ORIGINAL PAPER

Optimization of factors influencing microprojectilebombardment-mediated genetic transformation of seed-derivedcallus and regeneration of transgenic plants in Eleusine coracana(L.) Gaertn

Swati Jagga-Chugh • Sumita Kachhwaha •

Manju Sharma • Aditi Kothari-Chajer •

S. L. Kothari

Received: 24 June 2011 / Accepted: 23 December 2011 / Published online: 8 January 2012

� Springer Science+Business Media B.V. 2012

Abstract Microprojectile bombardment mediated genetic

transformation parameters have been standardized for seed

derived callus of Eleusine coracana. Plasmid pCAMBIA

1381 harboring hygromycin phosphotransferase (hptII) as

selectable marker gene and b-glucuronidase (gus A) as

reporter gene, was used for the optimization of gene

transfer conditions. The transient GUS expression and

survival of putative transformants were taken into consid-

eration for the assessment of parameters. Optimum con-

ditions for the microprojectile bombardment mediated

genetic transformation of finger millet were 1,100 psi

rupture disk pressure with 3 cm distance from rupture disk

to macrocarrier and 12 cm microprojectile travel distance.

Double bombardment with gold particles of 1.0 lm size

provided maximum transient GUS expression and trans-

formation efficiency. Osmotic treatment of callus with

0.4 M sorbitol enhanced efficiency of particle bombard-

ment mediated genetic transformation. Regenerative calli

were bombarded at optimum conditions of bombardment

and placed on regeneration medium with hygromycin to

obtain transformed plants. The integration of hptII and gus

A genes was confirmed with PCR amplification of 684 and

634 bp sizes of the bands respectively from putative

transformants and Southern blot hybridization using PCR

amplified DIG labeled hptII gene as probe. PCR analysis

with hptII gene specific primers indicated the presence of

transgene in T1 generation plants. Thus a successful genetic

transformation system was developed using particle bom-

bardment in E. coracana with 45.3% transformation effi-

ciency. The protocol will be helpful for the introgression of

desired genes into E. coracana.

Keywords Finger millet � Microprojectile �Genetic transformation � Regeneration � Southern blot

hybridization � Transgenic plants

Abbreviations

2,4-D 2,4-Dichlorophenoxyacetic acid

GA3 Gibberellic acid

GUS b-Glucuronidase

hptII Hygromycin phosphotransferase

MS Murashige and Skoog medium

Introduction

Particle bombardment mediated genetic transformation

provides an alternative method of gene transfer in those

cases where other methods of gene transfer are not effi-

cient. It facilitates DNA delivery into intact plant cells,

simultaneous multiple gene transfers with no biological

constraints or host limitations (Altpeter et al. 2005).

Moreover, particle bombardment is also employed for

DNA delivery in transient gene expression studies to

investigate the plant gene expression and for its ability to

introduce DNA directly into different tissues (Sivamani

et al. 2009). Any kind of plant tissue could be used as an

explant for microprojectile bombardment, which is an

advantage over other methods. The common target tissue

for particle bombardment is embryogenic somatic tissues

such as immature embryo, isolated scutella, inflorescence

S. Jagga-Chugh � S. Kachhwaha � S. L. Kothari (&)

Centre for Converging Technologies, University of Rajasthan,

Jaipur 302 004, India

e-mail: slkothari@lycos.com; slkothari28@gmail.com

S. Kachhwaha � M. Sharma � A. Kothari-Chajer � S. L. Kothari

Experimental Morphogenesis and Plant Tissue Culture

Laboratory, Department of Botany, University of Rajasthan,

Jaipur 302 004, India

123

Plant Cell Tiss Organ Cult (2012) 109:401–410

DOI 10.1007/s11240-011-0104-7

and regenerative callus derived from such tissues (Christou

1997). Shoot-apex was also used as an explant to particle

bombardment for production of transgenic cotton with an

increased level of phytase activity (Liu et al. 2011). Par-

ticle gun has been used for transformation of all the major

cereals and millets (Tamas et al. 2009; Um et al. 2007;

Ogawa et al. 2008; Girgi et al. 2006; Latha et al. 2006;

James et al. 2008) including finger millet (Latha et al.

2005). Although Agrobacterium mediated gene transfer in

finger millet has been reported earlier by the authors

(Sharma et al. 2011), however, in the present study we have

reported the feasibility of direct DNA delivery to seed

derived callus by particle bombardment and generation of

highly efficient, reproducible transformation protocol for

finger millet.

Finger millet (Eleusine coracana (L.) Gaertn.) is also

known as African millet. It has remarkable attributes as a

subsistence food crop which can survive in poor soils under

harsh and severe drought conditions (Latha et al. 2005).

Finger millet is consumed as a whole meal, which has

rather high crude fiber content (3–4%). Its seed can be

stored for several years without any insect damage.

Increase in crop yield in future is likely to come from

improved varieties transgenetically modified for resistance

to abiotic and biotic stress, using a tertiary gene pool

(Kothari et al. 2005). The major loss of finger millet yield

is due to fungal infection, thus genetic engineering is

desirable for production of fungal resistant finger millet.

