Porphyromonas gingivalis induces myocarditis and/ormyocardial infarction in mice and IL-17A is involved inpathogenesis of these diseases

Yuki Akamatsu a,*, Toshiro Yamamoto b, Kenta Yamamoto a, Fumishige Oseko b,Narisato Kanamura b, Jiro Imanishi a, Masakazu Kita a

aDepartment of Microbiology, Kyoto Prefectural University of Medicine Graduate School of Medical Science, 465, Kajii-cho,

Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto, 602-8566, JapanbDepartment of Dental Medicine, Kyoto Prefectural University of Medicine Graduate School of Medical Science, 465, Kajii-cho,

Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto, 602-8566, Japan

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 8

a r t i c l e i n f o

Article history:

Accepted 25 May 2011

Keywords:

Porphyromonas gingivalis

IL-17A

Cardiovascular diseases

Pathogenesis

a b s t r a c t

Objectives: Although an association between periodontitis and cardiovascular diseases has

been suggested, the role of Porphyromonas gingivalis in cardiovascular diseases is not clear. In

this study, we examined whether experimental bacteremia of P. gingivalis causes cardio-

vascular diseases and investigated the mechanism of pathogenesis of cardiovascular

diseases induced by P. gingivalis.

Design: C57BL/6 mice were intravenously inoculated with 2.0 � 108 CFU of P. gingivalis A7436

strain. Mice were sacrificed at specified days and their hearts were collected. The collected

organs were divided into two halves and used for histological evaluation and cytokine

analysis. IL-17A�/�, IFN-g�/� and TNF-a�/�mice were also intravenously inoculated and the

histological changes of hearts in mice were examined.

Results: Myocarditis and/or myocardial infarction were observed in mice injected with P.

gingivalis. The levels of IL1-b, IL-6, IL-17A, IL-18, TNF-a and IFN-g mRNA increased signifi-

cantly after P. gingivalis injection. In particular, high levels of IL-17A and IFN-g mRNA

expression were observed in hearts of mice after P. gingivalis injection in comparison with

these levels before injection. Furthermore, the production of IL-17A was detected in hearts

of wild-type mice after P. gingivalis injection. In wild-type, TNF-a�/� and IFN-g�/� mice,

moderate infiltration of neutrophils and monocytes was observed in hearts at 5 days after

injection. In contrast, no inflammatory findings were observed in hearts of IL-17A�/� mice.

Conclusion: We have demonstrated that an experimental bacteremia of P. gingivalis could

induce myocarditis and/or myocardial infarction in mice, and IL-17A plays an important role

in the pathogenesis of these diseases.

# 2011 Elsevier Ltd. All rights reserved.

avai lab le at w ww.s c ienc ed i rec t . c o m

journal homepage: http://www.elsevier.com/locate/aob

1. Introduction

Dental treatment is known to be the major causative agent for

bacteremia and procedures that generally cause bleeding,

* Corresponding author. Tel.: +81 75 2515329, fax: +81 75 2515331.E-mail address: akamatsu@koto.kpu-m.ac.jp (Y. Akamatsu).

0003–9969/$ – see front matter # 2011 Elsevier Ltd. All rights reservedoi:10.1016/j.archoralbio.2011.05.012

such as tooth extraction, periodontal surgery, scaling and root

planing, are considered to frequently lead to its development.1

Furthermore, bacteremia has been reported after daily routine

oral hygiene procedures including tooth brushing and dental

flossing, and even from chewing.2 In fact, a majority of the

d.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 8 1291

present specimens (approximately 80% of the heart valves,

90% of the aortic aneurysms) were positive for at least one of

the tested oral bacterial species.3 These findings indicate that

oral bacteria frequently enter the bloodstream and may invade

cardiovascular tissues following dental treatments and after

the performance of routines of daily life. Recently, an

association between periodontitis and cardiovascular diseases

has been suggested, based on reports that bacterial DNA

corresponding to periodontitis-related species was detected in

cardiovascular tissues using PCR in the coronary heart disease

(CAD) patients.3,4 The main cause of periodontitis is bacteria

such as Porphyromonas gingivalis (P. gingivalis), Aggregatibacter

actinomycetemcomitans (A. actinomycetemcomitans), Prevotella

intermedia (P. intermedia) and Fusobacterium nucleatum (F.

