Synthetic Biology with Cyanobacteria

Harnessing Synechocystis sp. PCC 6803 forhydrogen production

Thiyagarajan Gnanasekaran

Degree project in applied biotechnology, Master of Science (2 years), 2010Examensarbete i tillämpad bioteknik 45 hp till masterexamen, 2010Biology Education Centre and Department of Photochemistry and Molecular Sciences, UppsalaUniversitySupervisors: Dr. Thorsten Heidorn and Professor Peter Lindblad

Summary

The depletion of natural resources (e.g. fossil fuels) and anthropogenic climate change

are the major challenges of humanity today. Hence, fuel technologies that pave the way for

sustainable future are needed. One such sustainable fuel technology can be made possible by

following the photosynthetic blueprint (i.e. exploiting photosynthetic organisms to produce fuels

for the humanity). Synechocystis PCC 6803, belonging to the phylum cyanobacteria is an apt

photosynthetic model organism that can be harnessed to produce various bio-based products,

especially biofuels. The general idea of this project is to use synthetic biology approaches in

Synechocystis PCC 6803 strain for enhancing biohydrogen production - a promising biofuel for

the future.

In particular, my project centered on introducing synthetic [FeFe] hydrogenase genes

from Clostridium acetobutylicum (hydA) and Chlamydomonas reinhardtii (hydA1 and hydA2)

with/without the native ferredoxin gene attached via a linker peptide, and their respective

maturation system genes (hydE, hydF, hydG) into the cyanobacterial strains (Synechocystis PCC

6803 and, ∆HoxEF Synechocystis PCC 6803, lacking the native hydrogenase). All the genes

were codon optimized and developed as a synthetic construct by cloning under strong promoters

(Trc1 or Trc2) and ribosome binding sites (BB_0034), which have already been characterized in

cyanobacterial strain [60]. Initial hydrogen evolution measurements of mutant cyanobacteria

(carrying only hydrogenase constructs), using Clark type hydrogen electrode, indicated no

hydrogen evolution, although the western blotting results of the same mutant strains confirmed

the expression of hydrogenase genes. Furthermore, an experiment to prove the importance of

maturation system genes to make the hydrogenase enzymes biologically active was carried out in

E. coli BL21 (DE3) strain and a similar kind of approach was proposed for the cyanobacterial

strains to produce hydrogen.

Index

3

3

3

4

6

6

7

7

8

8

9

12

14

14

14

14

16

16

16

16

18

19

19

21

23

24

1. Introduction

1.1 Global warming and alternate energy

1.2 Hydrogen production methods

1.3 Hydrogenases

1.4 Cyanobacteria

1.5 Synthetic biology 2. Results

2.1 Cloning of the synthetic hydrogenase and maturation genes under synthetic promoters in E. coli

2.2 Transformation of Synthetic hydrogenase genes in cyanobacteria

2.3 Hydrogen evolution measurement in cyanobacteria and E. coli (NEB5α) strains

2.4 Confirmation of Synthetic hydrogenase expression in cyanobacteria and E. coli (NEB5α) by Western blotting

2.5 Hydrogen measurement in E. coli BL21 (DE3) cells possessing both the hydrogenase and maturation system genes.

3. Discussion

3.1 Repository of Hydrogenase and Maturation genes under synthetic promoters

3.2 Confirmation of synthetic foreign hydrogenase genes expression in cyanobacteria and E. coli.

3.3 Introduction of hydrogenase and maturation system constructs

4. Materials and methods

4.1 Bacterial strains, plasmids and synthetic genes

4.2 Growth conditions

4.3 Plasmid isolation and cloning

4.4 Polymerase chain reactions and DNA sequencing

4.5 Transformation into cyanobacteria by triparental mating method

4.6 Hydrogen measurements

4.7 Protein extraction and western blotting

5. Acknowledgement

6. References

2 

 

3 

 

1. Introduction

1.1 Global warming and alternate energy

Steven Chu, the current United States secretary of energy, addressed the need for renewable

energy by saying that “Necessity is the mother of invention and this is the mother of all

necessities” in an interview in the journal Nature [1]. Today, the need for renewable energy

technologies is the foremost challenge to humanity due to the continuing explosion of the human

population and anthropogenic climate change. The United Nations estimates the current

population to be 6.8 billion (2009) and by 2050 Earth will see a 47% increase in human

population corresponding to 8.9 billion people globally [2]. This predicted human population

explosion without renewable energy technology will be a major threat to this planet due to the

increasing levels of carbon dioxide (CO2) in Earth’s atmosphere. This was evidently confirmed

by J. Hansen and his colleagues in 1981, they predicted that given the more use of non-fossil fuel

technologies than the fossil fuel technologies in a realistic way, the 21st century will see 2.5˚C

(Celsius) increase in global temperature [3]. Increasing levels of CO2 is also clear from the

reports of Intergovernmental Panel on Climate Change (IPCC) and National Oceanic and

Atmospheric Administration (NOAA) in the United States, which show that the pre-

industrialized level of CO2 was around 280 parts per million by volume (ppmv) and the present

concentration is around 391 ppmv which is more than the accepted upper safety benchmark of

350 ppmv [4, 5]. Thus without a doubt, carbon free technologies that produce renewable energy

are the need of the day. In the current scenario, the carbon free renewable energy technologies

that are under development are nuclear fusion, photovoltaics and photoelectrochemical cells,

hydroelectricity, wind energy, and hydrogen-based technologies [6]. Above all, the ideal being

the hydrogen based technology because of the high energy content and the eco- friendly property

of hydrogen. [7]. Although hydrogen based technologies have a great scope for the future, they

are far-off from commercialization because of their shortcomings in terms of efficient production

methods, storage, transportation, cost, and adaptability [8, 43].

4 

 

1.2 Hydrogen production methods

Though hydrogen is the most abundant element in the universe, industrial production of

hydrogen at commercial-scale is a big challenge. At present, the catalytic steam reforming

method is the only economically feasible means of producing hydrogen at the industrial scale

[9]. However, the emission of hazardous gases like CO2, and, SO2 during the manufacturing

process makes catalytic steam reforming method less environment friendly. On the other hand, a

similar steam reforming method using ethanol apears to be eco- friendly, but not economically

viable [10, 12]. Other methods for hydrogen production in the research pipeline are electrolysis,

plasmolysis, magnetolysis, the thermochemical method, the photochemical method, biological

methods, pyrolysis, the photocatalytic method and the photoelectrochemical method. All these

methods are classified on the basis of the raw materials (water, biomass or fossilfuels) used to

produce hydrogen [11, 12, 13]. Due to the abundance of water in the earth’s atmosphere, the

technologies that make use of water as a raw material gain an advantage over other methods that

uses biomass or fossil fuels. At present, technologies in development that use water as the raw

material and work on the principle of splitting water to produce hydrogen, are solar water

thermolysis, the nuclear thermochemical method, eletrolysis, the photocatalytic method and

photobiological methods [14, 15, 16]. To split water and produce hydrogen, the former three

methods need energy input in the form of electricity or heat, which is a severe drawback, and the

later two methods use light to split water, which is a big advantage due to the enormous amount

of solar energy (5.7 × 1024 J per year) reaching the Earth’s surface [17]. Taken into account, the

continuing advancement of molecular biology and bioprocess engineering puts the

photobiological method ahead of the photocatalytic method. Generally, the photobiological

method involves the use of photosynthetic microbes, or combinations of photosynthetic and non-

photosynthetic microbes, to produce hydrogen. Photobiological methods involve only

photosynthetic organisms and are classified under direct biophotolysis, indirect biophotolysis

and photo-decomposition of organic compounds by photosynthetic bacteria, while the hybrid

system involves combinations of photosynthetic and non-photosynthetic microrganisms using

fermentative-photosynthetic metabolic combinations [13, 17, 18, 19]. Virtually, all these

photobiological method employ family of enzymes known as hydrogenases and to some extent,

nitrogenases for the production of hydrogen [20, 39].

1.3 Hydrogenases

Hydrogenases, common metallo-proteins existing among different phototrophic and

chemotrophic organisms, are capable of oxidizing and reducing hydrogen [21].

2H+ + 2e- H2 [24]

In nature hydrogenase enzymes exists in three different forms, based explicitly on the metal ion

composition in the active site; [FeFe]-H2ases, the [NiFe]-H2ases, and the Fe - H2ases. These

three different hydrogenases also differ in the nature of their electron donors/acceptors

(Nicotinamide adenine dinucleotide (NAD), cytochromes, coenzyme F420 and ferredoxins) and

their cellular localization (cytoplasm, membrane or periplasm) [21]. Though, the significance

behind different metal ions in the active site and electron donors/acceptors of these enzymes are

ambiguous, based on the cellular localizations, the hydrogenases plays three important roles; to

act as a switch that controls redox potential, to carry out oxidation of molecular hydrogen to

recover energy, or to control the proton gradient across the membranes [21, 22]. Taking into

account, the hydrogenases with different metal ion composition in the active site, the [FeFe]-

H2ases and [NiFe]-H2ases are the most abundant hydrogenases in microbes. They are of special

interest for biohydrogen research, as the former is found to have high production rate and the

later is found to have less sensitivity to molecular oxygen, which inactivates the enzyme [22, 23].

However, the high sensitivity to molecular oxygen of [FeFe]-H2ases and the low productivity

[NiFe]-H2ases are the limitations that restrict these enzymes from industrial applications. To

overcome these limitations, understanding the intricacies in its structures are vital, which

demands for the resolved crystal structures of these enzymes. So far, crystal structures of five

[NiFe]-H2ases and two [FeFe]-H2ases are resolved. The resolved [NiFe]-H2ases are from the

organisms Disulfovibrio (D) gigas [25], D. vulgaris [26], D. desulfuricans [27], D.

fructosovorans [28] and Desulfomicrobium baculatum [29] and the [FeFe]-H2ases are from C.

pasteurianum and D. desulfuricans [ 30, 31].