Particle bombardment parameters differ from one plant

species to another and within a species from one cultivar to

another. Development of microprojectile bombardment

mediated transformation system will be helpful for the

genetic improvement of this important millet crop.

Materials and methods

Plant material and culture conditions

Eleusine coracana PR-202 seeds were procured from the

University of Agricultural Science, GKVK campus, Ban-

galore. Seeds were initially washed with 0.5% (v/v) Tween-

20 and left in 70% (v/v) ethanol for 5 min, before surface

sterilization with 2.5% sodium hypochlorite solution (v/v)

for 10 min followed by thorough washing with autoclaved

distilled water. Seeds were placed on callus induction med-

ium, i.e., MS medium (Murashige and Skoog 1962) sup-

plemented with 0.5 mg l-1 Kinetin and 2 mg l-1 2,4-D.

After 6 weeks of culture green nodular callus was obtained

and further maintained on medium containing 0.2 mg l-1

2,4-D by repeated subculture in every 3 weeks (Kothari-

Chajer et al. 2008). Nodular callus from 2nd and 3rd sub-

culture was used for bombardment. The bombarded callus

was transferred to regeneration medium supplemented with

1 mg l-1 GA3. MS basal medium was supplemented with

3% (w/v) sucrose and solidified with 0.85% (w/v) agar

(bacteriological grade, Himedia, Mumbai, India). Cultures

were incubated at 26 ± 1�C under fluorescent light

(75 lmol s-1 m-2) and 16/8 h photoperiod.

Transformation with particle gun

Green nodular calli (5–7 mm) were arranged aseptically in

a circle with diameter of 20 mm in Petri plates on MS

medium supplemented with 0.2 mg l-1 2,4-D and 0.4 M

sorbitol 4 h prior to bombardment. Plasmid pCAMBIA

1381 was isolated using plasmid Miniprep kit (Fermentas,

India) following manufacturer’s protocol. Transformation

conditions were determined using the plasmid pCAMBIA

1381, which harbours gus A reporter gene and the hptII

gene as selectable marker, both were controlled by the

cauliflower mosaic virus (CaMV) 35S promoter. Plasmid

DNA was concentrated according to Qiagen, India.

Preparation of microcarriers

Microparticles (6 mg) were suspended in 200 ll of 70%

ethanol (v/v) by vigorous vortexing for 20 s to 1 min fol-

lowed by soaking for 5–10 min. Then microparticles were

washed with 100 ll of sterile water by vortexing and

suspension was left at room temperature for 10 min fol-

lowed by 1 min centrifugation at 10,000 rpm. After

washing pellet was resuspended in 100 ll sterile 50%

glycerol. Then 15 ll plasmid DNA (1 lg ll-1), 100 ll

CaCl2 (2.5 M) and 40 ll cold spermidine (0.1 M) were

added for coating of microparticles. After 10 min incuba-

tion on ice the suspension was spun in microcentrifuge for

30 s at 10,000 rpm then the supernatant was removed and

pellet was washed with 70% (v/v) ethanol followed by

washing with absolute ethanol. Then the DNA pellet was

re-suspended in 60 ll absolute ethanol for bombardments.

5 ll of this suspension was loaded on macrocarrier and

allowed to dry. Care was taken to ensure uniform particle

distribution and minimize agglomeration. To prevent

agglomeration microcarrier particle suspension was vor-

texed prior to each bombardment.

Microprojectile bombardment

Bombardments were carried out with biolistic gene gun

(PDS 1000/He, Bio-Rad) under a vacuum of 25 inches of

Hg. The variables to be optimized included, rupture disc

pressures (450, 650, 900, 1,100 and 2,100 psi), distance

from rupture disk to macrocarrier (3, 6 and 9 cm) and

microprojectile travel distances (6, 9, and 12 cm), type of

microcarrier (gold and tungsten), size of microcarrier (0.6,

402 Plant Cell Tiss Organ Cult (2012) 109:401–410

123

1.0 and 1.6 lm diameter of gold particles), number of

bombardments per Petri plate (1, 2 and 3), type of os-

moticum (sorbitol, mannitol and sucrose) and concentra-

tion of osmoticum (0, 0.2, 0.4 and 0.6 Molar). These

factors were standardized stepwise and conditions opti-

mized at one step were used in following step, which

finally resulted into development of efficient system for

production of transgenic finger millet. Calli bombarded

with uncoated microcarriers were used as control.

Selection and regeneration of putative transformants

After bombardment, calli were kept on medium supple-

mented with 0.2 mg l-1 2,4-D and 0.4 M sorbitol at 25�C

for 18 h and then transferred to medium supplemented with

0.2 mg l-1 2,4-D without antibiotic. After 15 days calli

were transferred to selection medium i.e., MS medium

containing 0.2 mg l-1 2,4-D, 3% sucrose, 0.85% agar and

hygromycin. After 3 cycles of selection with increasing

concentration of hygromycin (10, 20 and 50 mg l-1), green

calli were transferred to regeneration medium supple-

mented with 1 mg l-1 GA3 and 50 mg l-1 hygromycin.

