RNA Interference Targeting Hypoxia Inducible Factor 1α Reduces Post-Operative Adhesions in Rats

Journal of Surgical Research 141, 162–170 (2007)

RNA Interference Targeting Hypoxia Inducible Factor 1� ReducesPost-Operative Adhesions in Rats

Tatiana Segura, Ph.D.,*,† Hugo Schmokel, Ph.D., D.V.M.,* and Jeffrey A. Hubbell, Ph.D.*,1

*Ecole Polytechnique Fédérale de Lausanne (EPFL), Institute of Bioengineering and Institute of Chemical Sciences and Engineering,Lausanne, Switzerland; †Department of Chemical and Biomolecular Engineering, University of California, Los Angeles, California

Submitted for publication April 3, 2006

doi:10.1016/j.jss.2006.07.045

Background. To investigate the use of RNA interfer-ence mediated gene down-regulation targeting hypoxiainducible factor 1� (HIF-1�) and plasminogen activatorinhibitor 1 (PAI-1) in an effort to prevent abdominaladhesion formation.

Materials and methods. Real time polymerase chainreaction and a PAI-1 protein activity assay were usedin vitro to determine the efficacy of small interferingRNAs (siRNAs). For in vivo experiments, 57 white fe-male rats were operated to generate ischemic and se-rosal injury to the uterine horns, and treated withsaline, siRNALamin A/C (negative control), siRNAHIF-1�,siRNAPAI-1, or siRNAHIF-1� plus siRNAPAI-1. The cationicpolyer poly(ethylenimine) (PEI) was used as the deliv-ery vehicle for all siRNAs delivered in vivo. Adhesionswere analyzed by a blinded surgeon 8 days post-surgery.

Results. After in vitro transfection with siRNA, at least69% gene down-regulation was obtained for all siRNAstested. In vitro siRNA-mediated down-regulation of HIF-1�, PAI-1 or their simultaneous delivery resulted in asignificant decrease of PAI-1 protein activity (at least P <0.05). Administration of 4 nmol siRNAHIF-1� /PEI com-plexes after injury to the uterine horns achieved a sta-tistical reduction of post-operative adhesion formationwith a reduction by 52% (P < 0.05). Delivery of 4 nmolsiRNAPAI-1/PEI complexes and the simultaneous deliveryof 2 nmol siRNAHIF-1� plus 2 nmol siRNAPAI-1, resulted in areduction of abdominal adhesion by 36% and 42%, respec-tively, with the reduction being statistically significantwhen compared directly to the saline control (P < 0.01).

Conclusion. These data show that administration ofsiRNA/PEI complexes within the peritoneal cavity canbe used to prevent post-operative abdominopelvicadhesions. © 2007 Elsevier Inc. All rights reserved.

Key Words: siRNA; polyethyleneimine; non-viral; ab-dominal adhesion prevention.

1 To whom correspondence and reprint requests should be ad-dressed at: Jeffrey A. Hubbell, EPFL SV-LMRP, Station 15, CH-1015
Lausanne, Switzerland. E-mail: [email protected].
1620022-4804/07 $32.00© 2007 Elsevier Inc. All rights reserved.

INTRODUCTION

One of the most common and often serious side ef-fects of surgery within the peritoneal cavity is the forma-tion of adhesions, i.e., vascularized soft tissue bridgesbetween neighboring organs. It has been reported thatadhesions form in more than 90% of the patients whoundergo one or more abdominal operations [1], poten-tially causing small bowel obstruction [2] and infertil-ity in women [3]. Post-operative adhesion formationhas been associated with a decreased capacity of me-sothelial cells, which line the peritoneal cavity, to de-grade intraperitoneally deposited fibrin [4]. The bal-ance between fibrin deposition and fibrinolysis appearsto determine whether fibrin bridges formed betweenorgans either resorb or become permanent scar bridgesspanning between two organs. Numerous post-surgicalstrategies for the prevention of abdominopelvic adhe-sions have been investigated, however to date withlimited efficacy [5, 6]. Efforts to prevent adhesion for-mation have concentrated on inhibiting the inflam-matory response, inhibiting the formation or encourag-ing the lysis of fibrin, and protection of the damagedorgan surfaces [5]. Molecular therapeutics that havebeen investigated for the prevention of post-operativeadhesions include recombinant tissue plasminogen ac-tivator (tPA) [7–9] and antibodies against PAI-1 [10],transforming growth factor �1 (TGF-�1) [11, 12], andvascular endothelial growth factor (VEGF) [13].

Fibrin within the peritoneal cavity is naturally de-graded by mesothelial cells via plasminogen activationby plasminogen activator (PA). The reduced ability ofmesothelial cells to degrade fibrin deposited after ab-dominopelvic surgery has been attributed in part to theinhibition of PA activity by plasminogen activator in-hibitor type 1 (PAI-1) [4]. Intra-abdominal levels of PAI-1as well as the amount of tPA complexes with PAI-1have been found to increase in adhesion tissue [14, 15].
PAI-1 gene expression has been found to be regulated

163SEGURA, SCHMOKEL, AND HUBBELL: RNAi AS A STRATEGY TO PREVENT ABDOMINAL ADHESIONS

by oxygen level in numerous cell types including tho-phoblast [16], endothelial cells [17], hepatocytes [18],and keloid fibroblast [19]. It is generally agreed thatthe hypoxic regulated transcription factor HIF-1� me-diates hypoxia induced PAI-1 up-regulation under hy-poxic conditions although the molecular mechanismis no completely understood [19]. The PAI-1 gene con-tains oxygen responsive promoter sequences, namelyHRE-1 and HRE-2, to which HIF-1� binds and inducesgene expression [20]. Mutations to the oxygen respon-sive promoter sequences abolishes the effect of hypoxia[20]. Because PAI-1 up-regulation has been linked tothe formation of adhesions we hypothesized that thedown-regulation of HIF-1� and/or PAI-1 via RNA in-terference would lead to the reduction of adhesion for-mation.