5 

 

Figure 1: Crystal structure of [NiFe] Hydrogenase from D.gigas and [FeFe] Hydrogenase from

D.desulfuricans depicting the picture of active site. The larger subunit portrayed in green and the smaller

subunit portrayed in blue [23].

On the other hand, regardless of the structural details, approaches like hetrologous expression of

foreign hydrogenases, genetic engineering of native hydrogenases and invitro studies of

immobilized hydrogenase on various substrates are also being carried out in parallel [32, 33, 34,

35]. In the case of hetrologous expression studies of highly productive [FeFe]-H2ases from the

organisms Chlamydomonas reinhardtii, Clostridium acetobutylicum, Clostridium

saccharobutylicm, Thermotoga maritima, E. coli is often used due to its high degree of

adaptability [36, 37]. However, the requisite for sugars to grow E. coli is a drawback, which

demands for the photosynthetic organisms that do not require sugars for its growth [32, 38, 39].

Among the myriad photosynthetic microorganisms in nature, cyanobacteria are the ultimate

candidates for the manufacture of desired products due to their ubiquity, easy culturing

conditions in the lab, and, most importantly, the genome of at least 38 strains are already

sequenced making their cellular mechanisms explicable to larger extent [41, 42]. The use of

6 

 

7 

 

cyanobacteria for various industrial processes is also evident with the increasing number of

patents filed on engineered cyanobacteria [48, 49].

1.4 Cyanobacteria

Cyanobacteria encompass enormous diversity among the photosynthetic microbes and are the

major provider of molecular oxygen in the earth’s atmosphere [45]. The fossil record data assert

the existence of cyanobacteria (stromatolites) ~3465 million years ago (mya). These

stromatolites are the pioneers of oxygenic photosynthesis, which played a central role in

converting an anoxic environment to the oxic environment of the primitive earth [44]. Based on

the morphology and 16s rRNA sequences, cyanobacteria are classified into five subsections

(Chroococcales, Pleurocapsales, Oscillatoriales, Nostocales and Stigonematales) and every

subsection is further classified into numerous species [46, 47]. Of all the different species,

Synechocystis spp and Synechococcus spp (of the subsection Chroococcales), gain special

attention over other cyanobacteria for the studies related to production of renewable fuels,

metabolites, etc. due to their unicellular nature and faster growth rate [50, 51]. Presence of

[NiFe] hydrogenase enzymes that is capable of producing hydrogen in these cyanobacteria is an

additional advantage [40]. However, the low productivity of the native [NiFe] hydrogenases,

their bidirectional nature, and the ambiguous information about their role in cellular metabolism

limit the exploitation of these organisms for hydrogen production at the industrial scale [52, 53,

54]. In light to these problems, studies into hetrologous expression of highly productive foreign

hydrogenases and, metabolic engineering of hydrogen –yielding pathways are already being

carried out [32, 55]. However, the hetrologous expression of foreign genes and metabolic

engineering are not trouble-free tasks, due to problems like codon usage of the native organisms,

transcriptional and translational control and regulation, etc. Thanks to the emergence of synthetic

biology approaches many of the complex obstacles involved in molecular biology and genetic

engineering can be overcome [56, 57].

1.5 Synthetic biology

Synthetic biology follows the “bottom-up” approach in biology unlike conventional molecular

biology approaches that operates in a “top-down” manner. To put it more explicitly, synthetic

8 

 

biology deals with designing and concatenating different biological parts (Genes, Promoters,

Ribosome binding sites, transcriptional regulators, etc,) to build complete biological systems

similar to building an electronic instrument like a computer, with different physical layers

(integrated chips, transistors, capacitors, resistors etc). In contrast, the conventional molecular

biological approaches deal with the exploration of pathways and cellular mechanisms, which are

already available in the biological systems [57, 62]. A handful of successful projects that used

synthetic biology approaches are already reported. Two of the notable works are 1) the design of

synthetic multicellular prokaryotic and eukaryotic systems performing programmed pattern

fomation as a result of quorum sensing and intracellular signalling [63] and 2) the successful

cloning of synthetic genomes of Mycoplasma genitalium (0.6 Mega bases (Mb)), M. pneumoniae

(0.8 Mb) and M. mycoides subspecies capri (1.1 Mb) into yeast by Benders et al., 2010 [64].

Consequently, this synthetic biology approaches can also be very well applied to the renewable

fuel production using microrganisms, especially in designing synthetic minimal photosynthetic

microorganisms that are capable of producing renewable fuels [65, 66]. Hence, my project is one

such study that aimed at using synthetic biology approaches in photosynthetic bacteria to test for

the production of molecular hydrogen. In particular, my project focused on introducing synthetic

hydrogenase and its maturation system genes under synthetic promoters and ribosome binding

site in cyanobacterial strains (Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC

6803) to test for the production of molecular hydrogen.

9 

 

2. Results:

2.1 Cloning of the synthetic hydrogenase and maturation genes under synthetic promoters

in E. coli

Initially all the cloning experiments were tried using E. coli DH5α, E. coli JM107, E. coli BL21

(DE3) and E. coli (NEB5α) strains. Of all the strains, only E. coli (NEB5α) strain proved

efficient for cloning, as the other strains had problems with accumulating mutations in the

promoter or in the genes and also showed much lower cloning efficiency. By using E. coli

(NEB5α) strain, the synthetic hydrogenase genes from Chlamydomonas reinhardtii (hydA1 and

hydA2) with and without native ferredoxin gene and synthetic hydrogenase gene (hydA) of

Clostridium acetobutylicum without the native ferredoxin gene were successfully cloned under

the hybrid Trc promoter with one/two lac operators (Trc1/Trc2) in any of the plasmids

(pPMQAK1, pSB1AC3, pPMQAC1, pSB1A3, pSB1AK3). The maturation system genes

(hydEF, hydG) of Chlamydomonas reinhardtii and Clostridium acetobutylicum (hydE, hydF,

hydG) were also successfully cloned under Trc1 and Trc2 promoters in plasmids pSB1AC3. The

confirmation of successful cloning in E. coli (NEB5α) cells was performed using cPCR (colony

polymerase chain reaction) and DNA sequencing with the help of primers Vf2 and Vr (Table 2).

For convinience, the hydrogenase genes from C.reinhardtii cloned under the Trc1/Trc2

promoters were named as Trc1 hydA1 + fd, Trc1 hydA2+ fd, Trc2 hydA1+ fd (hydrogenase

gene linked to the native ferredoxin gene) and Trc1 hydA1, Trc1 hydA2, Trc2 hydA1

(hydrogenase gene without the native ferredoxin gene linked) and similarly the hydrogenase

constructs of C. acetobutylicum was named as Trc1 hydA+fd, Trc2 hydA+fd (Hydrogenase gene

is linked to the native ferredoxin gene) and Trc1 hydA, Trc2 hydA (hydrogenase gene without

the native ferredoxin gene linked). Likewise, the maturation system genes of C. reinhardtii and

C. acetobutylicum cloned under Trc1 and Trc2 promoters were named as Trc1MatCr, Trc2MatCr

and Trc1MatCa, Trc2MatCa. Though building most of construct combination are succesful,

attempts to combine the hydrogenase constructs with the maturation system constructs in the

same plasmids (pPMQAK1, pSB1AC3, pSB1AK3) were not successful.

10 

 

Table 1: Overview of the sequence confirmed constructs in the respective plasmids

Successfully cloned constructs in E. coli

(NEB5α)

Present in the Plasmid

Trc1 HydA1 + fd pPMQAK1

Trc2 HydA1 + fd pPMQAK1 pSB1AC3

Trc1 HydA1 pPMQAK1, pSB1AC3

Trc1 HydA2 + fd pPMQAK1, pSB1AC3

Trc1 HydA2 pPMQAK1

Trc1 HydA + fd Ns*

Trc1 HydA pSB1AC3

Trc2 HydA pSB1AC3

Trc2 Matcr pSB1AC3, pSB1AK3, pPMQAK1,

pPMQAC1

Trc1 Matca pSB1AC3, pSB1AK3, pPMQAK1,

pPMQAC1

Trc2 Matca pSB1A3

(Ns* -Not succeeded with cloning)

2.2 Transformation of Synthetic hydrogenase genes in cyanobacteria

Successfully cloned hydrogenase constructs (Trc1 hydA1 + fd, Trc1 hydA2+ fd, Trc1 hydA1,

Trc1 hydA2) in the plasmid pPMQAK1 using E. coli NEB5α strains were transformed to

cyanobacterial strains (Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC 6803) by

employing the triparental mating method. For confirmation of positive clones, the colonies of

mutant cyanobacterial strains in the BG11 agar plates supplied with 50µg/ml kanamycin were

screened by performing cPCR with the primers Vf2 and Vr. The cPCR reaction mixtures were

run in 1X agarose gel electrophoresis with the positive control (cPCR reaction of E. coli NEB5α

strains containing the respective constructs in the plasmid pPMQAK1) [Figure 2]. The band size

corresponding to Trc1hydA1 +fd in addition to the flanking region between the primer binding

site was around 2.2Kb (Trc1= 63bp, hydA1 -1824 bp and the flanking regions-316 bp) and band

Size corresponding to Trc1hydA2 +fd was around 2.27 Kb (Trc1 – 63bp, hydA2 -1836 bp and

the flanking regions -316 bp). One of the positive clones was selected and inoculated in 50 ml of

BG11 media suppiled with 50µg/ml kanamycin for future experiments.

Figure 2: 1x agarose gel picture showing the cPCR results of Synechocystis sp.PCC 6803 (syn wt) and ∆Hox Synechocystis sp.PCC 6803 (syn hox) confirming the presence of plasmid pPMQAK1 carrying Trc1HydA1+Fd and Trc1HydA2+Fd constructs. The positive controls (+ve controls) are cPCR of E. coli (NEB5α) strains containing plasmid pPMQAK1 with the respective constructs.