In vitro regenerated putative transformants were trans-

ferred under controlled green house conditions and mature

seeds were collected. In order to obtain T1 progenies

mature seeds from T0 hptII positive plants were randomly

selected and germinated on � MS medium supplemented

with 50 mg l-1 hygromycin. DNA was extracted from

seedling and amplified with hptII gene specific primers.

Histochemical GUS assay

GUS assay (Jefferson et al. 1987) was performed for calli

and leaves of putative transformants by placing them in

Eppendorf tubes containing GUS-buffer (1 mM 5-bromo,

4-chloro, 3 indolyl-D-glucuronide (XGluc), 100 mM

sodium phosphate buffer pH 7.0, 0.5 mM potassium ferr-

icynide, 0.5 mM potassium ferrocynide, and 0.1% Triton

X-100). Tubes were incubated overnight at 37�C, washed

once with sterile distilled water and finally dipped in 70%

ethanol overnight to extract any chlorophyll that may be

present in the tissue. Leaf and callus were examined under

a dissecting microscope and scored for blue coloration.

PCR amplification

DNA was isolated from putative transformants and control

shoots using 100 mg of in vitro grown leaves with Qiagen

mini DNA kit (Genetix). Transformation was confirmed by

PCR with hptII (hygromycin selection marker gene) spe-

cific primers (F: 50 GCTCCATACAAGCCAACCAC 30

and R: 50 CGAAAAGTTCGACAGCGTCTC 30) and gus A

(reporter gene) specific primer (F: 50 AACAGTTCCTGA

TTAACCACAAACC 30 and R: 50 GCCAGAAGTTCTT

TTTCCAGTACC 30). These primers were obtained from

Banglore Genei, India. PCR amplified hptII gene and gus A

gene present in pCAMBIA 1381 plasmid were taken as

positive control. DNA from nontransformed plants was

used as negative control. Genomic DNA (approx. 40 ng)

along with 1.5 mM MgCl2 and 50 ng of hptII/gus A gene

forward and reverse primers in 25 ll volume was subjected

to PCR amplification (Bio-Rad, UK), using an initial

denaturation at 94�C for 4 min, followed by 30 cycles of

94�C for 45 s, 52�C for 45 s and 72�C for 45 s, and a final

extension step at 72�C for 7 min. The amplified products

were separated on 1.2% agarose (Himedia, Mumbai, India)

gel and photographed using Gel Documentation System

(Bio-Rad, UK).

Southern blot hybridization

Approximately 8–10 lg genomic DNA of transformed

plants was digested with BamH1at 37�C. PCR amplified

hptII gene served as a positive control and DNA from

nontransformed plant was used as negative control. It was

electrophoresed on 0.8% agarose gel and blotted on im-

mobilon-NY ? membrane (Millipore, India; cat. no. 7104

633) as per Sambrook and Russel (2001). PCR amplified

hptII gene, labeled with digoxigenin (DIG) dUTP was used

as probe. Blotted membrane was hybridized with probe

using the standard protocol provided in DIG High prime

DNA labeling and detection starter kit I (Roche; cat. no. 11

745 832 910) for color detection with NBT/BCIP.

Statistical analysis

Each treatment consisted of at least three plates and was

replicated thrice. Percent GUS activity was calculated as

number of calli showing GUS expression to the total

number of explants stained after bombardment. Transfor-

mation efficiency was evaluated as the number of plants

showing hptII gene amplification per total number of

bombarded calli. Analysis for variance (ANOVA) appro-

priate for the design was carried out to detect significant

difference among different means, which were compared

using Duncan’s multiple range test at the 5% probability

level according to Gomez and Gomez (1984).

Results

Factors influencing particle gun mediated DNA delivery

including rupture disk pressure, distance from rupture disk to

macrocarrier and microprojectile travel distance, type of

microcarrier, size of microcarrier, number of bombardments

per Petri plate, types of osmoticum and concentration of

Plant Cell Tiss Organ Cult (2012) 109:401–410 403

123

osmoticum were standardized for finger millet embryogenic

callus.

Effect of rupture disk pressure

Different helium pressures were found to affect transient

GUS expression as well as transformation efficiency. When

callus was bombarded using various rupture disk pressure

with 3 cm distance between rupture disk and macrocarrier

and 9 cm microprojectile travel distance, it was observed

that 1,100 psi helium pressure gave highest transient GUS

expression (83%) (Fig. 1a). The highest transformation

efficiency (45.3%) was also observed when 1,100 psi

rupture disk pressure was used (Table 1). Regeneration

potential of callus was lost at 2,100 psi rupture disk pres-

sure. Thus 1,100 psi pressure was used in further experi-

ments for optimization of other factors.