nucleatum). These bacteria have been strongly associated with

the aetiology of chronic periodontitis and aggressive peri-

odontitis.5

P. gingivalis has been strongly associated with the most

common form of periodontal disease, and it is reported that

periodontal disease with elevated bacterial exposure is

associated with coronary heart disease (CHD) events and

early atherogenesis, suggesting that the level of systemic

bacterial exposure from periodontitis is biologically pertinent

to atherosclerotic risk.6–9 On the other hand, it was reported

that P. gingivalis fimbriae and vesicles possess platelet

aggregation-inducing activity, and that gingipain, which is a

cysteine protease produced by P. gingivalis, has a function for

cell apoptosis, induction of inflammatory cytokines and

disruption of polymorphonuclear leukocytes.10–14 However,

the effects of bacteremia with P. gingivalis on heart have not yet

been studied, although in vivo study has been undertaken for

atherosclerosis using a bacteremia model with P. gingivalis.8

It is well known that cytokines are involved in the

pathogenesis of periodontal disease and heart disease. We

have previously reported that human periodontal ligament

(hPDL) cells produce many kinds of inflammatory cytokine

such as interleukin (IL)-1b, IL-6, IL-8 and TNF-a by stimula-

tion with P. gingivalis.15 Gotsman et al.7 showed that the

levels of these cytokines in blood significantly increased in

CAD patients in comparison with those of non-CAD

patients. Furthermore, the levels of TNF-a and IFN-g have

been found to be elevated both in coronary arteries and in

peripheral blood of patients affected by coronary acute

syndrome.16 IL-17 is the earliest identified member of an

emerging family of inflammatory cytokines. IL-17 has been

found in inflammatory and autoimmune conditions includ-

ing rheumatoid arthritis. It was reported that the level of IL-

17 increased in blood of CAD patients, but not in blood of

patients with acute coronary syndrome.17,18 In addition, IL-

17 may be involved in the pathogenesis of periodontal

diseases.18 IL-18 is also a proinflammatory cytokine, which

is produced mainly by monocytes and macrophages. IL-18

induces Th1 cytokine to cooperate with IL-12, acts in

reinforcement action of IFN-g, and plays a critical role in

host defence mechanisms against infection.19,20 In a clinical

report, plasma IL-18 level was identified as an independent

predictor of CHD in healthy, middle-aged men and men

with risk factors for atherosclerosis and CAD.21 These

proinflammatory and inflammatory cytokines may be

involved in pathogenesis of heart diseases.

The purpose of this study is to examine whether

experimental bacteremia of P. gingivalis causes cardiovascular

diseases and to elucidate the mechanism of pathogenesis of

cardiovascular diseases induced by P. gingivalis. Therefore, we

investigated the role of cytokines in the development of

cardiovascular diseases by comparing wild-type mice with

IFN-g gene knockout (IFN-g�/�) mice, TNF-a gene knockout

(TNF-a�/�) mice and IL-17A gene knockout (IL-17A�/�) mice.

2. Materials and methods

2.1. Experimental animals

The wild-type C57BL/6 mice and mice from C57BL/6 back-

ground with targeted disruption of TNF-a (TNF-a�/�), IFN-g

(IFN-g�/�) and IL-17A (IL-17A�/�) used in this study were

specific pathogen-free 5-week-old males. All animals were

housed under the conditions of controlled temperature

(21 � 2 8C), humidity (45–50%) and a 12 h dark–light cycle.

The wild-type C57BL/6 mice were purchased from Charles

River Japan (Yokohama, Japan), whilst TNF-a�/�, IFN-g�/� and

IL-17A�/�mice were obtained from the Center for Experimen-

tal Medicine, Institute of Medical Science, University of Tokyo.

The mice were all maintained in a barriered animal facility

under pathogen-free conditions at Kyoto Prefectural Univer-

sity of Medicine. All equipment and supplies including cages,

water bottles, wooden chips and food pellets were sterilized.

Under these conditions, TNF-a�/�, IFN-g�/�, IL-17A�/� and

wild-type mice grew normally and healthily. All animal

studies were approved by the Animal Care and Use Committee

of Kyoto Prefectural University of Medicine.

2.2. Preparation of periodontal bacteria

P. gingivalis wild-type strain A7436 is composed of gram-

negative short rods. P. gingivalis A7436 was supplied by Genco

CA at Boston University. The bacteria were grown anaerobi-

cally on 5% sheep blood agar plates (Nissui Pharmaceutical

Co., Tokyo, Japan) at 37 8C for 48–72 h. Bacterial colonies grown

on 5% sheep blood agar plates were harvested aseptically from

the agar surface and immediately suspended in PBS (�)

solution and stored at �80 8C. Bacteria was grown anaerobi-

cally in Anaerobe Broth MIC (AB, DIFCO, Detroit, MI) for 2 to 3

days until the cultures reached OD (A600) of 1, as determined

using a spectrophotometer (Hitachi High-tech, Tokyo, Japan).

This absorbance corresponded to approximately 109 CFU/mL.

The bacterial cells were concentrated by centrifugation at

3000 rpm (10 min, room temperature) and resuspended in

1 mL of PBS (�) solution. Viable bacterial counts were

determined immediately prior to inoculation by serial dilu-

tion.

2.3. Injection with periodontal bacteria

To observe the pathogenic reaction of P. gingivalis injection for

hearts of mice, male C57BL/6 mice at 5 weeks of age were

intravenously inoculated with 2.0 � 108 CFU of P. gingivalis.22

Moreover, to observe the reaction of P. gingivalis reinjection for

hearts, After 2 weeks, mice were intravenously re-inoculated

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 81292

with 2.0 � 108 CFU of P. gingivalis. Mice injected with P.

gingivalis were sacrificed at specified days and their hearts

were collected (n = 5 per group for each day) (Fig. 1A). Mice that

were not injected with P. gingivalis were used as controls.

To observe whether TNF-a, IFN-g and IL-17A are involved in

the pathogenesis of hearts injected with P. gingivalis, TNF-a

(TNF-a�/�), IFN-g (IFN-g�/�) and IL-17A (IL-17A�/�) mice at 5

weeks of age were intravenously inoculated with 2.0 � 108 CFU

of P. gingivalis. Mice injected with P. gingivalis were sacrificed at

5 days after P. gingivalis injection and their hearts were

collected.