11 

 

12 

 

2.3 Hydrogen evolution measurement in cyanobacteria and E. coli (NEB5α) strains

The hydrogen evolution measurements were carried out for the liquid cultures of mutant and

wild type cyanobacterial cells by employing a methyl viologen assay, using Clark type hydrogen

electrode [Figure 3]. The graph displays two collective plots obtained for Synechocystis sp.PCC

6803 and ∆Hox Synechocystis sp.PCC 6803 with and without the constructs (Trc1 hydA1 + fd,

Trc1 hydA2+ fd, Trc1 hydA1, Trc1 hydA2). The controls, Synechocystis sp.PCC 6803 without

any of the constructs demonstrated a change in voltage (Y-axis) corresponding to the evolution

of hydrogen by native [NiFe]- H2ases, and ∆Hox Synechocystis sp.PCC 6803 culture without

any of the constructs demonstrated no change in the voltage confirming the absence of native

[NiFe]- H2ases. The plots corresponding to Synechocystis sp.PCC 6803 carrying different

constructs (Trc1 hydA1 + fd, Trc1 hydA2+ fd, Trc1 hydA1, Trc1 hydA2) in the plamid

pPMQAK1 displayed voltage changes like the control, illustrating no change in hydrogen

evolution due to the introcuced hydrogenase constructs. Similarly, plots corresponding to ∆Hox

Synechocystis sp.PCC 6803 carrying different constructs (Trc1 hydA1 + fd, Trc1 hydA2+ fd,

Trc1 hydA1, Trc1 hydA2) displayed no voltage changes like the control, reiterating that the

introduced constructs are not actively producing hydrogen. Similar measurements were also

performed for wild type and mutant E. coli (NEB5α) cells carrying the constructs in plasmid

pPMQAK1. Like the results of cyanobacterial cells, the hydrogen evolution measurement of the

mutant strains of E. coli (NEB5α) were similar to wild type E. coli (NEB5α) confirming that

there is no change in the hydrogen evolution due to the introduction of the hydrogenase

constructs (Graph not shown).

Figure 3: Hydrogen evolution measurements of Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC 6803 performed with the Clark-Type Hydrogen electrode. The minor drift corresponding to the ∆Hox Synechocystis sp.PCC 6803 plot is due to the background drift. The experiment setup and measurement was a joint effort from me and Sean Gibbons.

2.4 Confirmation of Synthetic hydrogenase expression in cyanobacteria and E. coli

(NEB5α) by Western blotting

In order to determine whether or not the hydrogenase genes are expressed in the mutant

cyanobacterial cells and E. coli (NEB5α), Western blot analysis with the polyclonal antibodies

which are specific to both HydA2 and HydA1 proteins of C.reinhardtii was carried out [Figure

4]. A coomassie stained SDS-PAGE is also shown to verify the uniformity in the pattern of

protein separation of various samples. Figure 4a displays the western blot and coomassie

staining run with 5 µg of total protein extract in SDS-PAGE. The lanes corresponding to

Trc1HydA2+fd for both the Synechocystis PCC 6803 and ∆Hox Synechocystis PCC 6803 strains

showed bright signal for western blot at the size of 61 kilodaltons (kDa), which is exactly the

size of HydA2 + ferredoxin (51 kDa +10 kDa). In contrast, the lanes 3, 5 and 7, 9 corresponding

to Trc1HydA1+fd and Trc1HydA1 of Synechocystis PCC 6803 and ∆Hox Synechocystis PCC

6803 showed very faint signal. With the aim of visualizing bright signal for Trc1HydA1+fd and

13 

 

Trc1HydA1, western blotting was performed with same amount of total protein extract with

more stringent washing steps and prolonging primary antibody incubation step for overnight at

4˚C, and secondary antibody incubation step for 3-4 hours instead of 1 hour at room temperature

[Figure 4b]. This lead to a lot of unspecific signals, even for the protein extracts from wildtype

(lane 2 and 8). In light to this problem, and to reconfirm whether the antibodies are working

against HydA1 proteins, western blotting was also carried out for the protein extracts of wild

type and mutant E. coli (NEB 5α) cells [Figure 5]. The results reiterated the antibodies were

only efficient against Trc1HydA2+fd (lane 5) and Trc1HydA2 (lane 6), but not against

Trc1HydA1+fd (lane 3) and Trc1HydA1 (lane4). Regardless of the unspecifity of the antibody to

HydA1 proteins, the positive signal for all the HydA2 constructs is a proof that the constructs

Trc1HydA2+fd and Trc1HydA2 were transcribed and translated.

a)

kDa

250

130

100

70

55

35

27

15

10

14 

 

Figure 4a: Coomassie staining (left) of SDS- PAGE and Western blot analyses (right) of mutant and wild type cyanobacterial strains (Synechocystis PCC 6803 and ∆Hox Synechocystis PCC 6803). Lane 1- ladder (Coomassie staining) and Synechocystis PCC 6803 wildtype (Wetern blot), Lane 2- Synechocystis PCC 6803 wildtype (Coomassie staining) and ladder (Wetern blot), Lane 3- Synechocystis PCC 6803 (Syn) with Trc1hydA1+fd, Lane 4- Syn Trc1hydA2+fd, Lane 5- Syn Trc1hydA1, Lane 6- ∆Hox Synechocystis PCC 6803 wildtype, Lane 7- ∆Hox Synechocystis PCC 6803 (∆HoxSyn) with Trc1hydA1, Lane 8- ∆HoxSyn Trc1hydA2, Lane 9- ∆HoxSyn Trc1hydA1, Lane 10- Chlamydomonas reinhardtii positive control

b)

kDa

250

130

100

70

55

35

27

15

10

15 

 

Figure 4b: Coomassie staining (left) of SDS- PAGE and Western blot analyses (right) of mutant and wild type cyanobacterial strains (Synechocystis PCC 6803 and ∆Hox Synechocystis PCC 6803). Lane 1 – ladder, Lane 2 – Synechocystis PCC 6803 wildtype, Lane 3- Synechocystis PCC 6803 (Syn) with Trc1hydA1+fd, Lane 4- Syn Trc2hydA1+fd, Lane 5- Syn Trc1hydA2+fd, Lane 6- Syn Trc1hydA1, Lane 7- Syn Trc2hydA1, Lane 8- ∆Hox Synechocystis PCC 6803 wildtype, Lane, 9- ∆Hox Synechocystis PCC 6803 (∆HoxSyn) with Trc1hydA1, Lane 10- ∆HoxSyn Trc2hydA1.

kDa

250

130

100

70

55

35

27

15

10

Figure 5: Western blot analyses of protein extracts from E. coli (NEB5α) cells with and without the hydrogenase constructs in the plasmid pPMQAK1. The ladder was moved up during the overlapping of

16 

 

bloting and ladder picture, which makes the signal displayed lower than expected. Lane 1- ladder, Lane 2- E. coli (NEB5α) wild type, Lane 3- Trc1HydA1 + fd in E. coli (NEB5α), Lane 4 - Trc1HydA1in E. coli (NEB5α), Lane 5 - Trc1HydA2 + fd in E. coli (NEB5α), Lane 6 - Trc1HydA2 in E. coli (NEB5α).

2.5 Hydrogen measurement in E. coli BL21 (DE3) cells possessing both the hydrogenase

and maturation system genes.

With respect to the previous results, an alternative approach was carried out by introducing

maturation system constructs with hydrogenase constructs in E. coli BL21 (DE3) as a proof of

concept. The hydrogenase constructs (Trc1 hydA1 + fd, Trc1 hydA2+ fd, Trc1 hydA1, Trc1

hydA2) in the plasmid pPMQAK1 was transformed with and without Maturation system

constructs (Trc1MatCa and Trc2MatCr) that are in Plasmid pSB1AC3 in E. coli BL21 (DE3).

For performing hydrogen measurement, E. coli BL21 (DE3) cells carrying hydrogenase

constructs in Plasmid pPMQAK1 and any one of the maturation system constructs in pSB1AC3

were grown in LB + 20mM glucose supplied with both the antibiotics (50µg/ml Kanamycin and

50µg/ml Chloramphenicol) to make sure the selection pressure of both the plasmids was

maintained. All the hydrogen evolution measurements were carried out using Gas

chromatography. The results indicated no hydrogen evolution from Wildtype E. coli BL21 (DE3)

and mutant E. coli BL21 (DE3) cells carrying only the hydrogenase constructs (Trc1 hydA1 + fd,

Trc1 hydA2+ fd, Trc1 hydA1, Trc1 hydA2). On contrary, the mutant E. coli BL21 (DE3)

carrying both hydrogenase and maturation system constructs produced hydrogen. Further, to test

the significance of linked ferredoxin and different maturation system, the rate measurement of

different hydrogenase constructs with/without linked feredoxin with any of the maturation

system constructs (Trc1MatCa or Trc2MatCr) were carried out [Figure 6A, 6B].

A)

Trc1hydA1+fd_pPMQAK1

Trc1Matca_pSB1AC3

Trc1hydA1_pPMQAK1

Trc1Matca_pSB1AC3

Trc1hydA2+fd_pPMQAK1

Trc1Matca_pSB1AC3

Trc1hydA2_pPMQAK1

Trc1Matca_pSB1AC3

Figure 6A: Bar graph displaying the difference in the rate of hydrogen evolution with in different

combination of constructs (Trc1hydA1 + fd_pPMQAK1 and Trc1MatCa_pSB1AC3, Trc1hydA1_pPMQAK1

and Trc1MatCa_pSB1AC3, Trc1hydA2 + fd_pPMQAK1 and Trc1MatCa_pSB1AC3,

Trc1hydA2_pPMQAK1 and Trc1MatCa_pSB1AC3) in E. coli BL21 (DE3) cells. In X-Axis the names of

different combination of constructs are mentioned and Y-Axis represents the rate of Hydrogen evolution

measured per OD per minute. Values correspond to means ± standard deviation (n=3).

