Supplementary figure 1

1
Supplementary figure 1 The fusion expressed CTB could improve specific T cell responses elicited by TRIVN (Tat, Rev, Integrase, Vif and Nef fusion antigen derived from HIV-1). However, when separating TRIVN and CTB into two DNA vaccines, the genetic adjuvant effect decreased.

description

Supplementary figure 1. The fusion expressed CTB could improve specific T cell responses elicited by TRIVN (Tat , Rev, Integrase , Vif and Nef fusion antigen derived from HIV-1). However, when separating TRIVN and CTB into two DNA vaccines, the genetic adjuvant effect decreased. - PowerPoint PPT Presentation

Transcript of Supplementary figure 1

Page 1: Supplementary figure 1

Supplementary figure 1

The fusion expressed CTB could improve specific T cell responses elicited by TRIVN (Tat, Rev, Integrase, Vif and Nef fusion antigen derived from HIV-1). However, when separating TRIVN and CTB into two DNA vaccines, the genetic adjuvant effect decreased.

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Supplementary Figures - VIVE LA RÉVOLUTIONmai68.org/spip/IMG/pdf/ncomms3543-s1.pdfSupplementary Figures Supplementary Figure S1. Frequency distribution maps for mtDNA haplogroups

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db.

Supplementary figure 1 Supplementary Fig. S1: Age dependent changes in db/db and db/dm mice. Representative images of PAS-stained kidney sections of db/db.

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste€¦ · Volodymyr Nikolenko, Kira E Poskanzer & Rafael Yuste Supplementary figures and text: Supplementary Figure 1. Optical design

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Info legend - Genes & Developmentgenesdev.cshlp.org/content/suppl/2006/08/02/20.16.2293.DC1/... · Supplementary Figure 2. The upstream regulatory region (nt -3876 to

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Data, Igyarto et al. - Tel Aviv University - Skin - Resident Mu… · Supplementary Data, Igyarto et al. 2 Supplementary Figure S2, related to Figure 4. Th17 cells co-express

Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Supplementary Figure 1. HNF4α re-expression is confined to ...dm5migu4zj3pb.cloudfront.net/manuscripts/73000/73137/JCI73137… · Supplementary Figure 1. HNF4α re-expression is

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figure S1.

Supplementary Figure S1.

Supplementary Figure S1

Supplementary Figure S1

Supplementary Figure S3

Supplementary Figure S3

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Supplementary Figures - Beijing Normal Universitysss.bnu.edu.cn/~wenxuw/publications/NC_Reconstruct_SI.pdf · Supplementary Figure 10 | Difference between ln(1 − P01 i ) and ln(1

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supporting Information · Supporting Information Supplementary Figure 1. ... Tumor bearing mice were treated with Taxol, ... Supplementary Figure.docx

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Supplementary Figure 1 - Hindawi Publishing …downloads.hindawi.com/journals/omcl/2015/379538.f1.docx · Web viewSupplementary Figure 5 Representative images of murine peritoneal

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Supplementary figure 1. Supplementary figure 1: TNF-α receptor 2 expression in the skin keratinocytes of C57 wild-type mice after TNF-α induction. (A)

Letter to the Editors · 48 Supplementary Figures Supplementary Figure 1. Injection of liver purified iNKT cells, depleted of iNKT cells, failed to increase the survival of PR8 infected

Letter to the Editors · 48 Supplementary Figures Supplementary Figure 1. Injection of liver purified iNKT cells, depleted of iNKT cells, failed to increase the survival of PR8 infected

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

MoleculardynamicssuggestsantiviralcompoundsactiveagainstDe ... · shown in supplementary figure 7 (SF7). No significant secondary structure rearrangementsweredetectedinthisexperimenteither(SF4).Onthewhole,thedata

A B C 3500x8900x 5600x14 000x 1500x5000x Supplementary Figure 1 TiO 2 Carbon black SWCNT.

A B C 3500x8900x 5600x14 000x 1500x5000x Supplementary Figure 1 TiO 2 Carbon black SWCNT.

Supplementary materials Supplementary methods 1. Transfection efficiency

Supplementary materials Supplementary methods 1. Transfection efficiency

SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

SUPPLEMENTARY INFORMATION Supplemental Figure Legend · 2011-09-12 · SUPPLEMENTARY INFORMATION Supplemental Figure Legend Fig. S1 miR-200c expression is induced by oxidative stress

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to

Supplementary Information - Nature · Supplementary Information Supplementary Figure 1 ... N 1s spectrum of 2D Cu 2 (OH) 3 NO 3. The O 1s can split into two peaks, corresponding to