2.4. Expression of cytokine mRNA in hearts of mice

Total RNA was extracted using ISOGEN (Nippon Gene,

Tokyo, Japan), and the expression of cytokine mRNA was

determined using reverse transcription-polymerase chain

reaction (RT-PCR). The mRNA expressions of IL-1b, IL-6, IL-

17A, IL-18, tumour necrosis factor (TNF)-a and interferon

(IFN)–g were analysed. b-actin was used as an internal

control. For RT-PCR, we used our previously reported

procedure.15 Briefly, total RNA was extracted with ISOGEN

and cDNA was produced using Superscript RNase H Reverse

Transcriptase (Invitrogen, Carlsbad, CA, USA), oligo dT

primer and 2.5 mM dNTP Mixture (Takara Shuzo, Otsu,

Japan). PCR was performed for 35 cycles, each consisting of

1 min at 95 8C for denaturation, 1 min at 50 8C for annealing

and 1 min at 72 8C for extension. 10 mL of each PCR product

was analysed by electrophoresis on a 1.5% agarose gel

Fig. 1 – Experimental protocol and body weight change. (A) Exp

after P. gingivalis injection (n = 7). A temporary decrease in body

containing ethidium bromide (Bio-Rad Laboratories, Hercu-

les, CA, USA), and the bands were visualized under UV light

Illuminator FAS-III (Toyobo, Osaka, Japan).

2.5. Level of cytokine mRNA in hearts of mice

To quantify the amount of mRNA in the hearts of mice, we

performed real-time PCR (LightCycler 3.5) using TaqMan

Master (Roche Diagnostics GmbH, Mannheim, Germany).

The real-time PCR reaction mixture of 20 mL contained 4 mL

of master mix (Roche Diagnostics GmbH, Mannheim,

Germany), 10.4 mL of distilled water, 5 � cDNA, Universal

ProbeLibrary probe (Roche Diagnostics GmbH, Mannheim,

Germany) and a pair of primers. Primers were designed using

Universal ProbeLibrary Assay Design Center (Roche Diagnos-

tics GmbH, Mannheim, Germany). Glyceraldehyde-3-phos-

phate (GAPDH) was used as an internal control and nuclease-

free water was used as a negative control. The primer

sequences are shown in Table 1.

Total RNA was extracted with ISOGEN, and cDNA was

produced using Superscript RNase H Reverse Transcriptase

(Invitrogen, Carlsbad, CA, USA), random primer (Invitrogen,

Carlsbad, CA, USA) and 2.5 mM dNTP mixture (Takara Shuzo,

Otsu, Japan). Real-time PCR was carried out with a LightCycler

instrument (Roche Diagnostics GmbH, Mannheim, Germany).

The amplification programme consisted of 1 cycle at 95 8C for

10 min, followed by 45 cycles at 95 8C and 60 8C, each

consisting of 10 s at 95 8C for denaturing and 30 s at 60 8C

for annealing and extension.

erimental protocol. (B) Body weight change of C57BL/6 mice

weight was observed 24–36 h after injection.

Table 1 – Sequences of real-time PCR primer pair for mouse cytokine genes.

Cytokine Primer Sequence Length (bp)

GAPDH L TGTCCGTCGTGGATCTGAC 19

R CCTGCTTCACCACCTTCTTG 20

IL-1b L TGTAATGAAAGACGGCACACC 21

R TCTTCTTTGGGTATTGCTTGG 21

IL-6 L GCTACCAAACTGGATATAATCAGGA 25

R CCAGGTAGCTATGGTACTCCAGAA 24

IL-17 L CAGGGAGAGCTTCATCTGTGT 21

R GCTGAGCTTTGAGGGATGAT 20

IL-18 L CATGTACAAAGACAGTGAAGTAAGAGG 27

R TTTCAGGTGGATCCATTTCC 20

IFN-g L ATCTGGAACTGGCAAAA 20

R TTCAAGACTTCAAAGAGTCTGAGGTA 26

TNF-a L TCTTCTCATTCCTGCTTGTGG 21

R GGTCTGGGCCATAGAACTGA 20

Abbreviations: GAPDH, Glyceralde-Hyde-3-phosphate; IL, interleukin; IFN-g, interferon-g; TNF-a, tumour necrosis factor-a.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 8 1293

To evaluate the relative quantitation of mRNA in hearts of

mice, we performed analysis using the comparative threshold

cycle (Ct) method.23 Briefly, the quantity of gene mRNA in the

target sample as a reference to gene mRNA in a normal sample

is given by 2-DDCt, where DDCt = [Ct of the unknown gene in

the target sample � Ct of the internal gene in the target

sample] � [Ct of the unknown gene in the calibrator sam-

ple � Ct of the internal gene in the calibrator sample]. Heart

tissue from non-infected mice was used as the calibrator

sample.

2.6. Production of cytokine in hearts of mice injected withP. gingivalis

IL-17A in homogenized heart of mice was measured using

enzyme-linked immunosorbent assay (ELISA) kits (R&D

systems, Minneapolis, MN, USA). The assay was conducted

in accordance with the manufacturer’s instructions and the

concentrations of IL-17A were determined using a standard

curve. The absorbance of each well was determined with a

micro- plate reader (Molecular Devices, USA) at 450 nm.

2.7. Histology in hearts of mice injected with P. gingivalis

Specimens of heart tissue from C57BL/6 mice before and after

P. gingivalis injection were dissected, fixed in 4% paraformal-

dehyde dissolved in 0.1 M phosphate buffer for 24 h and then

embedded in paraffin after dehydration treatment. Tissue

sections (10 mL) mounted on poly-L-lysine-coated glass slides

were deparaffinized with xylene. Finally, the sections were

rinsed in distilled water, counterstained with haematoxylin

(Vector Laboratories, Burlingame, CA) and eosin (Wako,

Osaka, Japan), treated with dehydration and penetration,

and coverslipped with Mount-Quick (Cosmo Bio Co., Tokyo,

Japan). The images were observed using FX-380 (Olympus,

Osaka, Japan).