17 

 

B)

Trc1hydA1+fd_pPMQAK1

Trc2Matcr_pSB1AC3

Trc1hydA1_pPMQAK1

Trc2Matcr_pSB1AC3

Trc1hydA2+fd_pPMQAK1

Trc2Matcr_pSB1AC3

Trc1hydA2_pPMQAK1

Trc2Matcr_pSB1AC3

Figure 6B: Bar graph displaying the difference in the rate of hydrogen evolution with in different

combination of constructs (Trc1hydA1 + fd_pPMQAK1 and Trc2MatCr_pSB1AC3, Trc1hydA1_pPMQAK1

and Trc2MatCr_pSB1AC3, Trc1hydA2 + fd_pPMQAK1 and Trc2MatCr_pSB1AC3,

Trc1hydA2_pPMQAK1 and Trc2MatCr_pSB1AC3) in E. coli BL21 (DE3) cells. In X-Axis the names of

different combination of constructs are mentioned and Y-Axis represents the rate of Hydrogen evolution

measured per OD per minute. Values correspond to means ± standard deviation (n=3).

From the bar graphs, it is comprehensible that with the introduction of any of the maturation

system constructs (Trc1MatCa and Trc2MatCr), the construct (Trc1hydA1+fd) that have linked

ferredoxin showed lesser rate of hydrogen evolution than the construct (Trc1hydA1) without the

linked ferredoxin. While in the case of hydA2 constructs (Trc1hydA2+fd, Trc1hydA2), the

significance of linked feredoxin is not clear due to the larger error bars, which are falling more or

less in the same range. To get more precise data for the hydA2 constructs, increasing the number

18 

 

19 

 

of biological replicates (n=3) by two or three times are needed. Most importantly, the hydrogen

measurement is a proof of concept to verify that all the construct combinations are working,

regardless of the hydrogen evolution rate by different combination of hydrogenase constructs

with different maturation system constructs.

20 

 

3. Discussion

3.1 Clone library of Hydrogenase and Maturation genes under synthetic promoters

One aim of this work was to establish a repository of hydrogenase and maturation system genes

of Chlamydomonas reinhardtii and Clostridium acetobutylicum cloned under Trc1 or Trc2

promoter in the plasmid pPMQAK1 that work in cyanobacteria and in plasmids pSB1AC3,

pSB1A3 and pSB1AK3 that work in E. coli. Though most of the construct combinations were

finished successfully, attempts to clone the hydrogenase gene (hydA) from Clostridium

acetobutylicum with the native ferredoxin gene under the promoters (Trc1 and Trc2) in E. coli

were not successful. The sequencing results of the cloned constructs showed accumulation of

mutations in the promoter and sometimes in the hydrogenase gene itself. The exact reason

behind the accumulation of mutations is not known. Similarly, attempts to combine hydrogenase

constructs and maturation system constructs in plasmids pPMQAK1 and pSB1AC3 were also not

successful. The expected reason behind this problem is that these plasmids may have an upper

cut-off for insert size (~ 6 Kb) that can be ligated into them. As the hydrogenase (~2kb) and

maturation system constructs (~ 4 -5.5 kb) add up to ~6-8 kb combined, this may be the

restricting feature. In such a case, vectors like bacterial artificial chromosomes or cosmids that

can hold larger size fragments are to be tested. However, finding bacterial artificial

chromosomes or cosmids that currently work in cyanobacterial strains is highly unlikely.

Regardless of above mentioned hurdles, the efficient cloning strain (E. coli NEB5α) and

optimized methods to work with highly active synthetic genes and promoters was successfully

established. In addition, all the constructs that were successfully cloned in E. coli were

transformed to cyanobacterial strains (Synechocystis PCC 6803 and ∆Hox Synechocystis PCC

6803) and a repository was created. Summing up, the established working method and the

repository will be of great use in the future to proceed with further experiments like performing

growth optimization of these mutant organisms in photobioreactors, introducing other

hydrogenase genes, etc.

21 

 

3.2 Confirmation of synthetic foreign hydrogenase gene expression in cyanobacteria and E.

coli.

The absence of hydrogen evolution from the mutant strains of E. coli NEB5α and cyanobacterial

strains raised doubts concerning the expression of the hydrogenase genes under synthetic

promoters. It was clarified by performing western blot of the protein extracts from the mutant

strains of E. coli and cyanobacteria against polyclonal antibodies specific against HydA1 and

HydA2 proteins of Chlamydomonas reinhardtii. The results proved the expression of HydA2

proteins with and without native ferredoxin gene in both cyanobacteria and E. coli, although the

signals in the Western blot for HydA1 proteins were negative. As both the hydA1 and hydA2

genes were constructed in the same way, it makes one consider that the hydA1 genes should also

be expressed. However, to visualize positive signal for HydA1 proteins in Western blot,

optimizing the running conditions or running western blot with purified HydA1 proteins may be

the key and they are of future interest.

3.3 Introduction of hydrogenase and maturation system constructs into E. coli and

cyanobacteria

From the western blot results, it is understood that the hydrogenase genes in the plasmid

pPMQAK1 are expressed in both E. coli and cyanobacteria. In contrast, from the hydrogen

evolution measurement results, it is feasible that even though the hydrogenase genes are

expressed, the protein is not biologically active to produce hydrogen. In light to this problem,

King et.al., argues that the polypeptide sequences of [Fe-Fe] hydrogenase enzymes after

translation need to undergo post-translational modifications to be biologically active, making the

introduction of maturation system genes essential [37]. As mentioned earlier, due to the

difficulty in combining maturation system constructs and hydrogenase constructs in the plasmid

pPMQAK1, an approach of introducing hydrogenase construct and maturation system construct

that are in two different plasmids (pPMQAK1 and pSB1AC3) was performed and proved

successful in E. coli BL21 (DE3). This same kind of approach is also tried for cyanobacteria. As

pPMQAK1 is the only available biobrick-compatible plasmid found to work in cyanobacteria,

22 

 

the kanamycin resistance casette was removed by digesting with AseI (VspI) restiction enzyme

and ligated with the chloromphenical resistance cassette amplified from plasmid (pSB1AC3)

using VSPCM.F and VSPCM.R primers. This new plasmid is named pPMQAC1 for

convinience. Attempt to clone Trc2MatCr into the new plasmid (pPMQAC1) were successful

and it was transformed into the mutant cyanobacterial strains carrying hydrogenase constructs in

plasmid pPMQAK1, while the cloning of Trc2Matca in the new plasmid was not successful and

is under development. Also, another approach of cloning both Trc2MatCr and Trc2MatCa in the

integrative plasmid pGDYH_NS that is capable of recombining these inserts into the genome is

also under development and is interest for the future work. Hydrogen evolution from the mutant

cyanobacterial cells is expected in the near future provided the above-mentioned approaches

work successfully.

23 

 

4. Materials and methods:

4.1 Bacterial strains, plasmids and synthetic genes

Synechocystis sp.PCC 6803 was obtained from the Pasteur culture collection (PCC), Paris,

France. ∆Hox Synechocystis sp.PCC 6803 (lacking native bidirectional hydrogenase) was kindly

provided by Paula Tamagnini group at Instituto de Biologia Molecular e Celular, Universidade

do Porto, Porto, Portugal. Escherichia coli NEB5α [fhuA2 Δ(argF-lacZ)U169 phoA glnV44

Φ80Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17] was used as a host for all the cloning

work and was obtained from New England Biolabs. Escherichia coli BL21 (DE3) [F– ompT gal

dcm lon hsdSB (rB- mB

-) λ (DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5] was used as a host for

hydrogen measurement. Escherichia coli HB101 [F- mcrB mrr hsdS20(rB- mB

-) recA13 leuB6

ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ-] carrying plasmid pRL443 [58]

was used as strain to carry out triparental mating with both the wild type and ∆Hox Synechocystis

sp.PCC 6803. All the cloning works in E. coli were carried out with the synthetic biology

plasmids pSB1A3 [59], pSB1AC3 [59], pPMQAK1 [60] and pPMQAC1. The expression studies

and hydrogen measurement were carried out using the plasmids pSB1AC3 and pPMQAK1 in E.

coli and pPMQAK1 in Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC 6803. The

integrative plasmid pGDYH_NS used for integrating maturation system genes (Trc2MatCa and

Trc2MatCr) into the genome of Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC

6803 was kindly provided by Paula Tamagnini group at Instituto de Biologia Molecular e

Celular, Universidade do Porto, Porto, Portugal. All the plasmids had the biobrick interface

possesing the restriction sites for the enzymes EcoRI, XbaI as the prefix and PstI, SpeI as the

Suffix. All the hydrogenase (hydA1, hydA2 and hydA) and maturation system genes (hydE,

hydF, hydG) were designed and kindly delivered by Jaramillo group at École Polytechnique in

Palaiseau, France. The well established synthetic Trc promoters with one and two lac operators

and synthetic ribosome binding site (BB_0034) in cyanobacteria were used to express the

hydrogenases and maturation systems genes [60].

24 

 

4.2 Growth conditions

Throughout this study Synechocystis sp.PCC 6803 and ∆Hox Synechocystis sp.PCC 6803 was

grown in BG11 media [61] with/without agar (10g/l) based on the need. The BG11 media for

growing mutant strains carrying plasmid pPMQAK1 with the constructs (Trc1HydA1,

Trc1HydA2, Trc1HydA1+ fd, Trc1HydA2+ fd) and pPMQAC1 with the construct (Trc2Matcr)

were supplemented with 50µg/ml Kanamycin and 50µg/ml Chloramphenicol. All the E. coli

strains were grown aerobically at 37˚C in super optimal broth (5 g yeast extract, 20 g tryptone,

0.584 g NaCl, 0.186 g KCl, 2.4 g MgSO4 )/liter of deionized water supplemented with 20mM

glucose with/without agar (10g/l) based on the need. When needed E. coli strains were grown in

SOC media supplemented with 50µg/ml Kanamycin, 50µg/ml Chloramphenicol, and 100µg/ml

Ampicillin.