RNA interference in animals is mediated by smalldouble-stranded RNA molecules named small interfer-ing RNA (siRNA) [21]. When in the cytosol, siRNAs be-come incorporated into the RNA induced silencing com-plex (RISC), which mediates degradation of the mRNAwith complementary sequences to the siRNA. RecentlysiRNA-induced RNA interference (RNAi) has been usedas an experimental therapeutic to treat a number ofdiseases including cancer [22, 23], pathogenic viruses[24, 25], high blood cholesterol [26], liver disease [27],and brain disorders [28, 29]. siRNA complexes with thepolycation polyethyleneimine (PEI) have been previ-ously used in vivo to deliver siRNA [22, 23, 25, 28],showing protection of siRNA against degradation, andenhancing cellular uptake and bioactivity in vivo.

In the present study, we sought to modulate thebalance of fibrinolysis and wound healing by RNAimediated gene down-regulation of HIF-1� and PAI-1,two molecules commonly associated with ischemia, thepersistence of adhesions and the wound-healing cas-cade. It was observed that intraperitonally deliveryof siRNAHIF-1� /PEI, siRNAPAI-1/PEI, and siRNAHIF-1�/siRNAPAI-1/PEI complexes immediately after surgeryresulted in a reduction of abdominal adhesions in a ratmodel. Treatment with siRNAHIF-1� resulted in statisti-cal significant reduction of abdominal adhesions (P �0.05) when the nonparametric Kruskal-Wallis test wasused in combination with the Dunn’s multiple com-parison’s test. For the siRNAPAI-1 and siRNAHIF-1�/siRNAPAI-1 treatments the reduction was statisticallysignificant (P � 0.01) when the less powerful Mann-Whitney test was used to compare the treatments di-rectly to the saline controls.

MATERIALS AND METHODS

Materials

All duplex siRNAs were purchased from Dharmacon (Lafayette,CO) using the indicated gene accession numbers (Table 1). Non-coding siRNA (siNEG) was purchased from Dharmacon but the se-
quence was not provided. siRNA targeting the Lamin A/C in human,
rat, and mouse genomes had a sequence GGUGGUGACGATCTG-GGCUUU (Dharmacon; Lafayette, CO). jetPEI was purchased fromPolyPlus (Illkirch, France). All other materials were purchased fromMillian (Geneva, Switzerland) unless otherwise noted.

Cell Culture and Transfection

To determine the efficacy of siRNA mediated gene down-regu-lation of HIF-1� and PAI-1, in vitro transfections with Lipofectamine2000 (LF2000) were used. siRNA sequences were designed to cut atfour different places along the mRNA of each gene (Fig. 1, Table 1).Rat fibroblasts and primary normal human dermal fibroblasts weretransfected using 25 pmol of siRNA and 1.25 �L of LF2000, asindicated in the Materials and Methods. RT-qPCR was used to quan-tify the level of mRNA remaining in cell lysates and as an indirectindication of protein down-regulation. Normal human dermal fibro-blasts (Cambrex, Verviers, Belgium) were cultured in FGM-2 (Clo-netics) containing Fibroblast basal medium (FBM) supplementedwith 2% FBS, hFGF-B, insulin, and gentamicin/amphotericin-B asinstructed by the distributor. Rat fibroblasts (LGC Promochem, Mol-sheim Cedex, France) were cultured in DMEM supplemented with10% FBS. To determine the effectiveness of the siRNA sequences,human fibroblasts (50,000 cells/well in a 24-well plate) were plated12 to 16 h before transfection. siRNA (25 pmol/well) was delivered tothe plated cells using Lipofectamine 2000 (Invitrogen, Basel, Swit-zerland) following the manufacture’s instructions. The transfectionreagent was left in contact with the cells for the duration of theexperiment. Co-transfection experiments were done delivering mix-tures of siRNAHIF-1� and siRNAPAI-1 at ratios ranging from 100:0 to0:100 with 50-pmol total siRNA. At predetermined time points thecells were lysed for total RNA extraction and analyzed using realtime RT-qPCR.

Real Time RT-qPCR

Primers were designed so that they flanked one of the degradationsites of siRNA and had efficiencies that passed the ��Ct method testas described by Livak et al. using GAPDH as the house keeping gene[30]. In brief, verification of the method was performed by plottingthe change in threshold cycle (Ct) with respect to the house keepinggene (�Ct � Ct,HIF1� or PAI-1 � Ct,GAPDH) versus template concentrationand calculating the slope of the resulting line. If the slope is close tozero, it indicates that the efficiencies of the targets and the referencegene are approximately equal. We considered a slope �0.3 to be closeto zero.

Real time RT-qPCR was used to determine the efficacy of the siRNAsequences to induce the specific down-regulation of HIF-1� and PAI-1.The mRNA expression levels of PAI-1 and HIF-1� were measured intransfected, untransfected cells and mock-transfected cells. The totalRNA from the samples was extracted using RNAqueous kit (Ambion,Cambridgeshire, United Kingdom) as recommended by the manufac-turer. RNA concentration was measured using a ND-1000 spectro-photometer (Nanodrop; Wilmington, DE). There was 10 to 20 ng/�Lof RNA used in all following experiments. cDNA synthesis wasperformed using an iScript cDNA synthesis kit (Bio-Rad, Reinach,Switzerland) using the maximum amount of recommended RNA.PCR amplification was performed and analyzed in real time on aniCycler IQ (Bio-Rad) using a SyberGreen mastermix (Bio-Rad). Inshort, 25 �L reactions were run at an initial denaturation step at95°C for 3 min followed by 45 cycles consisting of 95°C for 15 s and60°C for 45 s. Reactions were performed in duplicate and thresholdcycle values were averaged. The relative expression level of the geneswas calculated using the ��Ct method as described above withGAPDH as the housekeeping gene and comparing to mock trans-fected cells using a non-targeting siRNA (siNEG).