To observe whether TNF-a, IFN-g and IL-17A are involved

in the pathogenesis of hearts injected with P. gingivalis,

specimens of heart tissue from TNF-a (TNF-a�/�), IFN-g (IFN-

g�/�) and IL-17A (IL-17A�/�) mice at 5 days after P. gingivalis

injection were dissected and stained with haematoxylin and

eosin.

2.8. Statistical analysis

Data are expressed as mean � standard error (SE). Compar-

isons between groups were made using the paired t-test.

Differences were considered significant at p < 0.01, p < 0.05.

Statistical analysis was performed using Prism 5.0 (GraphPad

Software Inc., San Diego, CA).

3. Results

3.1. Histological change in hearts of C57BL/6 mice after P.gingivalis injection

To investigate the possibility that P. gingivalis injection

induces cardiovascular diseases in wild-type C57BL/6 mice,

mice were intravenously inoculated with 2.0 � 108 CFU of P.

gingivalis. Myocarditis and/or myocardial infarction-like

view were observed in hearts of mice injected with P.

gingivalis (Fig. 2). Inflammatory cells such as neutrophils and

monocytes infiltrated into hearts of mice and the vogue

apoptosis-like change of cardiac cells partly was observed in

heart of mice 5 days after P. gingivalis injection (Fig. 2D),

and moderate infiltration of fibroblasts was observed in

hearts of mice at 14 days after P. gingivalis injection (Fig. 2E).

As the histological change in hearts after P. gingivalis

injection was remarkable until 5 days after P. gingivalis

injection and gradually decreased, to investigate the

response for P. gingivalis reinjection, mice were intrave-

nously re-inoculated with 2.0 � 108 CFU of P. gingivalis. In

hearts at 5 days after P. gingivalis reinjection, more severe

infiltration of inflammatory cells was clearly observed

compared with that of the first P. gingivalis injection

(Fig. 2H), and more severe infiltration of fibroblasts was

also observed at 14 days after P. gingivalis reinjection (Fig. 2I).

These findings are similar to the histopathology of myocar-

dial infarction.

Mice exhibited temporary debilitation and ruffled fur

within 1–3 h after P. gingivalis injection and reinjection.

Although a temporary decrease in body weight was also

observed 24–36 h after injection, none of the mice died

(Fig. 1B).

Fig. 2 – Histological changes in hearts of C57BL/6 mice after P. gingivalis injection. Histological changes in hearts of C57BL/6

mice after P. gingivalis injection are shown (each magnification: left T200, right T400, each bar length: 50 mm). (A) Heart

tissue before P. gingivalis injection. (B) Heart tissue at 1 day after P. gingivalis injection. (C) Heart tissue at 3 days after P.

gingivalis injection. (D) Heart tissue at 5 days after P. gingivalis injection. (E) Heart tissue at 14 days after P. gingivalis

injection. (F) Heart tissue at 1 day after P. gingivalis reinjection. (G) Heart tissue at 3 days after P. gingivalis reinjection. (H)

Heart tissue at 5 days after P. gingivalis reinjection. (I) Heart tissue at 14 days after P. gingivalis reinjection. More severe

infiltration of inflammatory cells was clearly observed in hearts at 5 days after P. gingivalis reinjection compared with that

of the first P. gingivalis injection.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 81294

3.2. Expression of cytokine mRNA in hearts of C57BL/6mice after P. gingivalis injection

To examine the ability of P. gingivalis to induce the production

of cytokines, the cytokine-specific mRNA expressions in

hearts of mice after injection were analysed using RT-PCR.

Fig. 3 – Expression of cytokine mRNA in hearts of C57BL/6

mice before and after P. gingivalis injection. The

expression of IL1-b, IL-6, IL-17A, IL-18, IFN-g and TNF-a in

hearts of mice after injection with P. gingivalis is shown

(n = 5). Lane 1, IL-1b; Lane 2, IL-6; Lane 3, IL-17A; Lane 4,

IL-18; Lane 5, IFN-g; Lane 6,TNF-a. Although the

expressions of IL-1b, IL-6, IL-18 and TNF-a mRNA were

observed in hearts of mice before and after P. gingivalis

injection, the expressions of IL-17A and IFN-g mRNA were

detected only after injection.

Although the expressions of IL-1b, IL-6, IL-18 and TNF-a mRNA

were observed in hearts of C57BL/6 mice before and after P.

gingivalis injection, the expressions of IL-17A and IFN-g mRNA

were detected only after injection (Fig. 3).

Furthermore, we examined the level of cytokine mRNA in

hearts of mice after P. gingivalis injection using real-time PCR.

The levels of IL1-b, IL-6, IL-17A, IL-18, TNF-a and IFN-g mRNA

increased significantly at 14–15 days after P. gingivalis injection

(Fig. 4). In particular, high levels of IL-17A and IFN-g mRNA

expression were observed in hearts of mice after P. gingivalis

injection in comparison with these levels before injection

(Fig. 4D and F).

3.3. Production of IL-17A in heart of mice after P.gingivalis injection

The amounts of IL-17A protein in hearts of wild-type mice

after P. gingivalis injection were also analysed by ELISA. The

production of IL-17A increased significantly at 5 days and 14

days after P. gingivalis injection (Fig. 5).