4.3 Plasmid isolation and cloning

Plasmid isolations were usually carried out using GeneEluteTM Plamid prep kit (Sigma Aldrich)

for the overnight culture of E. coli grown in 37˚c shaking at 250 RPM (revolutions per minute)

The concentrations of plasmid DNA were measured using Cary 100 UV-Vis spectrophotometer

(Varian Inc). For cloning, all the restriction digestions were carried out using FastDigestTM

enzymes (Fermentas) and ligations were carried out using QuickLigaseTM (NewEngland

Biolabs). All the digestion and ligation experiment reaction mixtures were prepared according to

the manufacturer’s instructions. All the digestion reactions are carried out at 37˚C for 30 minutes

and the digested fragments are directly purified or agarose gel purified using Nucleospin® PCR

cleanup and gel extraction kit (Clonetech laboratories Inc). All the agarose gels were run in 1 %

w/v agarose (Sigma Aldrich) in 1X sodium borate buffer (1.9 g of sodium borate decahydrate

and 1.65 g of boric acid in 1L of deionized water) at 200 Volts for 15-20 minutes. All the

ligation reactions were carried out by conventional method (one vector and one insert) and/or 3-

A (3 antibiotic) assembly [Figure 7].

E X S P E X S PE X S P

Cut by EcoRI (E) & PstI (P)

Cut by EcoRI (E) & SpeI (S)

Cut by XbaI (X) & PstI (P)

E PE X S X S P

E X S S P

Part 1 Part 2

Construction of “Part 1 + Part 2”

: antibiotic

E X S PE X S P E X S PE X S PE X S PE X S P

Cut by EcoRI (E) & PstI (P)

Cut by EcoRI (E) & SpeI (S)

Cut by XbaI (X) & PstI (P)

E PE X S X S P

E X S S P

Cut by EcoRI (E) & PstI (P)

Cut by EcoRI (E) & SpeI (S)

Cut by XbaI (X) & PstI (P)

E PE PE PE PE X SE X SE X SE X S X S PX S PX S PX S P

E X S S PE X SE X SE X S S PS P

Part 1 Part 2

Construction of “Part 1 + Part 2”

: antibiotic: antibiotic

Figure 7: Schematic diagram of the 3-Antibiotic assembly. E, X, S and P represents EcoRI, XbaI, SpeI and

PstI restriction sites in plasmids that are carrying different antibiotic resistance casette. For example,

construct Trc1HydA1 can be built in plasmid pPMQAK1 by combining Trc1_pSB1A3 (blue),

HydA1_pSB1AC3 (green), and pPMQAK1 (red) digested by E and S, X and P, E and P.

For conventional ligation reactions, GENtle software (University of Cologne) was used to

calculate the ratio of insert to vector. The transformations of ligated constructs (2-5µl) were done

in competent E. coli (NEB5α) cells. Competent E. coli cells were prepared using the CCMB 80

protocol described in the openwet ware

(http://openwetware.org/wiki/TOP10_chemically_competent_cells) and stored at -80°C. The

CCMB 80 buffer was prepared with 10 mM KOAc pH 7.0, 80 mM CaCl2.2H2O (11.8 g/L), 20

mM MnCl2.4H2O (4.0 g/L), 10 mM MgCl2.6H2O (2.0 g/L), 10% glycerol (100 ml/L) and the

final pH is adjusted to 6.4 and stored at 4°C. In total, 10 ml of competent cells were made in a

batch and aliquoted in 2ml tubes (100µl each) and stored at - 80˚C. The transformations of

ligated plasmids in E. coli were done as follows: Tubes containing 100µl of frozen competent

cells were thawed for 5 minutes in ice and 2 – 5 µl of ligation mixtures were added and allowed

to rest in ice for 30 minutes. Cells were then heat shocked at 42˚C for 30- 45 seconds and

allowed to rest on ice again for 10 minutes. Then 900µl of SOC media was added to the cells and

allowed to shake at 250 Rotations per minute (RPM) for 1 hour at 37˚C. Cells were then spun

down for 10 minutes at 3000 xg and the supernatant (~900µl) was discarded leaving the pellet.

Then the pellet was vortexed and plated in SOC agar plates containing necessary antibiotics

(50µg/ml Kanamycin or/and 50µg/ml Chloramphenicol or/and 100µg/ml Ampicillin). The plates

were then incubated at 37˚C for overnight.

25 

 

26 

 

4.4 Polymerase chain reactions and DNA sequencing

Polymerase chain reactions (PCRs) were carried out for the clones in the selection plates (Colony

PCR) and the plasmid DNA when needed. The PCR reaction mixtures (20µl) were prepared as

follows: 13.3 µl of deionized water, 2µl of Dream Taq buffer (Fermentas), 2µl of dNTPs

(Fermentas), 0.1µl of Dream Taq Polymerase (Fermentas), 0.8µl of forward and reverse primers

and 1µl of template. For cPCR, the templates were prepared by suspending a colony of E.

coli/cyanobacteria picked from the selection plates in 10µl of SOC media/BG11 media. To

confirm the correct colonies, the thermocycler program was set as follows: 1) Initialization step

at 95˚C for 3 minutes, 2) Denaturation step at 95˚C for 30 seconds, 3) Anealing step at 48˚C for

30 seconds, 4) Elongation step at 72˚C for 3 – 9 minutes depending on the gene length, 5) Steps

2, 3 and 4 are repeated 25 -30 minutes depending on the need, 6) Final elongation step at 72˚C

for 3 minutes and 7) Final hold at 4˚C. After the completion of thermocycler, 3µl of cPCR

reaction mixtures were run in 1% agarose gels using 6x loading dye (Fermentas) and 1 KB DNA

ladder (Fermentas) as the marker. For using plasmid DNA as template, the DNA concentrations

were made to 10ng/µl by concentrating or diluting the samples depending on the need and the

same procedures that are used for cPCR were followed

Table 2: Details of the designed primer names and sequence

Primer name and sequence Description

VF2 (TGCCACCTGACGTCTAAGAA),

VR (ATTACCGCCTTTGAGTGAGC),

Universal for all the biobrick plasmids

pSB1A3, pSB1AK3, pPMQAK1, pSB1AC3

HydA1.1f (TGATGCTGATCCCACTCTCC) Internal forward primer for HydA1 gene

HydA2.1f (TAAAGAGCGCGGCATTAACC), Internal forward primer for HydA2 gene

HydA.1f CGGTACTGTTGATGACGTGTG,

HydA.2f TGGAGCTACTGGTGGTGTAATG Internal forward primer for HydA gene

VSPCM.F

(CCGATTAATCTCACGTTAAGGGATTTTGG),

VSPCM.R

(CCGATTAATGATCGGGCACGTAAGAGG)

Primer designed for amplifying

chloramphinecal cassette from the plasmid

pSB1AC3

27 

 

pGDYH.NS.Bb.f

CTTGGTTTCATCAGCCATCC

Forward primer for the biobrick interface at

pGDYH.NS plasmid

pGDYH.NS.Bb r

AGGGCACGGGTTCTAGGG

Reverse primer for the biobrick interface at

pGDYH.NS plasmid

MA1f - AATGGACCGTGCTATGGAAG

MA2f- AACCGACGTTGCCATTTTAG

MA3f - CGAGCATTAAAACCCTTTCC

Internal forward primers for MatCa gene

MA1r- TGGGTACGATGGGAATTTTG Internal reverse primer for MatCa gene

MR1f- GGTGTCTATTATCGCGGTTTG

MR2f- ACACCCGCTACCGATAAATG

MR3f- GCTGGAGAAGATGCTGGTG

MR4f -AAGCACAAGTGATGGAGGAAG

MR5f -CACGGTAAAGCATCTGCAAC

MR6f -CGGCACATTTGTGTTGTTTC

Internal forward primers for MatCr gene

MR1r- AAGTCACCACGTCGCCATAC

Internal reverse primer for MatCr gene

Colonies confirmed by cPCR were grown overnight in SOC media with necessary antibiotics for

plasmid preparations. Prepared plasmids were sent for sequencing with the respective primers to

Macrogen Inc, South Korea. The Sequencing results were examined using Lasergene software

(DNA Star, Madison, WI) and confirmed by performing alignment using ClustalW2

(http://www.ebi.ac.uk/Tools/clustalw2/index.html).

4.5 Transformation into cyanobacteria by triparental mating method

All the transformations in Cyanobacterial cells were carried out by the following the protocols

described by Jeff Elhai and C. Peter Wolk in the book Methods in enzymology [67]. E. coli cells

carrying the constructs (Trc1 hydA1 + fd, Trc1 hydA2+ fd, Trc1 hydA1, Trc1 hydA2) in the

plasmid pPMQAK1 (Cargo vector) and E. coli HB101 cells (Conjugal strain) carrying the

Conjugal vector (pRL443) were grown overnight in 10 ml SOC medium with 50µg/ml

Kanamycin and 100µg/ml Ampicillin. On the other hand, cyanobacterial strains (Synechocystis

28 

 

sp.PCC 6803 and ∆Hox Synechocystis sp.PCC 6803) that were grown for a period of 2~3 weeks

in BG11 media were used. Initially, 10 ml of overnight E. coli cells and cyanobacterial cells

were centrifuged at 3000xg for 10 minutes and the supernatant was discarded leaving the pellet.