Effect of distance from rupture disk to macrocarrier

and microprojectile travel distance

The effect of gap (3, 6 and 9 cm) between rupture disk and

macrocarrier was recorded on transient GUS expression

and transformation efficiency. Highest GUS expression

(81.5%) and transformation efficiency (35.5%) was

observed when 3 cm distance was used with 1,100 psi

pressure and 9 cm microprojectile travel distance (Fig. 1b;

Table 1). A marked decrease in percent explants showing

GUS expression and transformation efficiency was

observed beyond 3 cm distance from rupture disk to

macrocarrier. The intensity of blue color and number of

explants with blue color were also increased when micro-

projectile travel distance was increased. Optimum travel

distance was observed to be 12 cm for highest GUS

expression (82%) and efficiency of transformation (41.1%)

(Fig. 1c; Table 1). While at 6 cm, distance from micro-

carrier and target tissue the transient GUS expression level

(16%) and efficiency of transformation (7.7%) were lowest.

Effect of type and size of microcarrier

Tungsten microcarriers were also used to test their effect

on transient GUS expression and transformation efficiency.

It was observed that transient GUS expression (77.2%) and

efficiency of transformation (22.8%) with gold particles

were significantly higher than tungsten particles (Fig. 1d;

Table 1). Use of tungsten particles adversely affected

growth of calli as well as plantlet regeneration. Different

gold microparticle sizes (0.6, 1.0 and 1.6 lm) were com-

pared for their efficiencies in delivering DNA into the

target tissues. Survival of calli and number of recovered

putative transformants reached maximum when 1.0 lm

size of gold particle was used (Table 1). Thus size of

1.0 lm gave the highest 87.6% GUS expression as well as

(35.2%) transformation efficiency (Fig. 1e; Table 1).

Effect of number of bombardments per Petri plate

Calli were bombarded single and multiple times to evaluate

the effect of number of bombardments per Petri plate on

transient GUS expression and efficiency of transformation.

Double bombardment gave maximum transient GUS

expression (78.6%) as compared to calli bombarded once

and three times per Petri plate. The number of hptII gene

positive plants as well as transformation efficiency (41.3%)

was highest when callus was bombarded two times per

Petri plate (Fig. 1f; Table 1). When callus was bombarded

for three times per Petri plate necrosis was observed due to

mechanical damage and plantlet regeneration per callus

also decreased.

Effect of types and concentration of osmoticum

Significant difference was observed in percent explants

showing GUS expression and transformation efficiency

with different osmotic agents (sorbitol, mannitol and

sucrose). Treatment of callus with sorbitol 4 h before and

18 h after the bombardment resulted into maximum tran-

sient GUS expression (81.3%) and efficiency of transfor-

mation (33.3%) (Fig. 1g; Table 1) whereas, the calli

treated with sucrose and mannitol resulted in 16.1% and

21.9% transformation efficiency respectively. The effect of

different concentrations of sorbitol (0, 0.2, 0.4 and 0.6 M)

as osmotic treatment was also observed using the best

conditions of other parameters described above. It was

found that 0.4 M concentration of sorbitol significantly

increased the level of transient GUS expression (76.6%)

and transformation efficiency (29.5%) (Fig. 1h; Table 1).

The concentration of osmoticum showing increased GUS

expression in present investigation (0.4 M sorbitol) is

considerably lower and thus may not have any adverse

effect on regeneration. Callus survival as well as regener-

ation potential decreased when concentration higher than

0.4 M sorbitol was used.

Selection, regeneration and histochemical GUS assay

Calli were kept on the osmotic medium for 18 h following

bombardment (Fig 2a) and transferred to selection medium

after 15 days. Bombarded calli were transferred to medium

with increasing concentration (10, 20 and 50 mg l-1) of

hygromycin after every 15 days. During this selection

process non-transformed calli turned brown gradually,

while putative transformed sectors remained green and

exhibited slow growth (Fig. 2b). After the three subcultures

on selection medium, calli were transferred to regeneration

404 Plant Cell Tiss Organ Cult (2012) 109:401–410

123

Fig. 1 Effect of different factors on transient GUS expression in

Eleusine coracana. a Effect of rupture disk pressure (psi); b effect of

distance from rupture disk to macrocarrier (cm); c effect of

microprojectile travel distance (cm); d effect of type of microcarrier;

e effect of size of microcarrier (lM diameter); f effect of number of

bombardment per Petri plate; g effect of type of osmoticum; h effect

of concentration of osmoticum (Molar). Data represent the

Mean ± SE followed by different letters are significantly different

from each other at P = 0.05

Plant Cell Tiss Organ Cult (2012) 109:401–410 405

123

medium with 50 mg l-1 hygromycin. Shoot buds were

induced on regeneration medium after 3 weeks of culture

(Fig. 2c). White and green and only green well-developed

plantlets regenerated from the same callus after 8 weeks of

culture (Fig. 2d). Green plantlets were normal in appear-

ance (Fig. 2e). Putative transformants were successfully

established under controlled green house conditions

(Fig. 2f). Meanwhile, calli and leaves of putative trans-

formants were assayed for the transient GUS expression

using nontransformed calli and leaves obtained from non

transformed plants as control. The control callus and plant

did not show any blue color (Fig. 2g, i) while GUS

expression was observed in transformed tissues (Fig. 2h, j).