3.4. Histological change in hearts of cytokine KO miceafter P. gingivalis injection

To investigate the role of TNF-a, IFN-g and IL-17A in the

pathogenesis of heart disease induced by P. gingivalis injection,

the histological changes in hearts of TNF-a�/�, IFN-g�/� and IL-

17A�/� mice were examined at 5 days after P. gingivalis

Fig. 4 – The levels of cytokine mRNA in hearts of C57BL/6 mice after P. gingivalis injection. The levels of IL1-b, IL-6, IL-17A, IL-

18, TNF-a and IFN-g mRNA in hearts of mice before and after P. gingivalis infection are shown. Results are expressed as

mean W standard error (SE). **p < 0.01, *p < 0.05. High levels of IL-17A and IFN-g mRNA expression were observed in hearts

of mice after P. gingivalis injection in comparison with these levels before injection.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 8 1295

injection. In wild-type, TNF-a�/� and IFN-g�/�mice, moderate

infiltration of neutrophils and monocytes was observed in

hearts at 5 days after injection (Fig. 6A–C). In contrast, no

inflammatory findings were observed in hearts of IL-17A�/�

mice (Fig. 6D).

Fig. 5 – Production of IL-17A in hearts of mice after P.

gingivalis injection. Amounts of IL-17A protein in hearts of

C57BL/6 mice after P. gingivalis injection are shown.

Results are expressed as mean W standard error (SE).

**p < 0.01, *p < 0.05 IL-17A was significantly increased in

heart of mice after P. gingivalis injection in comparison

with the level before injection.

Fig. 6 – Histological changes in hearts of cytokine KO mice

after P. gingivalis injection. Histological changes in hearts

of TNF-aS/S, IFN-gS/S and IL-17AS/S mice after P. gingivalis

injection are shown (each magnification: T400, each bar

length: 50 mm). (A) Heart tissue of C57BL/6 mice. (B) Heart

tissue of TNF-aS/S mice. (C) Heart tissue of IFN-gS/S mice.

(D) Heart tissue of IL-17AS/S mice. In wild-type, TNF-aS/S

and IFN-gS/S mice, moderate infiltration of neutrophils

and monocytes was observed in hearts at 5 days after

infection. In contrast, no inflammatory findings were

observed in hearts of IL-17AS/S mice.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 81296

4. Discussion

It has been repeatedly reported that dental plaque bacteria

that form biofilms can enter the bloodstream, resulting in

bacteremia. The risk of bacterial endocarditis increases as the

oral hygiene index and the bacterial count increase.24

Furthermore, Holmlund et al.25 demonstrated infarction that

serum IgG levels against P. gingivalis in patients with

myocardial infarction were higher than those of patients

without myocardial infarction. Periodontopathic bacteria such

as P. gingivalis and A. actinomycetemcomitans have been found in

patients with endocarditis, and ingredient of there bacteria

have been detected in heart specimens of cardiovascular

patients.26,27 Recently, it has been shown that periodontal

inflammation with periodontitis enhances bacteremia. These

findings indicate that dental plaque bacteria can enter the

bloodstream. In this study, we showed that experimental

transient P. gingivalis bacteremia could induce cardiovascular

disease in mice. Although temporary myocarditis and/or

myocardial infarction was induced by intravenous injection

with P. gingivalis in the present study, it may be possible to

induce severe myocarditis and myocardial infarction in mice

by repeat bacteremia.

Some epidemiologic studies have shown a relationship

between periodontal disease and ischemic arterial disease.28–

30 In contrast, another study found no epidemiologic relation-

ship between periodontal disease and heart disease.31

Postulated mechanisms that may link periodontal disease-

associated biofilms and cardiovascular disease include the

following: platelet aggregation, invasion to aortic endothelial

cells, endothelial injury, induction of intracellular adhesion

molecules, antigenic components and dysfunction of immune

defence mechanisms.10–12,32

Using an antibiotic protection assay and electron micros-

copy, Dorn et al.33 demonstrated that P. gingivalis, P. intermedia

and Eikenella corrodens invade coronary artery cells at a

significant level. Katz et al.34,35 showed that P. gingivalis

induced degradation of epithelial cell junctional complexes

and proteins. In addition, Schenkein et al.36,37 showed that

these periodontal disease-associated bacteria can invade

human cells, including those of the vascular epithelium.

Furthermore, when a heterozygous apolipoprotein E-deficient

mice, known as an atherosclerosis-accelerated model, were

fed a high-fat diet and inoculated with P. gingivalis cells,

atherosclerosis was further promoted.9 They concluded that P.

gingivalis infection accelerated atherosclerosis, in addition to

the effects of the genetic and environmental circumstances,

including the high-lipid diet. CAD is a very frequent cause of

death and many of these patients have periodontitis. It is

important to accumulate further reliable evidence concerning

the relationship between periodontitis and cardiovascular

diseases.

In this study, we demonstrated that the levels of IL1-b, IL-6,

IL-17A, IL-18, TNF-a and IFN-g mRNA increased significantly at

14�15 days after P. gingivalis injection. In particular, high levels

of IL-17A and IFN-g mRNA expression were observed in hearts

of mice after P. gingivalis injection in comparison with these

levels before injection. These inflammatory cytokines are

known to play a role in many diseases including heart disease.