Then the pellets from E. coli cells were resuspended with 10 ml of fresh SOC media without any

antiobiotics. The resuspended E. coli cells (every 10 ml of cargo strain was mixed with 10 ml of

conjugal strain) were then mixed in 50 ml falcon tube. The E. coli cell mixtures were then spun

down again at 3000xg for 10 minutes and resuspended in 1 – 5ml of fresh SOC media depending

on the need. Simultaneously, the pellets from the cyanobacterial cells (Synechocystis sp.PCC

6803 and ∆Hox Synechocystis sp.PCC 6803) were resuspended in 1 -2 ml of fresh BG11 media

depending on the need. Serial dilutions were then performed for the cyanobacterial cells with

fresh BG11 media in the ratios 1:100 and 1:10000. Then 100 µl of serially diluted cyanobacterial

cells and 200µl of E. coli cell mixtures carrying both the cargo and conjugal vectors were mixed

in 1.5ml tubes and incubated at 30˚C for 90 minutes in the special incubators that had the light

intensity at ~30 microeinsteins m-2 s-1. After 90 mins of incubation, 300µl of cyanobacteria and

E. coli mixtures were plated in the BG11- agar plates without antibiotics and incubated at 30˚C

for 3 days with the light intensity at ~30 microeinsteins m-2 s-1. After three days of incubation,

the cells were washed with 100-200µl of fresh BG11 media and plated in BG11- agar plates

carrying necessary antibiotics (50µg/ml Kanamycin, 50µg/ml Chloramphenicol, and 100µg/ml

Ampicillin) and incubated for 1- 2 weeks until the colonies are visible in naked eye. The clonies

were then picked and the PCR reactions were performed similar to E. coli cells mentioned

before. A confirmed colony was inoculated in 50ml BG11 media with necessary antibiotics in E-

flasks for 3-4 weeks before performing the further experiments.

4.6 Hydrogen measurements

Hydrogen evolution measurements were carried out by using both the hydrogen electrode and

Gas chromatography for E. coli and only the hydrogen elecrode method for cyanobacterial cells.

29 

 

Methyl viologen assay and Hydrogen electrode:

Hydrogen electrode setup and calibration

For this method, CB1-D control box coupled with S1 Clark Type Polarographic Electrode Disc

containing platinum cathode at the center and concentric silver anode was used. Before

performing the measurements, the platinum cathode was cleaned by a drop of Aqua regia

solution (H2O, 12 M HCl and 16 M HNO3 in the ratio 4:3:1) and deionized water. Then 100µl of

2M H2SO4 was added and electroplated using custom-made platinum tipped electroplating

device at 0.3V for 10 mins. It was followed by washing with deionized water and adding a drop

of 2% chloroplatinic acid and electroplating for 40 minutes. Then 50% pottasium chloride

solution was added to the concentric silver anode and the electroplating was done at 0.3V for 20

minutes. A very thin spacer paper and a fine polytetrafluoroethylene (PTFE) membrane was then

applied on the dome of the electrode and retained by O-ring. Finally, the whole setup for

carrying out hydrogen measurement was assembled according to the manufacturer’s instructions

[68]. The calibrations were done using 1 ml of deionized water untill the voltage devaition stops

and the output graph reaches the steady baseline.

Whole cell hydrogen measurement in cyanobacterial cells

25 ml of cyanobacterial cells that were grown aerobically in BG11 media for 2-3 weeks were

collected, spun down at 5000 rpm and resuspended in 5ml of fresh BG11 media with necessary

antibiotics in 8 ml gas tight vials sealed with rubber septa (Chromacol Ltd) and covered with

aluminium foil. Cells were then flushed with argon for 1.5 to 2 hours and 850µl of the cells were

taken in the gas tight syringe and added in the hydrogen electrode setup. After the baseline

devaition stopped, 50µl of 100µM methyl viologen and 100µl of 100µM dithionite was added

and the change in the output was recorded.

Whole cell hydrogen measurement in E. coli NEB 5α cells

6 ml of E. coli cells that was grown aerobically in SOC media for overnight were collected, spun

down at 5000 rpm and resuspended in 5ml of fresh SOC media with necessary antibiotics in 8 ml

gas tight vials sealed with rubber septa (Chromacol Ltd). For carrying out the hydrogen

30 

 

measurement using hydrogen electrode, the same steps those were carried out for cyanobacterial

cells were followed.

Hydrogen measurement in E. coli BL21 (DE3) cells using Gas Chromatography (GC)

E. coli NEB 5α cells carrying hydrogenase constructs (HydA1+fd, HydA1, HydA2+fd, HydA2)

under Trc1 promoter in plasmid pPMQAK1 and the Maturation system constructs (MatCa under

Trc1 promoter and MatCr under Trc2 Promoter) in plasmid pPSB1AC3 were grown overnight in

SOC media with 50µg/ml Kanamycin and 50µg/ml Chloramphenicol. Then the isolation of these

plasmids was carried out using GeneEluteTM Plamid prep kit as mentioned earlier. These

isolated plasmids were transformed into competent E. coli BL21 (DE3) cells in the following

combinations (Table 3) and selected using the SOC/LB plates with two antibiotics (50µg/ml

Kanamycin and 50µg/ml Chloramphenicol). Then one of the colonies from the different

combination of constructs were picked and grown overnight at 37˚C in 5-6 ml of LB media with

20mM glucose using double selection. For hydrogen measurement using GC, initially the

absorbances at 595 nm of the overnight cultures were measured using multimode microplate

reader (Hidex Oy, Finland) and the initial OD was adjusted to 0.1 for all the different

combinations of constructs by diluting the culture using LB with 20mM glucose, 1 mM IPTG

and necessary antibiotics (50µg/ml Kanamycin and 50µg/ml Chloramphenicol). The cultures

were then transferred to sterile gas tight vials sealed with rubber septa (Chromacol Ltd) and

flushed with argon for ~10 mins. Then the vial head was covered with parafilm to make sure it

was completely gas tight and allowed to grow at 37˚C at 150 RPM. . For every construct

combination, triplicate readings were taken. The hydrogen measurement using Clarus 500 Gas

Chromatograph (Perkin Elmer Inc) was done by injecting 50µl of gas collected from the head

space using gas tight syringe at various time intervals, and simultaneously absorbance at 595 nm

was also measured. The output signals from GC were recorded using LCI-100 Computing

Integrator (Perkin Elmer Inc).

31 

 

Table 3: Different combination of hydrogenase and maturation system constructs

transformed to E. coli BL21 (DE 3) cells for hydrogen measurement using GC.

Hydrogenase constructs in Plasmid

pPMQAK1

Maturation system constructs in Plasmid

pSB1AC3

Trc1HydA1+fd Trc1MatCa

Trc2MatCr

Trc1HydA1 Trc1MatCa

Trc2MatCr

Trc1HydA2+fd Trc1MatCa

Trc2MatCr

Trc1HydA2 Trc1MatCa

Trc2MatCr

4.7 Protein extraction and western blotting

Protein extraction:

Cyanobacterial cells grown for 2- 3 weeks in BG11 media with/without necessary antibiotics

were collected in 50 ml falcon tubes and spun down at 5000 rpm for 10 minutes. The pellets

were resuspended with 700µl of protein extraction buffer (50 mM Tris- HCl pH 7.8, 0.1% Triton

X-100, 2% sodium dodecyl sulfate, and 10 μl ß- mercaptoethanol) and transferred to 2 ml screw

cap tubes. ~250µl of 0.1mm glass beads (sterile and acid washed) were added to the tube and

thelysis was performed using precellys®24 homogenizer (bertin Technologies) at the maximum

speed for 30 seconds. This step was repeated 3 times with the incubation step in ice for 1 minute

inbetween. The extracts were then centrifuged at 20000 xg for 10 minutes and the supernatant

32 

 

was collected and stored at 4˚C. The same experimental setup was used for the protein extraction

from E. coli cells, except the growth conditions (E. coli cells grown overnight in SOC media/LB

media with 20mM glucose provided with necessary antibiotics)

Western blotting

For western blotting, initially the extracted protein samples were run in Sodium dodecyl sulfate

polyacrylamide gel electrophoresis (SDS-PAGE) for seperation. 12% acrylamide running gel

[2.5 mL 1.5 M Tris-HCl pH 8.8, 100 μl 10% (w/v) SDS, 3.35 mL water, 4.0 mL acrylamide/bis

(37.5:1), 100 μl 10% ammonium persulfate, and 10 μl TEMED] was prepared, and allowed to

polymerise. Then the stacking gel [3.05 mL water, 1.25 mL 0.5M Tris- HCl pH 6.8, 50 μl 10%

(w/v) SDS, 655 μl acrylamide/bis (37.5:1), 25 μl 10% ammonium persulfate, and 5 μl TEMED]

was prepared, added over the running gel with a 10 well comb inserted. The sample loading

buffer (4X) [3.8 mL water, 1.0 mL 0.5 M Tris-HCl pH 6.8, 0.8 mL glycerol, 1.6 mL 10% (w/v)

SDS, 0.4 mL 2-mercaptoethanol, and 0.4 mL 1% (w/v) bromophenol blue] was prepared, mixed

with 10 -15 µl of the protein extract, and heated at 98˚C for 5 minutes before loading.

PageRuler™ Plus (Fermentas) prestained protein ladder was used as the marker and the running

buffer prepared with the following recipe [5x (9 g Tris base, 43.2 g glycine, and 3 g SDS to 600

mL of deionized)] was used to run the gels. Then the gels were run at 30 mA until the loading

dye reached at the bottom. Following the SDS-PAGE electrophoresis, proteins were blotted onto

Amersham™ Hybond™ ECL membrane (GE Healthcare, Waukesha, WI) for overnight at 17 V

and 60 mA. All the experimental setup was done according to the manufacturer’s instructions.