PAI-1 Activity

The amount of uPA activity was measured using a PAI-1 activity
assay kit according to the provider’s instructions (Calbiochem; VWR,

�

164 JOURNAL OF SURGICAL RESEARCH: VOL. 141, NO. 2, AUGUST 2007

Lucerne, Switzerland). Briefly, media samples collected 2 days post-transfection were incubated with 6 �L uPA and 20 �L assay bufferfor 2 days at 37°C. There were 20 �L of a uPA chromogenic substrateadded to the media/uPA samples. The samples were incubated at

TAB

siRNA Sequences and qPC

Access number Gene name 5= si

NM_000602 PAI-1 P CAAUCPAI-1 P ACUUGPAI-1 P UCAUUPAI-1 P AAACUPAI-1 (FW) P TCCTGPAI-1 (RV) P CCTGC

NM_001530 HIF-1� P CAAGUNM_181054 HIF-1� P UAUAU

HIF-1� P UUUGUHIF-1� P CAAAGHIF-1� (FW) P TTGGCHIF-1� (RV) P TTCAG

J02642 GAPDH (FW) P CACCCGAPDH (RV) P GTCCA

NM_012620 PAI-1 P UCACUPAI-1 P UCCCAPAI-1 P AACAUPAI-1 P GAGGGPAI-1 (FW) P AGCTGPAI-1 (RV) P ACGCT

NM_024359 HIF-1� P UAUUUHIF-1� P AAUACHIF-1� P CAACUHIF-1� P UAAUUHIF-1� (FW) P TGACGHIF-1� (RV) P TCGAG

NM_017008 GAPDH (FW) P TATAAGAPDH (RV) P TCCCG

Note. Gene indication with FW (forward) and RV (reverse) indica3= NN � 3= overhang nucleotide sequence; HS � Homo Sapiens; R

FIG. 1. siRNA target locations for HIF1� and PAI-1 genes for humline with UU and P indicating the 3= end repeat and the phosphatnucleotides in the mRNA. p(A)n indicates the poly(A) tail of mature m
reverse real-time PCR primers.
37°C for 1 h before reading absorbance at 405 nm in a Safire2-microplate reader (Tecan, Männedorf, Switzerland). Active PAI-1inactivates uPA, which in turn prevents its cleavage of the chromo-genic substrate. Thus, as the absorbance at 405 nm increases, the

1

Primers of Gene Targets

A antisense sequence 3= NN HS R

GAAUCCCAUAGC UU X XUGACCGUGCUCC UU XCAGGUUCUCUAG UU XCUGAACAUGUCG UU X

TCTGCCCAAGTTCTC NA XGACGTGGAGAG NA XAAAUCUGUGUCC UU X XUGGUACUUCCUC UU XAGUGCUUCCAUC UU X X

ACAGAUAACACG UU XCAACGACACAGAAACTG NA XGTGGGTAATGGAGACAT NA XTCCTCCACCTTTGA NA XACCCTGTTGCTGTA NA XUCAUACCUUUGG UU XGCAUCUUGGAUC UU XUGAGGGUUUCGC UU XGAAGACAUCUGC UU XGATGTCAGTCATGCCCA NAGCTCATCAGACAATGGA NAUCACGUUAUCAG UU X

UGACCAUAUCGC UU XGUAAUCCUUUCA UU XCACACACAAUGC UU XCTTGGTGCTGATTTGTG NA XTGTGTCGACTGAGAAAT NA XCTGGCTCCATGACCGTT N XGCGTTCGTGAATAACCT NA X

primer sequences.Rattus.

mRNAs (dark) and rat mRNAs (light). siRNAs are shown as a blacknd, respectively. The location of each siRNA is given as a range of

A. The arrows indicate the approximate location of the forward and

LE

R

RN

UUCUCCGUGTGCCUAACU

CGAGCGACCCGAUAGCCUAAGAGU

AUCACATGGCCCAA

tes

ane eRN


PAI-1 activity decreases. Readings were normalized by dividing theabsorbance readings by the total protein content, determined usingCoomassie Plus- The Better Bradfort Assay Kit (Pierce; Rockford, IL)as instructed.

In Vivo Adhesion Prevention Model

The effect of gene down-regulation on the formation of abdomi-nopelvic adhesions was tested in a rat model of ischemic and serosalinjury. The animal housing and procedures were evaluated and ap-proved according to Swiss federal laws by the veterinary authority ofthe Canton of Vaud. There were 57 white female OFA rats dividedinto nine groups by a blinded surgeon: vehicle control (n � 9),control siRNA treatment (n � 5), and seven active siRNA treat-ments. The siRNA treatments were as follows siRNAHIF1� 1 nmol (n �7), siRNAHIF1� 4 nmol (n � 7), siRNAHIF1� 10 nmol (n � 4), siRNAPA1-1

1 nmol (n � 7), siRNAPA1-1 4 nmol (n � 7), siRNAPA1-1 10 nmol (n � 4),and siRNAHIF-1�, and siRNAPAI-1 4 nmol total, 2 nmol of each (n � 7).The vehicle control was 150 mM NaCl solution, the siRNA controlwas siRNA against lamin A/C, a non-essential nuclear membraneprotein, and the active siRNA treatment was siRNAs designedagainst 4 regions of each HIF-1� and PAI-1 genomes at concentra-tions indicated above. The surgeon was blinded to the treatment ofeach rat during surgery and post-mortem evaluation.