On the other hand, periodontopathic bacterial LPSs may have

variable roles in systemic diseases. In fact, no viable P.

gingivalis were detected in heart tissue of injected mice, but

genes can be detected (data not shown). Wang and Ohura38

found that gingival fibroblasts express CD14 and toll-like

receptor (TLR), and that binding of LPSs to CD14 and TLR on the

cells activates various second-messenger systems. Recently,

several research groups have demonstrated that P. gingivalis

LPS and lipid A induced cellular activation through TLR and

subsequently induced tumour necrosis factor a (TNF-a) and

interleukin-1b (IL-1b).39,40 These findings indicate that LPS and

the components of periodontopathic bacteria can penetrate

into the bloodstream through TLR on gingival fibroblasts. Rice

et al.41 found that clinically relevant levels of endotoxin have

profound inflammatory effects on intact human saphenous

veins. In addition, TLR polymorphism attenuates receptor

signalling, diminishes the inflammatory response to gram-

negative bacteria, and is associated with a decreased risk of

atherosclerosis.42 These findings are all consistent with the

hypothesis that innate immunity such as TLR function may

play a part in atherogenesis. The natural immunity such as the

function of TLR may participate in the condition of a patient of

the coronary heart disease to cause stenocardia, a coronary

heart disease such as the myocardial infarction when

arteriosclerosis is worse.

In this study, we also investigated the role of cytokines in

the pathogenesis of heart disease induced by P. gingivalis

injection using TNF-a�/�, IFN-g�/� and IL-17A�/�mice. In wild-

type, TNF-a�/� and IFN-g�/� mice, moderate infiltration of

neutrophils and monocytes was observed in hearts at 5 days

after injection. In contrast, no inflammatory findings were

observed in hearts of IL-17A�/� mice. Furthermore, the

production of IL-17A was detected in hearts of wild-type mice

after P. gingivalis injection. These results suggest that IL-17A

plays an important role in the pathogenesis of myocarditis

and/or myocardial infarction induced by P. gingivalis injection.

The IL-17 cytokine family consists of 6 cytokines (IL-17A to IL-

17F) and at least 5 receptors (IL-17RA to IL-17RE).43 Like many

inflammatory cytokines, IL-17 plays both protective and

pathogenic roles in the immune system. IL-17 is important

for host defence against infectious organisms, including

Klebsiella pneumoniae, Candida albicans and Toxoplasma gon-

dii.44–46 Conversely, elevated levels of IL-17 are reported in

autoimmune diseases, including rheumatoid arthritis (RA),

collagen-induced arthritis (CIA), colitis, multiple sclerosis and

experimental autoimmune encephalomyelitis (EAE).47,48 IL-17

was recently shown to be the hallmark cytokine produced by a

newly identified subset of T helper cells, called Th17, which

are generated following signals from TGF-b, IL-6 and IL-23.48 In

addition, IL-17 plays a particularly significant role in regulating

neutrophil recruitment and granulopoiesis.49–51 Recently, it

has been reported that IL-17A and IL-17F may bind the same

receptor complexes consisting of IL-17RA and IL-17RC,

suggesting that these cytokines have similar biological

functions.52 Further studies are necessary to investigate the

role of IL-17F in heart diseases.

In conclusion, we have demonstrated that an experimental

bacteremia of P. gingivalis could induce myocarditis and/or

myocardial infarction in mice, and IL-17A plays an important

role in the pathogenesis of myocarditis and/or myocardial

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 8 1297

infarction. As periodontopathic bacteria enter the blood-

stream from dental plaque and result in heart diseases, it is

necessary to study the role of cytokines using other animal

models such as oral infection model in future.

Funding: None.

Competing interests: None declared.

Ethical approval: Not required.

Acknowledgments

We thank Genco CA, Hayashi C, Liu X, Lin YY and Kato S for

helpful suggestions and experimental preparation. P. gingivalis

A7436 was provided by Genco CA. We are especially grateful to

Chie H for help and assistance with the transportation of

bacteria. Methods of growing P. gingivalis A7436 were sup-

ported by Liu X. Histological analysis was supported by Kato S

at the Department of Pathology, Kyoto Prefectural University

of Medicine.

r e f e r e n c e s

1. Tomas Carmona I, Diz Dios P, Scully C. Efficacy of antibioticprophylactic regimens for the prevention of bacterialendocarditis of oral origin. J Dent Res 2007;86(12):1142–59.

2. Seymour RA, Lowry R, Whitworth JM, Martin MV. Infectiveendocarditis, dentistry and antibiotic prophylaxis; time for arethink? Br Dent J 2000;189(11):610–6.

3. Nakano K, Nemoto H, Nomura R, Inaba H, Yoshioka H,Taniguchi K, et al. Detection of oral bacteria incardiovascular specimens. Oral Microbiol Immunol2009;24(1):64–8.

4. Okuda K, Kato T, Ishihara K. Involvement ofperiodontopathic biofilm in vascular diseases. Oral Dis2004;10(1):5–12.

5. Joshi VM, Vandana KL. The detection of eight putativeperiodontal pathogens in adult and rapidly progressiveperiodontitis patients: an institutional study. Indian J DentRes 2007;18(1):6–10.

6. Mustapha IZ, Debrey S, Oladubu M, Ugarte R. Markers ofsystemic bacterial exposure in periodontal disease andcardiovascular disease risk: a systematic review and meta-analysis. J Periodontol 2007;78(12):2289–302.

7. Gotsman I, Lotan C, Soskolne WA, Rassovsky S, Pugatsch T,Lapidus L, et al. Periodontal destruction is associated withcoronary artery disease and periodontal infection withacute coronary syndrome. J Periodontol 2007;78(5):849–58.