Molecular analysis

The genetic transformation was confirmed on the basis of

expression of gus A reporter gene and selectable marker

hptII gene. DNA of putative transformed shoots was sub-

jected to standard conditions for PCR amplification with

hptII and gus A gene-specific primers. Ten out of eleven

transformants showed the expected 684 bp band size of

Table 1 Effect of different transformation conditions on transformation efficiency of finger millet

Factors No. of calli

bombarded

No. of hygromycin

resistant calli

No. of hygromycin

resistant plants

No. of PCR (hptII)positive plants

Transformation

efficiency (%)

Rupture disk pressure (psi)

450 75 21 11 10 13.3b

650 75 39 23 23 30.6c

900 75 48 26 24 32c

1,100 75 57 35 34 45.3d

2,100 75 6 0 0 0a

Distance from rupture disk to macrocarrier (cm)

3 90 69 32 32 35.5b

6 90 63 29 28 31.1b

9 90 21 5 4 4.4a

Microprojectile travel distance (cm)

6 90 42 9 7 7.7a

9 90 52 25 25 27.7b

12 90 66 38 37 41.1c

Type of microcarrier

Gold 105 30 24 24 22.8b

Tungsten 105 24 16 16 15.2a

Size of microcarrier (lM)

0.6 105 39 22 22 20.9a

1 105 53 37 37 35.2b

1.6 105 42 32 31 29.5b

No. of bombardments per Petri plate

1 75 30 13 12 16b

2 75 54 31 31 41.3c

3 75 24 7 7 9.3a

Type of osmoticum

Sorbitol 105 54 36 35 33.3b

Sucrose 105 36 18 17 16.1a

Mannitol 105 30 23 23 21.9a

Concentration of osmoticum (Molar)

0 105 36 19 19 18b

0.2 105 47 25 23 21.9b

0.4 105 48 31 31 29.5c

0.6 105 15 7 6 5.7a

Values in a column followed by different letters are significantly different from each other at P = 0.05

406 Plant Cell Tiss Organ Cult (2012) 109:401–410

123

hptII gene and eleven out of eleven expressed 634 bp

bands of gus A gene amplified product in T0 generation

(Fig. 3a, b). The DNA of control plant did not show any

amplification. DNA of T0 transformants (hptII positive)

was used for Southern blot hybridization with PCR

amplified hptII fragment as a probe. The results indicated

six out of ten selected plants with hptII gene integration in

their genome and four samples of putative transformants

with single copy while two transgenic plants contained two

copies of the introduced gene (Fig. 4). There was no

hybridization detected in the non-transformed plants. We

observed (66.6%) single copy insertion of hptII gene by

Southern blot analysis, confirming the efficacy of the

present method. In T1 generation seven out of ten plants

were amplified with hptII gene specific primer (Fig. 5).

The results revealed integration of hptII gene in T1 gen-

eration plants.

Discussion

Particle bombardment has been widely exploited to pro-

duce tissues and plants expressing traits with agronomic

value and has a major impact on basic plant science

research and biotechnology (Altpeter et al. 2005; Taylor

and Fauquet 2002). The objective of this work was to

optimize different parameters in particle bombardment that

could enhance stable integration of the desired genes in

Fig. 2 Microprojectile bombardment mediated genetic transforma-

tion, selection, regeneration and GUS assay in Eleusine using plasmid

pCAMBIA 1381. a Callus cultured on medium supplemented with

2,4-D (0.2 mg l-1) ? 0.4 M sorbitol after bombardment; b Callus

growth in selection medium (after 3 cycles of selection); c Shoot bud

induction on regeneration medium supplemented with hygromycin

(50 mg l-1) after 3 weeks of culture; d Regeneration of green and

albino plants on medium supplemented with hygromycin (50 mg l-1)

after 8 weeks of culture; e Plantlet regenerated from bombarded

callus; f Putative transformant established under control green house

conditions; g GUS assay of control non-bombarded callus; h GUS

expression in bombarded callus; i GUS assay of leaves of control

plant; j GUS expression in leaves of putative transformant

Plant Cell Tiss Organ Cult (2012) 109:401–410 407

123

finger millet. The efficiency of transformation obtained was

45.3% and higher than those reported earlier for finger

millet transformation (Latha et al. 2005).

The helium pressure had a significant effect on micro-

projectile bombardment mediated genetic transformation.

Low pressures could be correlated to the reduced transient

GUS expression, as microcarriers were not able to reach

recipient tissue. On the other hand, higher pressures caused

injury of the cells due to increased penetration force. We

found that helium pressure of 1,100 psi gave highest

transient GUS expression and efficiency of transformation

in Eleusine. Similarily, a higher level of transient GUS

expression has been reported in banana (Sreeramanan et al.

2005), maize (Petrillo et al. 2008), sugarcane (Kim et al.

2011) and rice (Anoop and Gupta 2004) using 1,100 psi

rupture disk pressure, whereas, maximum GUS expression

was reported in sorghum when immature embryos were

bombarded at 1,300 psi rupture disk pressure and 6 cm

target distance (Tadesse et al. 2003).