The surgeries were performed as follows. After an accommodationtime in the housing facility, anesthesia was induced and maintainedwith Isoflurane/O2. In dorsal recumbence, the abdominal region wasclipped and prepared for aseptic surgery. After a midline celiotomy,the urine horns were exposed, and the operating surgeon carefullyidentified the vessels of the uterine horn and cauterized them with-out damaging the main uterine artery, leaving the most proximaland distal mesometric vessel intact. The antimesometric woundingwas done using the pipolar cauter to create a 1-mm burn wound.After injury 1.5 ml of solution containing each treatment were added.The abdomen was closed with monofilament sutures and skin sta-ples. Analgesia was provided by an injection of buprenorphine (0.1mg/kg s.c.). The extent of adhesion formation was assessed 8 dayspost-surgery. One rat treated with control siRNA died because ofpost-operative complications and was not included in the statisticalanalysis.

An adhesion was defined as a connective tissue bridge involving aregion of the uterine horn with another region of the same horn, withthe contralateral horn, or with another tissue within the peritonealcavity. The extent of adhesion was defined as the percentage of thelength of the uterine horn involved in any adhesions. The lengths ofthe adhesions and of the uterine horns were measured with a ruler.For the clinical grading a previously published method by our labo-ratory was used [9, 31–33]. A 0 to 5 grade representing the severityof the adhesions was assigned, where 0 � no adhesions, 1 � adhe-sions from the mesometrium to the cautery wounds 2 � adhesionsconnecting the horns, 3 � horns massively adhered together, 4 �punctate adhesions to another organ, and 5 � severe adhesions toanother organ (bladder, intestine, etc.).

Statistics

All statistical analyses were performed using the computer pro-gram Prism (GraphPad, San Diego, CA). In vitro experiments wherestatistically analyzed using repeated measures analysis of varianceusing the Tukey test, which compares all pairs of columns, using a95% confidence interval. Two statistical analyses were used to ana-lyze the in vivo results on extent of adhesion. The nonparametricKruskal-Wallis test, which does not assume a Gaussian distribution,in conjunction with the Dunn’s test was used as our most powerfulstatistical analysis, using a 95% confidence interval. The Dunn’s testcompares all pairs of columns. There was no segregation of individ-ual treatment groups during the analysis. All groups saline control,siRNA , siRNA , siRNA :siRNA , and siRNA were
HIF1� PA1-1 HIF-1� PAI-1 laminA/C
analyzed simultaneously. The second statistical test used was the

less statistically powerful Mann-Whitney test, which allows for thedirect comparison of a treatment group to the control; a 95% confi-dence interval was used.

RESULTS

In Vitro Characterization of siRNA-MediatedGene Down-Regulation

Transfection of human fibroblasts resulted in down-regulation levels of 84% and 82% for PAI-1 and HIF-1�, respectively (Fig. 2A and 2B). Transfection of ratfibroblasts resulted in down-regulation levels of 97%and 69% for PAI-1 and HIF-1�, respectively (Fig. 2Cand 2D). To determine if there is any added or de-creased mRNA degradation when both genes are downregulated, simultaneous co-transfections were used(Fig. 3). Human fibroblasts were transfected with mix-tures of siRNAPAI-1:siRNAHIF-1� ranging from 100:0 to0:100. The resulting transfections showed the samelevel of mRNA degradation for all of the ratios tested.

Gene expression was quantified via RT-qPCR at dif-ferent time points to investigate the duration of the

FIG. 2. Relative mRNA expression levels in NHDF and RF aftersiRNAHIF1�/LF2000 and siRNAPAI-1/LF2000 transfection for human(dark) and rat (light) cells. RT-qPCR was used to quantify theamount of mRNA remaining 48-h post-tranfection using GAPDH asa housekeeping gene. The 2-��Ct method was used to calculate thepercent remaining activity. siRNAHIF1� and siRNAPAI-1 were efficientat mediating mRNA degradation with down-regulation levels of 82%and 84% for human (A) siRNAHIF1� and (C) siRNAPAI-1, respectively,and 69% and 97% for rat (B) siRNA and (D) siRNA , respec-
HIF1� PAI-1
tively. Data are plotted as the mean � SD.


siRNA mediated gene down-regulation (Fig. 4). The re-sulting mRNA quantifications showed that the down-regulation effect persisted for the duration of the study(8 days) with the same level of silencing for HIF-1�. In

FIG. 3. Relative mRNA expression levels in NHDF for (A,B)co-transfected cells with siRNAHIF1� and siRNAPAI-1. A total of 50 pmolof siRNA were used at different siRNAHIF1� to siRNAPAI-1 ratios at 48 hthe mRNA was extracted an mRNA levels quantified using RT-qPCR. The 2-��Ct method was used to calculate the percent remainingactivity. Data are plotted as the mean � SD.

FIG. 4. Relative mRNA expression levels in NHDF over time forsiRNAHIF1� and siRNAPAI-1 transfected cells. The extent of mRNAdegradation was analyzed over time after transfection with 25 pmolof siRNA or siRNA . The 2-��Ct method was used to calculate
HIF1� PAI-1
the percent remaining activity. Data are plotted as the mean � SD.

contrast, the level of PAI-1 transcript expression in-creased by 17% (from 94% to 77% down regulation)after 48 h and remained at this down-regulation levelfor the remaining time of the study (8 days). The levelof HIF-1� and PAI-1 transcript did not return to nor-mal levels for the duration of the study, indicating thatthe siRNA mediated down-regulation effect for thesegenes is long lasting in vitro.

In Vitro Characterization of PAI-1 Protein Activity

Down regulation of mRNA does not always directlycorrelate to reduced protein activity. A PAI-1 activityassay was used to determine the protein activity ofPAI-1 after siRNAPAI-1 and siRNAHIF 1� treatment withLF2000 (Fig. 5). Human fibroblasts were transfected asdescribed in the Materials and Methods. Media fromthe transfected cells was collected at 2 days post-trans-fection and assayed for PAI-1 activity. It was foundthat PAI-1 protein activity was statistically signifi-cantly decreased when human fibroblasts were trans-fected with siRNAPAI-1 and siRNAHIF-1� with P � 0.05and P � 0.01, respectively. Moreover, co-transfection ofsiRNAPAI-1 and siRNAHIF-1� also resulted in a statisti-cally significant decrease in PAI-1 activity (P � 0.01).There was no statistical difference between the treat-ment groups (P � 0.05).

