulosa cell tumor development. Cancer Res. 65, 9206–9215.

Boerboom, D., White, L.D., Dalle, S., Courty, J., Richards, J.S., 2006. Dominant-stablebeta-catenin expression causes cell fate alterations and Wnt signalingantagonist expression in a murine granulosa cell tumor model. Cancer Res.66, 1964–1973.

Boyer, A., Goff, A.K., Boerboom, D., 2010a. WNT signaling in ovarian follicle biologyand tumorigenesis. Trends Endocrinol. Metab. 21, 25–32.

Boyer, A., Lapointe, E., Zheng, X., Cowan, R.G., Li, H., Quirk, S.M., DeMayo, F.J.,Richards, J.S., Boerboom, D., 2010b. WNT4 is required for normal ovarian follicledevelopment and female fertility. FASEB J. 24, 3010–3025.

Cai, H., Ren, Y., Li, X.X., Yang, J.L., Zhang, C.P., Chen, M., Fan, C.H., Hu, X.Q., Hu, Z.Y.,Gao, F., Liu, Y.X., 2011. Scrotal heat stress causes a transient alteration in tightjunctions and induction of TGF-beta expression. Int. J. Androl. 34, 352–362.

Castrillon, D.H., Miao, L., Kollipara, R., Horner, J.W., DePinho, R.A., 2003. Suppressionof ovarian follicle activation in mice by the transcription factor Foxo3a. Science301, 215–218.

Chassot, A.A., Ranc, F., Gregoire, E.P., Roepers-Gajadien, H.L., Taketo, M.M.,Camerino, G., de Rooij, D.G., Schedl, A., Chaboissier, M.C., 2008. Activation ofbeta-catenin signaling by Rspo1 controls differentiation of the mammalianovary. Hum. Mol. Genet. 17, 1264–1277.

Chen, B., Dodge, M.E., Tang, W., Lu, J., Ma, Z., Fan, C.W., Wei, S., Hao, W., Kilgore, J.,Williams, N.S., Roth, M.G., Amatruda, J.F., Chen, C., Lum, L., 2009. Smallmolecule-mediated disruption of Wnt-dependent signaling in tissueregeneration and cancer. Nat. Chem. Biol. 5, 100–107.

Chen, M., Cai, H., Yang, J.L., Lu, C.L., Liu, T., Yang, W., Guo, J., Hu, X.Q., Fan, C.H., Hu,Z.Y., Gao, F., Liu, Y.X., 2008. Effect of heat stress on expression of junction-associated molecules and upstream factors androgen receptor and Wilms’tumor 1 in monkey sertoli cells. Endocrinology 149, 4871–4882.

Clevers, H., Nusse, R., 2012. Wnt/beta-catenin signaling and disease. Cell 149, 1192–1205.

Couse, J.F., Yates, M.M., Deroo, B.J., Korach, K.S., 2005. Estrogen receptor-beta iscritical to granulosa cell differentiation and the ovulatory response togonadotropins. Endocrinology 146, 3247–3262.

Dijkers, P.F., Medema, R.H., Lammers, J.W., Koenderman, L., Coffer, P.J., 2000a.Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by theforkhead transcription factor FKHR-L1. Curr. Biol. 10, 1201–1204.

Dijkers, P.F., Medema, R.H., Pals, C., Banerji, L., Thomas, N.S., Lam, E.W., Burgering,B.M., Raaijmakers, J.A., Lammers, J.W., Koenderman, L., Coffer, P.J., 2000b.Forkhead transcription factor FKHR-L1 modulates cytokine-dependenttranscriptional regulation of p27(KIP1). Mol. Cell. Biol. 20, 9138–9148.

Dong, J., Albertini, D.F., Nishimori, K., Kumar, T.R., Lu, N., Matzuk, M.M., 1996.Growth differentiation factor-9 is required during early ovarian folliculogenesis.Nature 383, 531–535.

Edson, M.A., Nagaraja, A.K., Matzuk, M.M., 2009. The mammalian ovary fromgenesis to revelation. Endocr. Rev. 30, 624–712.

Fan, H.Y., Liu, Z., Shimada, M., Sterneck, E., Johnson, P.F., Hedrick, S.M., Richards, J.S.,2009. MAPK3/1 (ERK1/2) in ovarian granulosa cells are essential for femalefertility. Science 324, 938–941.