The gap of 3 cm between the rupture disk and macro-

carrier was an important factor in improving stable trans-

formation. While in previous investigations on wheat 6 cm

distance from rupture disk to macrocarrier was reported to be

optimum (Delporte et al. 2005). The distance from the

macrocarrier to target tissue can also affect the velocity of

microparticles and consequently transformation rates (Pet-

rillo et al. 2008). This distance should be optimized to pro-

vide even distribution of DNA-coated microcarrier over the

target tissue without damaging it (Tadesse et al. 2003).

Tissue dislocation and mechanical damage was observed at

too short microprojectile travel distance. As the distance

increased the particle velocity and depth of their penetration

decreased so that a lower number of cells could receive

DNA. We found significantly higher transient GUS expres-

sion and transformation efficiency when calli were placed

12 cm away from macrocarrier. Contrary to this, 9 cm mi-

croprojectile travel distance was reported to be optimum for

rice calli (Ramesh and Gupta 2005), wheat (Gharanjik et al.

2008) and cumin embroys (Singh et al. 2010).

Two different types of microparticles (gold/tungsten)

were compared for their efficiency in finger millet trans-

formation. Gold particles are round, homogenous in sizes

and shapes then tungsten particles thus they are often

preferred for particle bombardment. They are biologically

inert, non-toxic and do not degrade DNA bonds. On the

other hand, tungsten particles are highly heterogeneous in

size and shape, toxic and can also acidify solutions and

catalyse plasmid DNA degradation (Sanford et al. 1993).

Although Latha et al. (2005) reported the successful

application of tungsten particles in finger millet transfor-

mation, however, we found that use of gold particles for

gene delivery resulted into better efficiency of transfor-

mation in E. coracana. Depending upon genotype and

Fig. 3 a PCR amplification of hptII gene in putative transgenic T0

plants of Eleusine coracana. M molecular marker, PC positive control

(684 bp band of hptII gene present in pCAMBIA-1381 plasmid), NCnegative control (DNA from nontransformed plant), lanes 1–11putative transformants. b PCR amplification of gus A gene in putative

transgenic T0 plants of Eleusine coracana. M molecular marker, PCpositive control (634 bp band of gus A gene present in pCAMBIA-

1381 plasmid), NC negative control (DNA fron nontransformed

plant), lanes 1–11 putative transformants

Fig. 4 Southern blot hybridization of T0 putative transformants in

Eleusine coracana. M molecular marker, PC positive control (PCR

amplified hptII gene), NC negative control (DNA from nontrans-

formed plants), lanes 1–11 putative transformants

Fig. 5 Selectable marker (hptII) gene amplification in T1 generation

plants of Eleusine coracana. M molecular marker, PC positive control

(684 bp band of hptII gene present in pCAMBIA-1381 plasmid), NCnegative control (DNA from nontransformed plant), lanes 1–10transgenic plants

408 Plant Cell Tiss Organ Cult (2012) 109:401–410

123

species, size of gold particles was also an important factor

that govern the transformation efficiency of monocots

(Sood et al. 2011). A very small microcarrier will have a

lower penetration force and a bigger one will increase

tissue damages (Klein et al. 1988). In our study, we found

that 1.0 lm size of microcarrier gave maximum transient

GUS expression and efficiency of transformation in finger

millet than smaller or larger size of gold particles. Simi-

larly, Albert et al. (2010) used 1.0 lm gold microparticles

for Cymbidium transformation. Contrary to this, Takumi

et al. (1994) have found that 1.6 lm gold particle was

better than 1.0 lm for transformation of einkorn wheat.

Whereas, Reggiardo et al. (1991) reported that micropro-

jectile size was not important for the transformation of

maize coleoptiles.

Double bombardment (rotating the plate by 908) results

in better coverage of the target area and increases the

efficiency of transformation. Whereas, triple bombardment

can cause higher tissue damage particularly with higher

helium pressures. In the present study double bombardment

per Petri plate was found to be optimum in terms of tran-

sient GUS expression and efficiency of transformation. Our

results are in line with previous results where double

bombardment has been shown to increase the efficiency of

transient GUS expression in banana (Sreeramanan et al.

2005) and Brazilian maize inbred lines (Petrillo et al.

2008). But Rasco-Gaunt et al. (1999) reported no signifi-

cant difference in GUS expression while carrying out sin-

gle and multiple bombardments on wheat tissues.

The penetration of microparticles destructed intracellu-

lar lipid membrane structure and caused ethylene accu-

mulation (Imaseki 1986). Osmotic treatment cause

plasmolysis of tissue that generally maintains the pressure

potential of wounded cells and thus prevent the cell dam-

age and leakage of protoplasm (Ye et al. 1994). In our

study sorbitol was found better than mannitol and sucrose

for transient GUS expression and transformation effi-

ciency. Whereas, addition of mannitol and sorbitol in the

medium for osmotic treatment of maize suspension cells

(Vain et al. 1993) and rice calli (Cho et al. 2004) increased

the rate of transient and stable transformation. The effect of

different concentrations of sorbitol was also tested on

transient GUS expression and transformation efficiency.

We found that 0.4 M concentration of sorbitol gave highest

percent GUS expression and efficiency of transformation.