In Vivo Prevention of Abdominal Adhesions

The ability of siRNA mediated down-regulation of

FIG. 5. A chromogenic substrate PAI-1 activity assay was usedto determine if PAI-1 expression was affected at the protein level.Transfection of NHDF with siRNAHIF1�, siRNAPAI-1, and a combina-tion of both (50:50) resulted in statistically significantly lower PAI-1protein activity compared to untreated cells. Total protein concen-tration was used to normalize the observed activity. Data are plottedas the mean � SD, * and ** means statistical significance to the levelof P � 0.05, and P � 0.01 (Tukey test multiple comparisons test),respectively.

HIF-1� and PAI-1 to prevent post-operative abdomi-


nopelvic adhesions was tested in an in vivo model ofprevention of de novo adhesions as detailed in theMaterials and Methods (Fig. 6). Delivery of three dif-ferent amounts of siRNA were used to assess the effec-tiveness of siRNAHIF-1� and siRNAPAI-1 as therapeutics,delivering 1, 4, and 10 nmol of siRNA with PEI as thedelivery vehicle (Fig. 6). Delivery of 4 nmol siRNAHIF-1�

(n � 7 rats) achieved a statistical significant reductionof abdominal adhesions compared to the saline control(n � 9 rats) with P � 0.05. It is worth noting that thedirect comparison of siRNAPAI-1 4 nmol (n � 7 rats) tothe saline control (n � 9 rats) using the non-parametricMann Whitney test results in statistical significantreduction of abdominal adhesions with P � 0.01, sug-gesting that the down-regulation of PAI-1 also has apositive effect.

A higher dose of siRNA, 10 nmol, did not furtherstatistically decrease the percent of abdominal adhe-sions for either siRNAHIF-1� and siRNAPAI-1 when com-pared with 4 nmol (Fig. 6B and 6C, P � 0.05); siRNAHIF-1�

and siRNAPAI-1 at 10 nmol did not result in statisticallysignificant lower adhesion extent than control (P �0.05).

To determine if the simultaneous delivery ofsiRNAHIF-1� and siRNAPAI-1 resulted in enhanced pre-vention of abdominal adhesion formation, 4 nmol totalof siRNA were delivered, 2 nmol siRNAHIF-1� and 2 nmolsiRNAPAI-1 (Fig. 6D). A higher dose of siRNA was notused, given that when 10 nmol was delivered a lessstatistically significant or non-statistically significantreduction of abdominal adhesions was obtained. It wasfound that the simultaneous delivery of siRNAHIF-1� and

FIG. 6. To assess if the percent of abdominal adhesions are reduadhesion model was used. Rats were operated intra-abdominally wprocedure, the rats were treated with saline (A), siRNALamin A/C/PEI (A)(D). Three treatment amounts (1, 4, and 10 nmol) were used for the tand 4 nmol of siRNALaminA/C resulted in a percent of abdominal adhein statistically significant reduction of abdominal adhesions comparepercent adhesions of 33 � 6. siRNAPAI-1 and the dual treatment of siRabdominal adhesions compared directly to saline (symbol ††, P � 0.040 � 7, respectively. Data are plotted as the mean � SEM.

siRNAPAI-1 resulted in a statistically significant reduc-

tion of abdominal adhesions with P � 0.01 only ifcompared directly with the saline control using theMann-Whitney test.

The clinical grade of the abdominal adhesions wasimproved when siRNAHIF-1� was delivered intraperito-neally (Fig. 7). The clinical grade represents the sever-ity of the adhesions present, with zero indicating theabsence of adhesions and five the presence of severeadhesions with adjacent organs. The clinical grade forsaline controls was 2.0 � 0.3, whereas for the 4 nmoldose siRNAHIF-1� and siRNAPAI-1 the average was 1.1 �0.3 and 1.4 � 0.3, respectively, indicating that that theseverity of the adhesions encountered was lower for thesiRNAHIF-1� and siRNAPAI-1 treated animals. The dualdelivery of siRNAHIF-1� and siRNAPAI-1, delivering 2 nmolof each, had a clinical grade average of 1.6 � 0.6 withP � 0.17. One of the animals in this group resulted inan adhesion to the colon (clinical grade � 5), which wasnot encountered with any other group including thesaline control.

DISCUSSION

After surgery, fibrin within the peritoneal cavity isnaturally degraded by mesothelial cells via plasmin-ogen activation by plasminogen activator (PA). Thereduced ability of mesothelial cells to degrade fibrindeposited after abdominopelvic surgery has been at-tributed in part to the inhibition of PA activity by plas-minogen activator inhibitor type 1 (PAI-1) [4]. Intra-abdominal levels of PAI-1 as well as the amount of tPAcomplexes with PAI-1 have been found to increase inadhesion tissue [14, 15]. Elevated TGF-�1 has also

after treatment with siRNAHIF1�/PEI and siRNAPAI-1/PEI, an in vivoadhesions induced along the uterus horns. Immediately after theNAHIF1�/PEI (B), and siRNAPAI-1/PEI (C) and siRNAHIF1�:siRNAPAI-1/PEI

apeutic genes to determine the effectiveness of the approach. Salines of 69 � 5 and 60 � 8 respectively. siRNAHIF1� treatment resultedith saline for 4 nmol (symbol *, P � 0.05, Kruskal-Wallis test) withHIF1� and siRNAPAI-1 resulted in a statistical reduction in the percent

using the Mann-Whitney test with percent adhesions of 44 � 8 and

cedith, siRhersiond wNA1)