Fan, H.Y., O’Connor, A., Shitanaka, M., Shimada, M., Liu, Z., Richards, J.S., 2010. Beta-catenin (CTNNB1) promotes preovulatory follicular development but repressesLH-mediated ovulation and luteinization. Mol. Endocrinol. 24, 1529–1542.

Fero, M.L., Rivkin, M., Tasch, M., Porter, P., Carow, C.E., Firpo, E., Polyak, K., Tsai, L.H.,Broudy, V., Perlmutter, R.M., Kaushansky, K., Roberts, J.M., 1996. A syndrome ofmultiorgan hyperplasia with features of gigantism, tumorigenesis, and femalesterility in p27(Kip1)-deficient mice. Cell 85, 733–744.

Gilley, J., Coffer, P.J., Ham, J., 2003. FOXO transcription factors directly activate bimgene expression and promote apoptosis in sympathetic neurons. J. Cell Biol.162, 613–622.

Guo, J., Tao, S.X., Chen, M., Shi, Y.Q., Zhang, Z.Q., Li, Y.C., Zhang, X.S., Hu, Z.Y., Liu, Y.X.,2007. Heat treatment induces liver receptor homolog-1 expression in monkeyand rat sertoli cells. Endocrinology 148, 1255–1265.

Hernandez Gifford, J.A., Hunzicker-Dunn, M.E., Nilson, J.H., 2009. Conditionaldeletion of beta-catenin mediated by Amhr2cre in mice causes femaleinfertility. Biol. Reprod. 80, 1282–1292.

Hoogeboom, D., Essers, M.A., Polderman, P.E., Voets, E., Smits, L.M., Burgering, B.M.,2008. Interaction of FOXO with beta-catenin inhibits beta-catenin/T cell factoractivity. J. Biol. Chem. 283, 9224–9230.

Hsieh, M., Boerboom, D., Shimada, M., Lo, Y., Parlow, A.F., Luhmann, U.F., Berger, W.,Richards, J.S., 2005. Mice null for Frizzled4 (Fzd4�/�) are infertile and exhibitimpaired corpora lutea formation and function. Biol. Reprod. 73, 1135–1146.

Hsieh, M., Johnson, M.A., Greenberg, N.M., Richards, J.S., 2002. Regulated expressionof Wnts and frizzleds at specific stages of follicular development in the rodentovary. Endocrinology 143, 898–908.

Ivaniutsin, U., Chen, Y.J., Mason, J.O., Price, D.J., Pratt, T., 2009. Adenomatouspolyposis coli is required for early events in the normal growth anddifferentiation of the developing cerebral cortex. Neural Dev. 4.

L. Li et al. / Molecular and Cellular Endocrinology 382 (2014) 915–925 925

Jamin, S.P., Arango, N.A., Mishina, Y., Hanks, M.C., Behringer, R.R., 2002.Requirement of Bmpr1a for Mullerian duct regression during male sexualdevelopment. Nat. Genet. 32, 408–410.

Kawaguchi, J., Nichols, J., Gierl, M.S., Faial, T., Smith, A., 2010. Isolation andpropagation of enteric neural crest progenitor cells from mouse embryonicstem cells and embryos. Development 137, 693–704.

Kim, K., Pang, K.M., Evans, M., Hay, E.D., 2000. Overexpression of beta-catenininduces apoptosis independent of its transactivation function with LEF-1 or theinvolvement of major G1 cell cycle regulators. Mol. Biol. Cell 11, 3509–3523.

Lapointe, E., Boerboom, D., 2011. WNT signaling and the regulation of ovariansteroidogenesis. Front Biosci. (Schol. Ed.) 3, 276–285.

Lapointe, E., Boyer, A., Rico, C., Paquet, M., Franco, H.L., Gossen, J., DeMayo, F.J.,Richards, J.S., Boerboom, D., 2012. FZD1 regulates cumulus expansion genes andis required for normal female fertility in mice. Biol. Reprod. 87, 104.

Lenie, S., Smitz, J., 2009. Functional AR signaling is evident in an in vitro mousefollicle culture bioassay that encompasses most stages of folliculogenesis. Biol.Reprod. 80, 685–695.

Liu, L., Rajareddy, S., Reddy, P., Du, C., Jagarlamudi, K., Shen, Y., Gunnarsson, D.,Selstam, G., Boman, K., Liu, K., 2007. Infertility caused by retardation of folliculardevelopment in mice with oocyte-specific expression of Foxo3a. Development134, 199–209.