On the contrary, Vasil et al. (1992) observed that in wheat

calli, 0.25 M mannitol increased transient GUS expression

several fold but at 0.5 M, expression was reduced. Vain

et al. (1993) found that treatment of embryogenic maize

suspension cultures with 0.2 M sorbitol combined with

0.2 M mannitol 4 h prior to and 16 h after bombardment,

gave 2.7 fold increase in transient GUS expression, with

6.8 fold increase in recovery of stably transformed clones.

In conclusion we have established a simple and efficient

microprojectile mediated genetic transformation protocol

in finger millet. Our results exhibit the possibility of stable

transformation of finger millet through direct gene transfer.

The optimized protocol can be applied to produce trans-

genic finger millet with improved agronomic traits.

Acknowledgments We thank UGC, New Delhi for providing

Senior Research Fellowship to Swati Jagga–Chugh, UGC, New Delhi

for providing postdoctoral fellowship to Dr. Manju Sharma and CSIR,

New Delhi for providing Senior Research Fellowship to Aditi Kot-

hari–Chajer.

References

Albert NW, Arathoon S, Collette VE, Schwinn KE, Jameson PE,

Lewis DH, Zhang H, Davies KM (2010) Activation of antho-

cyanin synthesis in Cymbidium orchids: variability between

known regulators. Plant Cell Tiss Organ Cult 100:355–360

Altpeter F, Baisakh N, Beachy R, Bock R, Capell T, Christou P,

Daniell H, Datta K, Datta S, Dix PJ (2005) Particle bombard-

ment and the genetic enhancement of crops: myths and realities.

Mol Breed 15:305–327

Anoop N, Gupta AK (2004) Transgenic indica rice CV IR- 50

overexpressing vigna acontifolia—pyrroline-5-carboxylate syn-

thase cDNA shows tolerance to high salt. J Plant Biochem

Biotechnol 12:109–116

Cho MJ, Yano H, Okamoto D, Kim HK, Jung HR, Newcomb K, Le

VK, Yoo HS, Langham R, Buchanan BB (2004) Stable

transformation of rice (Oryza sativa L.) via microprojectile

bombardment of highly regenerative, green tissues derived from

mature seed. Plant Cell Rep 22:483–489

Christou P (1997) Rice transformation: bombardment. Plant Mol Biol

35:197–203

Delporte F, Li S, Jacquemin JM (2005) Calluses initiated from thin

mature embryo fragments are suitable targets for wheat trans-

formation as assessed by long-term GUS expression studies.

Plant Cell Tiss Organ Cult 80:139–149

Gharanjik S, Moieni A, Mousavi A, Alizadeh H (2008) Optimization

of transient expression of uidA gene in androgenic embryos of

wheat (Triticum aestivum L. cv Falat) via particle bombardment.

Iran J Biotechnol 6:207–213

Girgi M, Breese WA, Lorz H, Oldach KH (2006) Rust and downy

mildew resistance in pearl millet (Pennisetum glaucum) medi-

ated by heterologous expression of the afp gene from Aspergillusgiganteus. Transgenic Res 15:313–324

Gomez KA, Gomez AA (1984) Statistical procedures for agricultural

research, 2nd edn. Wiley, NY

Imaseki H (1986) Ethylene. In: Takahashi N (ed) Chemistry of plant

hormones. CRC Press, Boca Raton, pp 249–264

James VA, Neibaur I, Altpeter F (2008) Stress inducible expression of

the DREB1A transcription factor from xeric, Hordeum sponta-neum L. in turf and forage grass (Paspalum notatum Flugge)

enhances abiotic stress tolerance. Transgenic Res 17:93–104

Jefferson RA, Kavanagh A, Bevan MW (1987) GUS fusions:

b-glucuronidase as a sensitive and versatile fusion marker in

higher plants. EMBO J 6:3901–3907

Kim JY, Gallo M, Altpeter F (2011) Analysis of transgene integration

and expression following biolistic transfer of different quantities

of minimal expression cassette into sugarcane (Saccharum spp.

hybrids). Plant Cell Tiss Organ Cult. doi:10.1007/s11240-011-

0043-3

Plant Cell Tiss Organ Cult (2012) 109:401–410 409

123

Klein TM, Gradziel T, Fromm ME, Sanford JC (1988) Factors

influencing gene delivery into Zea mays cells by high velocity

microprojectiles. Biotechnology 6:559–563

Kothari SL, Kumar S, Vishnoi RK, Kothari A, Watanabe KN (2005)

Applications of biotechnology for improvement of millet crops:

review of progress and future prospects. Plant Biotechnol

22:81–88

Kothari-Chajer A, Sharma M, Kachhwaha S, Kothari SL (2008)

Micronutrient optimization results into highly improved in vitro

plant regeneration in kodo (Paspalum scrobiculatum L.) and

finger (Eleusine coracana (L.) Gaertn.) millets. Plant Cell Tiss

Organ Cult 94:105–112

Latha AM, Rao KV, Reddy VD (2005) Production of transgenic

plants resistant to leaf blast disease in finger millet (Eleusinecoracana (L.) Gaertn.). Plant Sci 169:657–667