been associated with a local impairment of fibrinolytic


capacity after abdominal surgery, elevated peritonealconcentrations of active TGF-�1 in tissues being corre-lated with severe adhesions [15]. Moreover, TGF-�1decreases the expression of matrix metalloproteinases(MMPs) and increases the expression of tissue inhibi-tors of MMPs (TIMP) [34]. A decreased MMP-1 and anincreased TIMP-1 expression has been found to corre-late with the presence of severe adhesions in humans[35, 36]. Furthermore, peritoneal mesothelial hypoxia,which can be induced by microvascular damage asso-ciated with surgery, has been suggested to correlatewith adhesion formation [37], likely through the acti-vation of hypoxia inducible factor 1 (HIF-1). HIF-1� isa transcription factor that is regulated by cellular ox-ygen levels and regulates the activation of hypoxiainducible genes such as VEGF [38] and TGF-� [37],which in turn regulates PAI-1 expression [39]. siRNAmediated down-regulation of HIF-1� in cancer cellshas been shown to reduce the protein concentration ofVEGF and TGF-� [40]. Thus, we sought to temporarilydown-regulate the gene expression of HIF-1� and PAI-1as a strategy to reduce the expression of hypoxia in-ducible genes in the abdominopelvic cavity, to preventthe formation of post-operative abdominal adhesionsby enhancing fibrinolysis and by down-regulating po-tentially scar-forming growth factors.

To understand the mechanism by which delivery ofsiRNAHIF-1� and siRNAPAI1 decrease the percent of ab-dominal adhesions in vivo an in vitro PAI-1 activityassay was performed. In vitro analysis of siRNAHIF-1�

mRNA down-regulation showed that the down-regu-lation of HIF1-� did not affect the expression of PAI-1at the mRNA level at 48 h. At the protein level, how-ever, the down-regulation of HIF-1� lead to a statisti-cally significant decrease of PAI-1 activity, suggestingthat HIF-1� down-regulation affects the overall abilityof PAI-1 to inactivate uPA and tPA. This result can be

FIG. 7. The clinical grade of resulting adhesions after treatment wthe procedure the rats were treated with saline (A), siRNALamin A/C/PEI (A(D). A grade of 1 to 5 was used with 0 � no adhesions, 1 � adhesions fthe horns, 3 � horns massively adhered together, 4 � punctate ad(bladder, intestine, etc.). Data are plotted as the mean � SEM.

explained with findings that delivery of siRNAHIF-1� up-

regulates the expression of uPA receptor (uPAR) at theprotein level [40, 41]. Moreover, under hypoxic condi-tions, HIF-1� has been shown to enhance PAI-1 ex-pression [42]. As expected, PAI-1 protein activity wasdecreased when siRNAPAI-1 was delivered.

Our findings that siRNAPAI-1/PEI complex deliveredafter abdominopelvic surgery statistically decreasesthe amount of adhesion formation when the Mann-Whitney test is used supports that up-regulation ofPAI-1 plays a major role in adhesion formation. Previ-ous successful molecular therapeutic approaches tar-geting the tPA-to-PAI-1 balance have focused on thedirect inhibition of PAI-1 using antibodies [10] or thedelivery of tPA by recombinant protein delivery [9].However, the cost associated with recombinant proteinand antibody production has made these approaches oflimited practical impact. Interestingly, our results alsoindicate that down-regulation of PAI-1 alone is not aseffective as down regulation of HIF-1� indicating thatother pathways such as matrix assembly and fibroblastrecruitment may play a major role in adhesion forma-tion.

Although HIF-1� modulates the expression of mol-ecules often associated with post-operative abdomi-nal adhesion formation and has been suggested toplay a role in adhesion formation [37], to our knowl-edge, it has not been previously used as a therapeu-tic target to prevent adhesion formation. We investi-gated the use of the RNAi pathway to down-regulatethe expression of HIF-1� in the hopes blunting thenegative effects of hypoxia on up-regulating nuclearHIF-1� after surgery. Our results show a statisticallygreater reduction of abdominopelvic adhesions whenrats were treated with siRNA targeting HIF-1� insteadof PAI-1 for the similar siRNA concentrations (P �0.05), suggesting that the multiple pathways that aresimultaneously affected may cause a greater effect. For

siRNAHIF1�/PEI and siRNAPAI-1/PEI was assessed. Immediately afterRNAHIF1�/PEI (B) and siRNAPAI-1/PEI (C), and siRNAHIF1�:siRNAPAI-1/PEI

the mesometrium to the cautery wounds, 2 � adhesions connectingions to another organ, and 5 � severe adhesions to another organ

ith), siromhes

example, HIF-1� regulates the expression of TGF-�


[43], which is a major regulator of extracellular matrixdeposition, by stimulating its synthesis or degradationdepending on environmental conditions. Furthermore,TGF-� regulates PAI-1 expression [39] and the balanceof MMPs and tissue inhibitors of MMPs [44, 45]. More-over, TGF-�1 is chemotactic for fibroblasts and pro-motes cell proliferation, differentiation and angiogenesis[44, 45], features characteristic of the vascularizationand fibrous tissue formation phase of adhesion forma-tion. Further studies investigating the role of HIF-1�in the molecular fingerprint of adhesion formation areneeded to better understand the ramifications associ-ated with its down-regulation and the results obtainedin this report.

Interestingly, the delivery of 10 nmol of siRNA/PEIwas less effective than the delivery of 4 nmol of siRNA/PEI for both HIF-1� and PAI-1, suggesting a detrimen-tal effect of high amount of siRNA or siRNA/PEI com-plex delivery. The clinical grade of 1 nmol and 4 nmolof siRNAHIF-1�/PEI complexes was lower than that of10 nmol, suggesting that the complexes might alsohave a negative effect, promoting adhesion formation.This may be because of the limited biocompatibility ofPEI as a transfection vector in vivo [46], emphasizingthe need for continued vector development for siRNAdelivery.