Lorenz, A., Deutschmann, M., Ahlfeld, J., Prix, C., Koch, A., Smits, R., Fodde, R.,Kretzschmar, H.A., Schuller, U., 2011. Severe alterations of cerebellar corticaldevelopment after constitutive activation of Wnt signaling in granule neuronprecursors. Mol. Cell. Biol. 31, 3326–3338.

Lu, C., Yang, W., Chen, M., Liu, T., Yang, J., Tan, P., Li, L., Hu, X., Fan, C., Hu, Z., Liu, Y.,2009a. Inhibin A inhibits follicle-stimulating hormone (FSH) action bysuppressing its receptor expression in cultured rat granulosa cells. Mol. Cell.Endocrinol. 298, 48–56.

Lu, J., Ma, Z., Hsieh, J.C., Fan, C.W., Chen, B., Longgood, J.C., Williams, N.S., Amatruda,J.F., Lum, L., Chen, C., 2009b. Structure-activity relationship studies of small-molecule inhibitors of Wnt response. Bioorg. Med. Chem. Lett. 19, 3825–3827.

MacDonald, B.T., Tamai, K., He, X., 2009. Wnt/beta-catenin signaling: components,mechanisms, and diseases. Dev. Cell 17, 9–26.

Manolagas, S.C., Almeida, M., 2007. Gone with the Wnts: beta-catenin, T-cell factor,forkhead box O, and oxidative stress in age-dependent diseases of bone, lipid,and glucose metabolism. Mol. Endocrinol. 21, 2605–2614.

McGee, E.A., Hsueh, A.J., 2000. Initial and cyclic recruitment of ovarian follicles.Endocr. Rev. 21, 200–214.

Mizusaki, H., Kawabe, K., Mukai, T., Ariyoshi, E., Kasahara, M., Yoshioka, H., Swain,A., Morohashi, K., 2003. Dax-1 (dosage-sensitive sex reversal-adrenalhypoplasia congenita critical region on the X chromosome, gene 1) genetranscription is regulated by wnt4 in the female developing gonad. Mol.Endocrinol. 17, 507–519.

Olmeda, D., Castel, S., Vilaro, S., Cano, A., 2003. Beta-catenin regulation during thecell cycle: implications in G2/M and apoptosis. Mol. Biol. Cell 14, 2844–2860.

Parakh, T.N., Hernandez, J.A., Grammer, J.C., Weck, J., Hunzicker-Dunn, M., Zeleznik,A.J., Nilson, J.H., 2006. Follicle-stimulating hormone/cAMP regulation ofaromatase gene expression requires beta-catenin. Proc. Natl. Acad. Sci. USA103, 12435–12440.

Pon, Y.L., Wong, A.S., 2006. Gonadotropin-induced apoptosis in human ovariansurface epithelial cells is associated with cyclooxygenase-2 up-regulation viathe beta-catenin/T-cell factor signaling pathway. Mol. Endocrinol. 20, 3336–3350.

Poschl, J., Grammel, D., Dorostkar, M.M., Kretzschmar, H.A., Schuller, U., 2013.Constitutive activation of beta-Catenin in neural progenitors results indisrupted proliferation and migration of neurons within the central nervoussystem. Dev. Biol. 374, 319–332.

Qu, F., Wang, F.F., Yin, R., Ding, G.L., El-prince, M., Gao, Q., Shi, B.W., Pan, H.H.,Huang, Y.T., Jin, M., Leung, P.C.K., Sheng, J.Z., Huang, H.F., 2012. A molecular

mechanism underlying ovarian dysfunction of polycystic ovary syndrome:hyperandrogenism induces epigenetic alterations in the granulosa cells. J. Mol.Med.-Jmm 90, 911–923.

Reynolds, A.B., Roczniak-Ferguson, A., 2004. Emerging roles for p120-catenin in celladhesion and cancer. Oncogene 23, 7947–7956.

Richards, J.S., Sharma, S.C., Falender, A.E., Lo, Y.H., 2002. Expression of FKHR,FKHRL1, and AFX genes in the rodent ovary: evidence for regulation by IGF-I,estrogen, and the gonadotropins. Mol. Endocrinol. 16, 580–599.

Ricken, A., Lochhead, P., Kontogiannea, M., Farookhi, R., 2002. Wnt signaling in theovary: identification and compartmentalized expression of wnt-2, wnt-2b, andfrizzled-4 mRNAs. Endocrinology 143, 2741–2749.