8. Brodala N, Merricks EP, Bellinger DA, Damrongsri D,Offenbacher S, Beck J, et al. Porphyromonas gingivalisbacteremia induces coronary and aortic artherosclerosis innormocholesterolemic and hypercholesterolimic pigs.Arterioscler Thromb Vasc Biol 2005;25(7):1446–51.

9. Li L, Messas E, Batista Jr EL, Levine RA, Amar S.Porphyromonas gingivalis infection accelerates theprogression of atherosclerosis in a heterozygousapolipoprotein E-deficient murine model. Circulation2002;105(7):861–7.

10. Sharma A, Novak EK, Sojar HT, Swank RT, Kuramitsu HK,Genco RJ. Porphyromonas gingivalis platelet aggregationactivity: outer membrane vesicles are potent activators ofmurine platelets. Oral Microbiol Immunol 2000;15(6):393–6.

11. O’Brien-Simpson NM, Pathirana RD, Walker GD, ReynoldsEC. Porphyromonas gingivalis RgpA-Kgp proteinase-adhesin

complexes penetrate gingival tissue and induceproinflammatory cytokines or apoptosis in a concentration-dependent manner. Infect Immun 2009;77(3):1246–61.

12. Abe N, Kadowaki T, Okamoto K, Nakayama K, Ohishi M,Yamamoto K. Biochemical and functional properties oflysine-specific cysteine proteinase (lys-gingipain) as avirulence factor of Porphyromonas gingivalis in periodontaldisease. J Biochem 1998;123(2):305–12.

13. Shi Y, Ratnayake DB, Okamoto K, Abe N, Yamamoto K,Nakayama K. Genetic analysis of proteolysis, hemoglobinbinding, and hemagglutination of Porphyromonas gingivalis. JBiol Chem 1999;274(25):17955–60.

14. Nakayama K, Kadowaki T, Okamoto K, Yamamoto K.Construction and characterization of arginine-specificcysteine proteinase (arg-gingigipain)-deficient mutants ofPorphyromonas gingivalis. J Biol Chem 1995;270(40):23619–29.

15. Yamamoto T, Kita M, Oseko F, Nakamura T, Imanishi J,Kanamura N. Cytokine production in human periodontalLigament cells stimulated with Porphyromonas gingivalis. JPeriodont Res 2006;41(6):554–9.

16. Pasqui AL, Di Renzo M, Bova G, Maffei S, Pompella G, AuteriA, et al. Pro-inflammatory/anti-inflammatory cytokineimbalance in acute coronary syndromes. Clin Exp Med2006;6(1):38–44.

17. Hashmi S, Zeng QT. Role of interleukin-17 and interleukin-17 induced cytokines interleukin-6 and interleukin-8 inunstable coronary artery disease. Coron Artery Dis2006;17(8):699–706.

18. Patel KD, Murphy RT, White M, Gasparro D, Kelleher DP,Ryan T, et al. Interleukin 17: an unlikely marker of acutecoronary syndrome? Atherosclerosis 2009;205(1):33–4.

19. Dao T, Ohashi K, Kayano T, Kurimoto M, Okamura H.Interferon-g-inducing factor, a novel cytokine, enhances fasligand-mediated cytotoxicity of murine T helper 1 cells. CellImmunol 1996;173(2):230–5.

20. Biet F, Locht C, Kremer L. Immunoregulatory functions ofinterleukin 18 and its role in defense against bacterialpathogens. J Mol Med 2002;80(3):147–62.

21. Chen MC, Chen CJ, Yang CH, Wu CJ, Fang CY, Hsieh YK, et al.Interleukin-18: a strong predictor of the extent of coronaryartery disease in patients with unstable angina. Heart Vessels2007;22(6):371–5.

22. Amar S, Zhou Q, Shaik-Dasthagirisaheb Y, Leeman S. Diet-induced obesity in mice causes changes in immuneresponses and bone loss manifested by bacterial challenge.Proc Natl Acad Sci USA 2007;104(51):20466–71.

23. Oseko F, Yamamoto T, Akamatsu Y, Kanamura N, IwakuraY, Imanishi J, et al. IL-17 is involved in bone resorption ofmouse periapical lesions. Microbiol Immunol 2009;53(5):287–94.

24. Strom BL, Abrutyn E, Berlin JA, Kinman JL, Feldman RS,Stolley PD, et al. Risk factors for infective endocarditis: oralhygiene and nondental exposures. Circulation2000;102(23):2842–8.

25. Holmlund A, Hedin M, Pussinen PJ, Lerner UH, Lind L.Porphyromonas gingivalis (Pg) a possible link betweenimpaired oral health and acute myocardial infarction. Int JCardiol 2009. [Epub ahead of print].

26. Van Winkelhoff AJ, Slots J. Actinobacillusactinomycetemcomitans and Porphyromonas gingivalis innonoral infections. Periodontol 2000 1999;20(1):122–35.

27. Nakano K, Inaba H, Nomura R, Nemoto H, Takeuchi H,Yoshioka H, et al. Distribution of Porphyromonas gingivalisfimA genotypes in cardiovascular specimens from Japanesepatients. Oral Microbiol Immunol 2008;23(2):170–2.