For surgically associated therapies, such as periop-erative administration of a bioactive molecule in pre-vention of abdominal adhesions, delivery of siRNA maybe advantageous over antibody and recombinant pro-tein delivery because of its catalytic nature; one siRNAmolecule can degrade multiple mRNAs. In contrast, de-livery of antibodies requires one molecule to be presentper molecule to be inhibited, meaning a one-to-one ther-apeutic effect. Furthermore, an in vitro time course ofsiRNA mediated mRNA degradation showed that themRNA of HIF-1� and PAI-1 remained down regulatedfor up to 8 d, indicating that the therapeutic effect maybe long lasting once the cells are transfected. In con-trast, antibodies and recombinant proteins are clearedrapidly from the abdominal cavity, potentially limitingtheir therapeutic effects [10]. The catalytic nature ofsiRNA and its possible long lasting down-regulation invivo would reduce the cost associated with this molec-ular therapy, compared to recombinant protein deliv-ery, and the number of doses a patient would need toobtain a therapeutic effect.

In summary, delivery of siRNAHIF-1�/PEI complexesimmediately after abdominopelvic surgery resulted ina reduction of the extent and severity of abdominaladhesion found 7 days post-surgery, probably becauseof a combination of enhanced fibrinolysis and impairedmatrix assembly. This effect required delivery of 4 nmolof siRNA to achieve a therapeutic effect without toxic-ity or undesired side effects. Lower amounts did not
result in statistically significant reduction of abdomi-
nal adhesions, suggesting that PEI is not an efficientdelivery vehicle in the peritoneal cavity and that thesiRNA/PEI complexes are maybe being cleared or de-graded rapidly. Higher amounts also resulted in less ofa therapeutic effect, perhaps because of intrinsic bioin-compatibilty of the polycation PEI as a vector. Theresults of this study validate siRNAHIF-1� as potentiallyuseful targets in post-operative adhesion preventionand point to the need for more effective and biocompat-ible delivery vectors.

ACKNOWLEDGMENTS

We would like to thank Helen Kyd for experimental laboratoryassistance, Thomas Barker, Harry Bermudez, Annette Matthies,Catharina Adeloew, and Dominique A. Rothenfluh for discussion andcomments on the manuscript.

Funding for this research was provided by the National Institutesof Heath and the Ecole Polytechnique Fédérale de Lausanne. Thisproject was supported in part by grant F32GM72428 (TS).

REFERENCES

1. Menzies D, Ellis H. Intestinal obstruction from adhesions: Howbig is the problem? Ann R Coll Surg Engl 1990;72:60.

2. Menzies D. Postoperative adhesions: Their treatment and rel-evance in clinical practice. Ann R Coll Surg Engl 1993;75:147.

3. Diamond MP, Hershlag A. Adhesion formation/reformation.Prog Clin Biol Res 1990;358:23.

4. Holmdahl L, Eriksson E, al-Jabreen M, et al. Fibrinolysis inhuman peritoneum during operation. Surgery 1996;119:701.

5. Boland GM, Weigel RJ. Formation and prevention of postoper-ative abdominal adhesions. J Surg Res 2006;132:3, Epub 2006Feb 2.

6. Risberg B. Adhesions: Preventive strategies. Eur J Surg 1997;(Suppl):32.

7. Montz FJ, Fowler JM, Wolff AJ, et al. The ability of recombi-nant tissue plasminogen activator to inhibit post-radical pelvicsurgery adhesions in the dog model. Am J Obstet Gynecol1991;165:1539.

8. Dunn RC, Mohler M. Effect of varying days of tissue plasmin-ogen activator therapy on the prevention of postsurgical adhe-sions in a rabbit model. J Surg Res 1993;54:242.

9. Hill-West JL, Dunn RC, Hubbell JA. Local release of fibrinolyticagents for adhesion prevention. J Surg Res 1995;59:759.

10. Falk K, Bjorquist P, Stromqvist M, et al. Reduction of experi-mental adhesion formation by inhibition of plasminogen acti-vator inhibitor type 1. Br J Surg 2001;88:286.

11. Fukui N, Tashiro T, Hiraoka H, et al. Adhesion formation canbe reduced by the suppression of transforming growth factor-beta1 activity. J Orthop Res 2000;18:212.

12. Lucas PA, Warejcka DJ, Young HE, et al. Formation of abdom-inal adhesions is inhibited by antibodies to transforminggrowth factor-beta1. J Surg Res 1996;65:135.

13. Saltzman AK, Olson TA, Mohanraj D, et al. Prevention ofpostoperative adhesions by an antibody to vascular permeabil-ity factor/vascular endothelial growth factor in a murine model.Am J Obstet Gynecol 1996;174:1502.

14. Ivarsson ML, Bergstrom M, Eriksson E, et al. Tissue markersas predictors of postoperative adhesions. Br J Surg 1998;85:1549.

15. Holmdahl L, Kotseos K, Bergstrom M, et al. Overproduction of


transforming growth factor-beta1 (TGF-beta1) is associated withadhesion formation and peritoneal fibrinolytic impairment.Surgery 2001;129:626.

16. Fitzpatrick TE, Graham CH. Stimulation of plasminogen acti-vator inhibitor-1 expression in immortalized human tropho-blast cells cultured under low levels of oxygen. Exp Cell Res1998;245:155.

17. Uchiyama T, Kurabayashi M, Ohyama Y, et al. Hypoxia in-duces transcription of the plasminogen activator inhibitor-1gene through genistein-sensitive tyrosine kinase pathways invascular endothelial cells. Arterioscler Thromb Vasc Biol 2000;20:1155.

18. Kietzmann T, Roth U, Jungermann K. Induction of the plas-minogen activator inhibitor-1 gene expression by mild hypoxiavia a hypoxia response element binding the hypoxia-induciblefactor-1 in rat hepatocytes. Blood 1999;94:4177.

19. Zhang Q, Wu Y, Chau CH, et al. Crosstalk of hypoxia-mediatedsignaling pathways in upregulating plasminogen activatorinhibitor-1 expression in keloid fibroblasts. J Cell Physiol 2004;199:89.