Rosenbluh, J., Nijhawan, D., Cox, A.G., Li, X.N., Neal, J.T., Schafer, E.J., Zack, T.I., Wang,X.X., Tsherniak, A., Schinzel, A.C., Shao, D.D., Schumacher, S.E., Weir, B.A.,Vazquez, F., Cowley, G.S., Root, D.E., Mesirov, J.P., Beroukhim, R., Kuo, C.J.,Goessling, W., Hahn, W.C., 2012. Beta-catenin-driven cancers require a YAP1transcriptional complex for survival and tumorigenesis. Cell 151, 1457–1473.

Stambolic, V., Ruel, L., Woodgett, J.R., 1996. Lithium inhibits glycogen synthasekinase-3 activity and mimics wingless signalling in intact cells. Curr. Biol. 6,1664–1668.

Sun, F., Betzendahl, I., Shen, Y., Cortvrindt, R., Smitz, J., Eichenlaub-Ritter, U., 2004.Preantral follicle culture as a novel in vitro assay in reproductive toxicologytesting in mammalian oocytes. Mutagenesis 19, 13–25.

Sunters, A., Fernandez de Mattos, S., Stahl, M., Brosens, J.J., Zoumpoulidou, G.,Saunders, C.A., Coffer, P.J., Medema, R.H., Coombes, R.C., Lam, E.W., 2003.FoxO3a transcriptional regulation of Bim controls apoptosis in paclitaxel-treated breast cancer cell lines. J. Biol. Chem. 278, 49795–49805.

Uckun, F.M., Ma, H., Zhang, J., Ozer, Z., Dovat, S., Mao, C.N., Ishkhanian, R., Goodman,P., Qazi, S., 2012. Serine phosphorylation by SYK is critical for nuclearlocalization and transcription factor function of Ikaros. Proc. Natl. Acad. Sci.USA 109, 18072–18077.

Vainio, S., Heikkila, M., Kispert, A., Chin, N., McMahon, A.P., 1999. Femaledevelopment in mammals is regulated by Wnt-4 signalling. Nature 397, 405–409.

van Amerongen, R., Nusse, R., 2009. Towards an integrated view of Wnt signaling indevelopment. Development 136, 3205–3214.

Wang, H.X., Li, T.Y., Kidder, G.M., 2010. WNT2 regulates DNA synthesis in mousegranulosa cells through beta-catenin. Biol. Reprod. 82, 865–875.

Xu, M., West-Farrell, E.R., Stouffer, R.L., Shea, L.D., Woodruff, T.K., Zelinski, M.B.,2009. Encapsulated three-dimensional culture supports development ofnonhuman primate secondary follicles. Biol. Reprod. 81, 587–594.

Yang, J.L., Zhang, C.P., Li, L., Huang, L., Ji, S.Y., Lu, C.L., Fan, C.H., Cai, H., Ren, Y., Hu,Z.Y., Gao, F., Liu, Y.X., 2010. Testosterone induces redistribution of forkhead box-3a and down-regulation of growth and differentiation factor 9 messengerribonucleic acid expression at early stage of mouse folliculogenesis.Endocrinology 151, 774–782.

Yao, H.H., Matzuk, M.M., Jorgez, C.J., Menke, D.B., Page, D.C., Swain, A., Capel, B.,2004. Follistatin operates downstream of Wnt4 in mammalian ovaryorganogenesis. Dev. Dyn. 230, 210–215.

You, H., Pellegrini, M., Tsuchihara, K., Yamamoto, K., Hacker, G., Erlacher, M.,Villunger, A., Mak, T.W., 2006. FOXO3a-dependent regulation of Puma inresponse to cytokine/growth factor withdrawal. J. Exp. Med. 203, 1657–1663.

Zhang, C.P., Yang, J.L., Zhang, J., Li, L., Huang, L., Ji, S.Y., Hu, Z.Y., Gao, F., Liu, Y.X.,2011. Notch Signaling is involved in ovarian follicle development by regulatinggranulosa cell proliferation. Endocrinology 152, 2437–2447.

Zhang, Z., Deb, A., Pachori, A., He, W., Guo, J., Pratt, R., Dzau, V.J., 2009. Secretedfrizzled related protein 2 protects cells from apoptosis by blocking the effect ofcanonical Wnt3a. J. Mol. Cell. Cardiol. 46, 370–377.

Zhao, H., Tanegashima, K., Ro, H., Dawid, I.B., 2008. Lrig3 regulates neural crestformation in Xenopus by modulating Fgf and Wnt signaling pathways.Development 135, 1283–1293.