For all the blotting, TE 22 transfer tank (GE Healthcare) and the tank buffer prepared by the

following recipe (3.03 g Trizma base, 14.4 g glycine, 800 mL deionized water and 200 mL

methanol) was used. The blocking of the membrane was done using 1X Tween (0.1%) TBS (50

mM Tris-HCl, pH 7.4, 150 mM NaCl) with 5% (w/v) lowfat milk Powder (Bio Rad lab) for 1.5-

2 hours followed by the primary antibody hybridization step for 1 – 2 hours with polyclonal

rabbit anti-HydA2 antibodies (Agrisera,Vännäs, Sweden) at a 1:5000 dilution in 1X Tween TBS

(T-TBS). After primary antibody hybridization, washing step with 1X T-TBS was carried out for

10 mins, and the step was repeated for 3 times. Then the secondary anti-rabbit –IgG antibody

33 

 

conjugated to horseradish peroxidase (HRP, GE Healthcare): T-TBS with 1:5000 dilutions was

added to the blot and incubated for 1 hour at room temperature. To develop and visualise the

blot, ECL Western Blot Analysis development solution and Chemidoc (Bio-Rad) instrument

with Quantity One software (Bio-Rad) was used.

Protein staining

While running a SDS-PAGE gel for western blot, usually a duplicate gel was also run with the

same conditions for performing protein staining and also to make sure the protein separation is

fine. The protocol for staining as follows: fixing the gel with 7% glacial acetic acid and 40%

methanol for 1 hour and staining it for overnight with the 4 parts of 1X working [800 mL

deionized water with 1 % w/v Brilliant Blue G-colloidal concentrate (Sigma Aldrich)] solution

and 1 part methanol. Then the gels were destained using dH2O for 2 hours and wrapped in a

transparent plastic sheet before the picture was taken using on the Chemidoc imager using Epi

White setting.

5. Acknowledgements

I am a part of all that I have met

- Alfred Lord Tennyson in Ulysses

First of all, I would like to thank Professor Peter Lindblad and Dr. Thorsten Heidorn for giving

an opportunity to pursue my interests in fotomol. I am very grateful to both of them; their

valuable inputs, immense support, and effective supervision are of great help. Thank you!

Many thanks go to Ph.D students Hsinho Huang and Daniel Camsund, for their valuable

suggestions and guidance, I learned a lot from both of you. Also, a load of thanks for their

patience to answer all my questions, even the “silly and inappropriate” questions!

Thank you Sean, for your friendship and all your help, without your help, this work wouldn’t

have reached this stage! You are really an interesting person to work with! I Hope to deserve

your freindship all through our lives.

I am very grateful to Dr.Paulo Olieveira for all his valuable suggestions. His humbleness, hard

work, and astuteness inspired me in many ways.

My deeply felt gratitude is due also to the other lab members Dr. Petra Kellers, Dr. Karin

Stensjö, Dr. Pia Lindberg, Marie Holmqvist, Ellenor Devine, Dr. Åsa Agervald, Dr. Fernando

Lopes Pinto, Peter yohanoun, Jon Van Wagenen, Dr. Wipawee Baebprasert, Wanthanee

Khetkorn and Namita Khanna for making the joyous working environment in the lab. I loved

working with all of you, thank you very much.

Last of all, most importantly, I would like to thank, my sister Aswini Gnanasekaran, my parents,

and my friends, for their unconditional love and support over all these years.

34 

 

35 

 

6. References

1. Eric Hand (2009). Newsmaker of the year: The power player. Nature 462, 978-983

2. World population 2300.(2004) Economic and Social Affairs, United Nations

(http://www.un.org/esa/population/publications/longrange2/WorldPop2300final.pdf)

3. Hansen, J., D. Johnson, A. Lacis, S. Lebedeff, P. Lee, D. Rind, and G. Russell (1981).

Climate impact of increasing atmospheric carbon dioxide. Science 213: 957–966.

4. Dr. Pieter Tans, NOAA/ESRL (www.esrl.noaa.gov/gmd/ccgg/trends)

5. JT Houghton, LG Meira Filho, DJ Griggs and K Maskell (1997). IPCC Technical Paper III.

6. M. S. Dresselhaus, I. L. Thomas (2001). Alternative energy technologies. Nature 414, 332-

337.

7. Richard Cammack, Michel Frey, Robert L. Robson (2002). Hydrogen as a fuel: learning

from nature. ISBN 0-203-47104-0. Taylor and Francis Inc.

8. Phillip Tseng, John Lee and Paul Friley (2005). A hydrogen economy: opportunities and

challenges. Energy. Volume 30, Issue 14, 2703-2720

9. Jens R. Rostrup-Nielsen and Thomas Rostrup-Nielsen (2002). Large-Scale Hydrogen

Production. CATTECH .Volume 6, Number 4, pages 150-159

10. Agus Haryanto, Sandun Fernando, Naveen Murali, and Sushil Adhikari (2005). Current

Status of Hydrogen Production Techniques by Steam Reforming of Ethanol: A Review.

Energy Fuels, 19 (5), pp 2098–210

11. M. Momirlan, T. N. Veziroglu (2002). Current status of hydrogen energy. Renewable and

Sustainable Energy Reviews.Volume 6, Issues 1-2, Pages 141-179.

12. J. O'm. Bockris, B. Dandapani, D. Cocke and J. Ghoroghchian (1985).On the splitting of

water. International Journal of Hydrogen Energy. vol. 10. no. 30, Pages 179-201.

13. Debabrata Das and T. N. Veziroglu (2001). Hydrogen production by biological processes: a

survey of literature. International Journal of Hydrogen Energy. Volume 26, Issue 1, Pages

13-28.

14. S. Z. Baykara and E. Bilgen (1989). An overall assessment of hydrogen production by solar

water thermolysis. International Journal of Hydrogen Energy. Volume 14, no. 12, pages.

881-891.

36 

 

15. S. Yalcin (1989). A review of nuclear hydrogen production. International Journal of

Hydrogen Energy, Volume 14, no. 8, Pages 551-561.

16. S.Z. Baykara and E. Bilgen (1989). Solar hydrogen production by hybrid process of water

thermolysis and electrolysis. Solar and wind technology.Volume 6, Issue 3, Pages 183-188.

17. Jun Miyake, Masato Miyake and Yasuo Asada (1999). Biotechnological hydrogen

production: research for efficient light energy conversion. Journal of Biotechnology. Volume

70, Issues 1-3, Pages 89-101.

18. Yasuo Asada and Jun Miyake (1999). Photobiological hydrogen production, Journal of

Bioscience and Bioengineering, Volume 88, Issue 1, Pages 1-6

19. Debabrata Das and T. Nejat Veziroglu (2008). Advances in biological hydrogen production

processes International Journal of Hydrogen Energy, Volume 33, Issue 21, pages 6046-

6057.

20. Marjory Stephenson and Leonard Hubert Stickland (1931). Hydrogenase: a bacterial enzyme

activating molecular hydrogen. Biochemical Journal, Volume 25(1), Pages 205–214.

21. Elena N. Kondratieva and Ivan N. Gogotov (1986). Production of molecular hydrogen in

microorganisms. ISBN 978-3-540-12791-8. Pages 131-191.

22. Paulette M. Vignais, Bernard Billoud, Jacques Meyer (2001) .Classification and phylogeny

of hydrogenases. FEMS Microbiology Reviews, Volume 25, Pages 455-501.

23. Wolfgang Lubitz, Eduard Reijerse, and Maurice van Gastel (2007). [NiFe] and [FeFe]

Hydrogenases Studied by Advanced Magnetic Resonance Techniques. Chemical. Reviews

107, 4331-4365

24. Clarke T. Gray and Howard Gest (1965). Biological Formation of Molecular Hydrogen.

Science, Volume. 148. Pages. 186 – 192

25. Anne Volbeda Marie-Hélène Charon Claudine Piras E. Claude Hatchikian Michel Frey &

Juan C. Fontecilla-Camps (1995). Crystal structure of the nickel–iron hydrogenase from

Desulfovibrio gigas. Nature 373, 580 - 587

26. Higuchi, Y.; Ogata, H.; Miki, K.; Yasuoka, N.; Yagi, T (1999). Activation Process of [NiFe]

Hydrogenase Elucidated by High-Resolution X-Ray Analyses: Conversion of the Ready to

the Unready State. Structure, 7, 549.

37 

 

27. Matias, P. M.; Soares, C. M.; Saraiva, L. M.; Coelho, R.; Morais, J.; LeGall, J.; Carrando, M.

A.(2001). [NiFe] hydrogenase from Desulfovibrio desulfuricans ATCC 27774: gene

sequencing, three-dimensional structure determination and refinement at 1.8 Å and modelling

studies of its interaction with the tetrahaem cytochrome c3. Journal of Biological Inorganic

Chemistry. Volume 6, Pages 63 -81.

28. Montet, Y.; Amara, P.; Volbeda, A.; Vernede, X.; Hatchikian, E.C.; Field, M. J.; Frey, M.;

Fontecilla-Camps, J. C. (1997). Gas access to the active site of Ni-Fe hydrogenases probed

by X-ray crystallography and molecular dynamics. Nature Structural Biology. Volume 4,

Pages 523 – 526.

29. Garcin E, Vernede X, Hatchikian EC, Volbeda A, Frey M, Fontecilla-Camps JC (1999). The

crystal structure of a reduced [NiFeSe] hydrogenase provides an image of the activated

catalytic center. Structure, Volume 5, Pages 557-566.

30. John W. Peters, William N. Lanzilotta, Brian J. Lemon, Lance C. Seefeldt (1998). X-ray

Crystal Structure of the Fe-Only Hydrogenase (CpI) from Clostridium pasteurianum to

1.8 Angstrom Resolution. Science. Vol. 282. no. 5395, pp. 1853 – 1858.

31. Nicolet Y, Piras C, Legrand P, Hatchikian CE, and Fontecilla-Camps JC (1999).

Desulfovibrio desulfuricans iron hydrogenase: the structure shows unusual coordination to an

active site Fe binuclear center. Structure. 7(1), 13-23.