28. Beck J, Garcia R, Heiss G, Vokonas PS, Offenbacher S.Periodontal disease and cardiovascular disease. J Periodontol1996;67(10):1123–37.

a r c h i v e s o f o r a l b i o l o g y 5 6 ( 2 0 1 1 ) 1 2 9 0 – 1 2 9 81298

29. Beck JD, Offenbacher S. The association betweenperiodontal diseases and cardiovascular diseases: a state-of-the-science review. Ann Periodontol 2001;6(1):9–15.

30. Beck JD, Pankow J, Tyroler HA, Offenbacher S. Dentalinfections and atherosclerosis. Am Heart J 1999;138(5):S528–S533.

31. Hujoel PP, Drangsholt M, Spiekerman C, DeRouen TA.Periodontal disease and coronary heart disease risk. JAMA2000;284(11):1406–10.

32. Amar S, Wu SC, Madan M. Is Porphyromonas gingivalis cellinvasion required for atherogenesis? Pharmacotherapeuticimplications. J Immunol 2009;182(3):1584–92.

33. Dorn BR, Dunn Jr WA, Progulske-Fox A. Invasion of humancoronary artery cells by periodontal pathogens. Infect Immun1999;67(11):5792–8.

34. Katz J, Sambandam V, Wu JH, Michalek SM, Balkovetz DF.Characterization of Porphyromonas gingivalis-induceddegradation of epithelial cell junctional complexes. InfectImmun 2000;68(3):1441–9.

35. Katz J, Yang QB, Zhang P, Potempa J, Travis J, Michalek SM,et al. Hydrolysis of epithelial junctional proteins byPorphyromonas gingivalis gingipains. Infect Immun2002;70(5):2512–8.

36. Schenkein HA, Barbour SE, Berry CR, Kipps B, Tew JG.Invasion of human vascular endothelial cells byActinobacillus actinomycetemcomitans via the receptor forplatelet-activating factor. Infect Immun 2000;68(9):5416–9.

37. Rudney JD, Chen R, Sedgewick GJ. Intracellular Actinobacillusactinomycetemcomitans and Porphyromonas gingivalis in buccalepithelial cells collected from human subjects. Infect Immun2001;69(4):2700–7.

38. Wang PL, Ohura K. Porphyromonas gingivalislipopolysaccharide signaling in gingival fibroblasts-CD14and Toll-like receptors. Crit Rev Oral Biol Med 2002;13(2):132–42.

39. Hajishengallis G, Martin M, Schifferle RE, Genco RJ.Counteracting interactions between lipopolysaccharidemolecules with differential activation of toll-like receptors.Infect Immun 2002;70(12):6658–64.

40. Ogawa T, Asai Y, Hashimoto M, Takeuchi O, Kurita T,Yoshikai Y, et al. Cell activation by Porphyromonas gingivalislipid A molecule through Toll-like receptor 4- and myeloiddifferentiation factor 88-dependent signaling pathway. IntImmunol 2002;14(11):1325–32.

41. Rice JB, Stoll LL, Li WG, Denning GM, Weydert J, Charipar E,et al. Low-level endotoxin induces potent inflammatoryactivation of human blood vessels: inhibition by statins.Arterioscler Thromb Vasc Biol 2003;23(9):1576–82.

42. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, OberhollenzerF, Bonora E, et al. Toll-like receptor 4 polymorphisms andatherogenesis. New Engl J Med 2002;347(3):185–92.

43. Moseley TA, Haudenschild DR, Rose L, Reddi AH.Interleukin-17 family and IL-17 receptors. Cytokine GrowthFactor Rev 2003;14(2):155–74.

44. Huang W, Na L, Fidel PL, Schwarzenberger P. Requirementof interleukin-17A for systemic anti-Candida albicans hostdefense in mice. J Infect Dis 2004;190(3):624–31.

45. Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J,Schwarzenberger P, et al. Requirement of interleukin 17receptor signaling for lung CXC chemokines andgranulocyte colony-stimulating factor expression,neutrophil recruitment, and host defense. J Exp Med2001;194(4):519–27.

46. Kelly MN, Kolls JK, Happel K, Schwartzman JD,Schwarzenberger P, Combe C, et al. Interleukin-17/interleukin-17 receptor-mediated signaling is important forgeneration of an optimal polymorphonuclear responseagainst Toxoplasma gondii infection. Infect Immun2005;73(1):617–21.

47. Kotake S, Udagawa N, Takahashi N, Matsuzaki K, Itoh K,Ishiyama S, et al. IL-17 in synovial fluids from patients withrheumatoid arthritis is a potent stimulator ofosteoclastogenesis. J Clin Invest 1999;103(9):1345–52.

48. Langrish CL, Chen Y, Blumenschein WM, Mattson J, BashamB, Sedgwick JD, et al. IL-23 drives a pathogenic T cellpopulation that induces autoimmune inflammation. JEnviron Monit 2005;201(2):233–40.

49. Forlow SB, Schurr JR, Kolls JK, Bagby GJ, Schwarzenberger PO,Ley K. Increased granulopoiesis through interleukin-17 andgranulocyte colony-stimulating factor in leukocyte adhesionmolecule-deficient mice. Blood 2001;98(12):3309–14.

50. Linden A, Adachi M. Neutrophilic airway inflammation andIL-17. Allergy 2002;57(9):769–75.

51. Linden A, Laan M, Anderson GP. Neutrophils, interleukin-17A and lung disease. Eur Respir J 2005;25(1):159–72.

52. Weaver CT, Harrington LE, Mangan PR, Gavrieli M, MurphyKM. Th17: an effector CD4 T cell lineage with regulatory Tcell ties. Immunity 2006;24(6):677–88.