Latha AM, Rao KV, Reddy TP, Reddy VD (2006) Development of

transgenic pearl millet (Pennisetum glaucum (L.) R. Br.) plants

resistant to downy mildew. Plant Cell Rep 25:927–935

Liu JF, Wang XF, Li QL, Li X, Zhang GY, Li MG, Ma ZY (2011)

Biolistic transformation of cotton (Gossypium hirsutum L.) with

the phyA gene from Aspergillus ficuum. Plant Cell Tiss Organ

Cult 106:207–214

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bio assays with tobacco tissue cultures. Physiol Plant 15:

473–497

Ogawa T, Kawahigashi H, Toki S, Handa H (2008) Efficient

transformation of wheat by using a mutated rice acetolactate

synthase gene as a selectable marker. Plant Cell Rep 27:

1325–1331

Petrillo CP, Carneiro NP, Purcino AAC, Carvalho CHS, Alves JD,

Carneiro AA (2008) Optimization of particle bombardment

parameters for the genetic transformation of Brazilian maize

inbred lines. Pesq Agropec Brasilia 43:371–378

Ramesh M, Gupta AK (2005) Transient expression of-glucuronidase

gene in indica and japonica rice (Oryza sativa L.) callus cultures

after different stages of co-bombardment. Afr J Biotechnol 4:

596–600

Rasco-Gaunt S, Riley A, Barcelo P, Lazzeri PA (1999) Analysis of

particle bombardment parameters to optimise DNA delivery into

wheat tissues. Plant Cell Rep 19:118–127

Reggiardo MI, Arana JL, Orsaria LM, Permingeat HR, Spitteler MA,

Vallejos RH (1991) Transient transformation of maize tissues by

microparticle bombardment. Plant Sci 75:237–243

Sambrook J, Russel DW (2001) Molecular cloning: a laboratory

manual, 3rd edn. Cold Spring Habour Laboratory Press Cold

Spring Habour, New York

Sanford JC, Smith FD, Russell JA (1993) Optimizing the biolistic

process for different biological applications. Methods Enzymol

217:483–509

Sharma M, Kothari-Chajer A, Jagga-Chugh S, Kothari SL (2011)

Factors influencing Agrobacterium tumefaciens-mediated

genetic transformation of Eleusine coracana (L.) Gaertn. Plant

Cell Tiss Organ Cult 105:93–104

Singh N, Mishra A, Joshi M, Jha B (2010) Microprojectile

bombardment mediated genetic transformation of embryo axes

and plant regeneration in cumin (Cuminum cyminum L.). Plant

Cell Tiss Organ Cult 103:1–6

Sivamani E, DeLong RK, Qu R (2009) Protamine-mediated DNA

coating remarkably improves bombardment transformation effi-

ciency in plant cells. Plant Cell Rep 28:213–221

Sood P, Bhattacharya A, Sood A (2011) Problems and possibilities of

monocot transformation. Biol Plant 55:1–15

Sreeramanan S, Maziah M, Abdullah MP, Sariah M, Aini MN (2005)

Physical and biological parameters affecting transient GUS and

GFP expressions in banana via particle bombardment. Asia Pac J

Biol Biotechnol 13:35–57

Tadesse Y, Sagi L, Swennen R, Jacobs M (2003) Optimisation of

transformation conditions and production of transgenic sorghum

(Sorghum bicolor) via microparticle bombardment. Plant Cell

Tiss Organ Cult 75:1–18

Takumi S, Otani M, Shimada T (1994) Effect of six promoter-intron

combinations on transient reporter gene expression in einkorn,

emmer and common wheat cells by particle bombardment. Plant

Sci 103:161–166

Tamas C, Kisgyorgy BN, Rakszegi M, Wilkinson MD, Yang MS,

Lang L, Tamas L, Bed Z (2009) Transgenic approach to improve

wheat (Triticum aestivum L.) nutritional quality. Plant Cell Rep

28:1085–1094

Taylor NJ, Fauquet CM (2002) Microparticle bombardment as a tool

in plant science and agricultural biotechnology. DNA Cell Biol

21:963–977

Um MO, Park TI, Kim YJ, Seo HY, Kim JG, Kwon SY, Kwak SS,

Yun DJ, Yun SJ (2007) Particle bombardment-mediated trans-

formation of barley with an Arabidopsis NDPK2 cDNA. Plant

Biotechnol Rep 1:71–77

Vain P, McMullen MD, Finer JJ (1993) Osmotic treatment enhances

particle bombardment-mediated transient and stable transforma-

tion of maize. Plant Cell Rep 12:84–88

Vasil V, Castillo AM, Fromm ME, Vasil IK (1992) Herbicide

resistant fertile transgenic wheat plants obtained by micropro-

jectile bombardment of regenerable embryogenic callus. Nat

Biotechnol 10:667–674

Ye X, Brown SK, Scorza R, Cordts J, Sanford JC (1994) Genetic

transformation of peach tissues by particle bombardment. J Am

Soc Hort Sci 119:367–373

410 Plant Cell Tiss Organ Cult (2012) 109:401–410

123