32. Yasuo Asada, Yoji Koike, Jörg Schnackenberg, Masato Miyake, Ieaki Uemura and Jun

Miyake (2000). Heterologous expression of clostridial hydrogenase in the cyanobacterium

Synechococcus PCC7942. Biochimica et Biophysica Acta. Volume 1490, Issue 3, Pages 269-

278.

33. Pierre-Pol Liebgott, Fanny Leroux, Bénédicte Burlat, Sébastien Dementin, Carole Baffert,

Thomas Lautier, Vincent Fourmond, Pierre Ceccaldi, Christine Cavazza, Isabelle Meynial-

Salles, Philippe Soucaille, Juan Carlos Fontecilla-Camps, Bruno Guigliarelli, Patrick

Bertrand, Marc Rousset & Christophe Léger. (2010). Relating diffusion along the substrate

tunnel and oxygen sensitivity in hydrogenase. Nature Chemical Biology. 6, 63 - 70

34. Douglas A. Lappi, Francis E. Stolzenbach, Nathan O. Kaplan and Martin D. Kamen (1976).

Immobilization of hydrogenase on glass beads. Biochemical and Biophysical Research

Communications. Volume 69, Issue 4, Pages 878-884.

38 

 

35. R. H. A. Plasterk, K. K. Rao and D. O. Hall (2004). Immobilization of hydrogenases for

biophotolytic hydrogen production; stability and kinetics. Biotechnology Letters. Volume 3.

Pages 99-104.

36. Agapakis CM, Ducat DC, Boyle PM, Wintermute EH, Way JC, Silver PA (2010). Insulation

of a synthetic hydrogen metabolism circuit in bacteria. Journal of Biological Engineering.

Feb 25; 4:3.

37. Paul W. King, Matthew C. Posewitz, Maria L. Ghirardi, and Michael Seibert (2006).

Functional Studies of [FeFe] Hydrogenase Maturation in an Escherichia coli Biosynthetic

System. Journal of Bacteriology. March 2006, p. 2163-2172, Vol. 188, No. 6.

38. Anastasios Melis (2002). Green alga hydrogen production: progress, challenges and

prospects. International Journal of Hydrogen Energy. Volume 27, Issues 11-12, Pages 1217-

1228.

39. Maria L. Ghirardi, Matthew C. Posewitz, Pin-Ching Maness, Alexandra Dubini, Jianping Yu,

and Michael Seibert (2006) Hydrogenases and Hydrogen Photoproduction in Oxygenic

Photosynthetic Organisms. Annual Review of Plant Biology. Vol. 58: 71-91

40. Paula Tamagnini, Rikard Axelsson, Pia Lindberg, Fredrik Oxelfelt, Röbbe Wünschiers, and

Peter Lindblad (2002). Hydrogenases and Hydrogen Metabolism of Cyanobacteria.

Microbiology and Molecular Biology Reviews. Volume 66. Pages 1-20.

41. Online database for cyanobacteria – Cyanobase. http://genome.kazusa.or.jp/cyanobase/

42. T. Kaneko, S. Sato, H. Kotani, A. Tanaka, E. Asamizu, Y. Nakamura, N. Miyajima, M.

Hirosawa, M. Sugiura and S. Sasamoto (1996). Sequence analysis of the genome of the

unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of

the entire genome and assignment of potential protein-coding regions, DNA Research.

Volume 3.Pages 109–136.

43. Jeff Tollefson (2010). Hydrogen vehicles: Fuel of the future? Nature. Volume 464, Pages

1262-1264.

44. Schopf, J. W. (1993). Microfossils of the Early Archean Apex chert: new evidence of the

antiquity of life. Science 260: 640-646.

45. Antonia Herrero and Enrique Flores (2008). The Cyanobacteria: Molecular Biology,

Genomics and Evolution. Caister Academic Press. ISBN: 978-1-904455-15-8

39 

 

46. Castenholz R. W.(2001) in Bergey's Manual of Systematic Bacteriology, eds Boone D. R.,

Castenholz R. W. (Springer, New York), 2nd Ed. Volume 1, Pages 474–487.

47. Akiko Tomitani, Andrew H. Knoll, Colleen M. Cavanaugh, Terufumi Ohno (2006). The

evolutionary diversification of cyanobacteria: Molecular–phylogenetic and paleontological

perspectives. PNAS .Volume. 103. no. 14. Pages 5442-5447.

48. Eric James Devroe, Sriram Kosuri, David Arthur Berry, Noubar Boghos Afeyan, Frank

Anthony Skraly, Dan Eric Robertson, Brian Green, Christian Perry Ridley (2008).

Hyperphotosynthetic Organisms. USPTO Applicaton #20090203070 –Class 435691.

49. Michael Mendez, Bryan O'Neill, Stephen Mayfield, Yan Poon, Phillip Lee, Craig Aaron

Behnke, Su-Chiung Fang (2009). Molecule Production by Photosynthetic Organisms. IPC8

Class: AC12P704FI, USPC Class: 435157, Patent application number: 20090280545

50. Niederholtmeyer H, Wolfstädter BT, Savage DF, Silver PA, Way JC (2010). Engineering

synthesis and export of hydrophilic products from cyanobacteria. Applied and Environmental

microbiology. Published online: doi:10.1128/AEM.00202-10

51. Xinyao Liu, Daniel Brune, Wim Vermaas, Roy Curtiss III (2010). Production and secretion

of fatty acids in genetically engineered cyanobacteria. Proceedings of the National Academy

of Sciences. Published online. doi: 10.1073/pnas.1001946107

52. L.J. Stal and R. Moezelaar (1997). Fermentation in cyanobacteria. FEMS Microbiology

Reviews. Volume 21. Pages 179–21.

53. J. Appel, S. Phunpruch, K. Steinmüller and R. Schultz (2000). The bidirectional

hydrogenase of Synechocystis sp. PCC 6803 works as an electron valve during

photosynthesis. Arch Microbiol Volume 173 Pages. 333–338

54. Fernando A. Lopes Pinto, Olga Troshina, and Peter Lindblad (2002). A brief look at three

decades of research on cyanobacterial hydrogen evolution. International Journal of

Hydrogen Energy. Volume 27, Issues 11-12, Pages 1209-1215.

55. Laurent Cournac, Florence Mus, Laetitia Bernard, Geneviève Guedeney, Paulette Vignais

and Gilles Peltier (2002). Limiting steps of hydrogen production in Chlamydomonas

reinhardtii and Synechocystis PCC 6803 as analysed by light-induced gas exchange

transients. International Journal of Hydrogen Energy. Volume 27, Issues 11-12, Pages 1229-

1237

40 

 

56. Claes Gustafsson, Sridhar Govindarajan and Jeremy Minshull (2004). Codon bias and

heterologous protein expression. Trends in Biotechnology. Volume 22, Issue 7, Pages 346-

353

57. Ernesto Andrianantoandro, Subhayu Basu, David K Karig & Ron Weiss (2006). Synthetic

biology: new engineering rules for an emerging discipline. Molecular Systems Biology

2:2006.0028.

58. Elhai, J., Cai, Y., and Wolk, C.P. (1994) Conduction of pEC22, a plasmid coding for

MR.EcoT22I, mediated by a resident Tn3-like transposon, Tn5396. J Bacteriol 176:5059-

5067.

59. Registry of standard Biological parts (http://partsregistry.org)

60. Hsin-Ho Huang, Daniel Camsund, Peter Lindblad and Thorsten Heidorn (2010). Design and

characterization of molecular tools for a Synthetic Biology approach towards developing

cyanobacterial biotechnology. Nucleic Acids Research 38(8):2577-2593

61. Rippka, R., J. Deruelles, J. Waterbury, M. Herdman and R. Stanier (1979). Generic

assignments, strain histories and properties of pure cultures of cyanobacteria. J.Gen.

Microbiol. 111: 1-61.

62. Leland H. Hartwell, John J. Hopfield, Stanislas Leibler and Andrew W. Murray (1999). From

molecular to modular cell biology. Nature. Volume 402.

63. Subhayu Basu, Yoram Gerchman, Cynthia H. Collins, Frances H. Arnold & Ron Weiss.

(2005). A synthetic multicellular system for programmed pattern formation. Nature 434,

1130-1134.

64. Gwynedd A. Benders, Vladimir N. Noskov, Evgeniya A. Denisova, Carole Lartigue, Daniel

G. Gibson, Nacyra Assad-Garcia, Ray-Yuan Chuang, William Carrera, Monzia Moodie,

Mikkel A. Algire, Quang Phan, Nina Alperovich, Sanjay Vashee, Chuck Merryman, J. Craig

Venter, Hamilton O. Smith, John I. Glass and Clyde A. Hutchison (2010). Cloning whole

bacterial genomes in yeast. Nucleic Acids Research. 38(8):2558-2569

65. David F. Savage, Jeffrey Way and Pamela A. Silver (2008). Defossiling Fuel: How Synthetic

Biology Can Transform Biofuel Production. ACS Chemical Biology, 3 (1), pp 13–16

41 

 

66. Brenner, M. P., Bildsten, L., Dyson, F., Fortson, N., Garwin, R., Grober, R., Hemley, R.,

Hwa, T., Joyce, G., Katz, J., and Koonin, S. ( 2006) Engineering microorganisms for energy

production, U. S. Department of Energy, Washington, DC, Report JSR-05-300

67. Jeff Elhai and C. Peter wolk (1988). Conjugal transfer of DNA to cyanobacteria. Methods in

Enzymology, Volume 167, Chapter 83. Copyright © 1988 by Academic press, Inc. ISBN

9780121820688.

68. Hansatech (1992) Hydrogen Measurement Using Modified Oxygen Control Box CB1-

DNotes for Users. In: Hansatech, pp. 1-12. Norfolk, England: Hansatech Instruments