20. Kietzmann T, Samoylenko A, Roth U, et al. Hypoxia-induc-ible factor-1 and hypoxia response elements mediate theinduction of plasminogen activator inhibitor-1 gene expres-sion by insulin in primary rat hepatocytes. Blood 2003;101:907.

21. Elbashir SM, Harborth J, Lendeckel W, et al. Duplexes of21-nucleotide RNAs mediate RNA interference in culturedmammalian cells. Nature 2001;411:494.

22. Schiffelers RM, Ansari A, Xu J, et al. Cancer siRNA therapy bytumor selective delivery with ligand-targeted sterically stabi-lized nanoparticle. Nucleic Acids Res 2004;32:e149.

23. Urban-Klein B, Werth S, Abuharbeid S, et al. RNAi-mediatedgene-targeting through systemic application of polyethyleni-mine (PEI)-complexed siRNA in vivo. Gene Ther 2005;12:461.

24. Banerjea A, Li MJ, Bauer G, et al. Inhibition of HIV-1 bylentiviral vector-transduced siRNAs in T lymphocytes differen-tiated in SCID-hu mice and CD34� progenitor cell-derivedmacrophages. Mol Ther 2003;8:62.

25. Wu CJ, Huang HW, Liu CY, et al. Inhibition of SARS-CoVreplication by siRNA. Antiviral Res 2005;65:45.

26. Soutschek J, Akinc A, Bramlage B, et al. Therapeutic silencingof an endogenous gene by systemic administration of modifiedsiRNAs. Nature 2004;432:173.

27. Zender L, Hutker S, Liedtke C, et al. Caspase 8 small interfer-ing RNA prevents acute liver failure in mice. Proc Natl Acad SciUSA 2003;100:7797.

28. Hassani Z, Lemkine GF, Erbacher P, et al. Lipid-mediatedsiRNA delivery down-regulates exogenous gene expression inthe mouse brain at picomolar levels. J Gene Med 2005;7:198.

29. Xia H, Mao Q, Eliason SL, et al. RNAi suppresses poly-glutamine-induced neurodegeneration in a model of spinocere-bellar ataxia. Nat Med 2004;10:816.

30. Livak KJ, Schmittgen TD. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(-Delta Delta
C(T)) method. Methods 2001;25:402.
31. Chowdhury SM, Hubbell JA. Adhesion prevention with ancrodreleased via a tissue-adherent hydrogel. J Surg Res 1996;61:58.

32. Winblade ND, Schmokel H, Baumann M, et al. Sterically block-ing adhesion of cells to biological surfaces with a surface-activecopolymer containing poly(ethylene glycol) and phenylboronicacid. J Biomed Mater Res 2002;59:618.

33. Elbert DL, Hubbell JA. Reduction of fibrous adhesion formationby a copolymer possessing an affinity for anionic surfaces.J Biomed Mater Res 1998;42:55.

34. Chegini N. The role of growth factors in peritoneal healing:Transforming growth factor beta (TGF-beta). Eur J Surg Suppl1997;17.

35. Chegini N, Kotseos K, Bennett B, et al. Matrix metalloprotein-ase (MMP-1) and tissue inhibitor of MMP in peritoneal fluidsand sera and correlation with peritoneal adhesions. Fertil Steril2001;76:1207.

36. Chegini N, Kotseos K, Zhao Y, et al. Expression of matrixmetalloproteinase (MMP-1) and tissue inhibitor of MMP inserosal tissue of intraperitoneal organs and adhesions. FertilSteril 2001;76:1212.

37. Molinas CR, Mynbaev O, Pauwels A, et al. Peritoneal mesothe-lial hypoxia during pneumoperitoneum is a cofactor in adhesionformation in a laparoscopic mouse model. Fertil Steril 2001;76:560.

38. Molinas CR, Campo R, Elkelani OA, et al. Role of hypoxiainducible factors 1alpha and 2alpha in basal adhesion forma-tion and in carbon dioxide pneumoperitoneum-enhanced adhe-sion formation after laparoscopic surgery in transgenic mice.Fertil Steril 2003;80(Suppl):795.

39. Tietze L, Elbrecht A, Schauerte C, et al. Modulation of pro- andantifibrinolytic properties of human peritoneal mesothelialcells by transforming growth factor beta1 (TGF-beta1), tumornecrosis factor alpha (TNF-alpha) and interleukin 1beta (IL-1beta). Thromb Haemost 1998;79:362.

40. Krishnamachary B, Berg-Dixon S, Kelly B, et al. Regulation ofcolon carcinoma cell invasion by hypoxia-inducible factor 1.Cancer Res 2003;63:1138.

41. Graham CH, Fitzpatrick TE, McCrae KR. Hypoxia stimulatesurokinase receptor expression through a heme protein-depen-dent pathway. Blood 1998;91:3300.

42. Kimura D, Imaizumi T, Tamo W, et al. Hypoxia enhances theexpression of plasminogen activator inhibitor-1 in human lungcancer cells, EBC-1. Tohoku J Exp Med 2002;196:259.

43. Saed GM, Zhang W, Chegini N, et al. Transforming growthfactor beta isoforms production by human peritoneal mesothe-lial cells after exposure to hypoxia. Am J Reprod Immunol2000;43:285.

44. Border WA, Ruoslahti E. Transforming growth factor-beta indisease: The dark side of tissue repair. J Clin Invest 1992;90:1.

45. Massague J. The transforming growth factor-beta family. AnnuRev Cell Biol 1990;6:597.

46. Lungwitz U, Breunig M, Blunk T, et al. Polyethylenimine-based non-viral gene delivery systems. Eur J Pharm Biopharm
2005;60:247.

RNA Interference Targeting Hypoxia Inducible Factor 1α Reduces Post-Operative Adhesions in Rats

Documents

Transcript of RNA Interference Targeting Hypoxia Inducible Factor 1α Reduces Post-Operative Adhesions in Rats