Contents lists available at SciVerse ScienceDirect

Livestock Science

Livestock Science 152 (2013) 74–78

1871-14

http://d

n Corr

E-m

zh65zh

journal homepage: www.elsevier.com/locate/livsci

Short communication

Molecular analysis of as1-, b-, as2- and k-casein transcriptsreveals differential translational efficiency in yak lactatingmammary gland

W.L. Bai a,d, R.H. Yin a,n, W.Q. Jiang a, O.O. Ajayi d, S.J. Zhao b, G.B. Luo a,Z.H. Zhao c,n, I.G. Imumorin d

a College of Animal Science and Veterinary Medicine, Shenyang Agricultural University, Shenyang 110866, Chinab Institute of Biotechnology, Animal Science Research Academy of Sichuan Province, Chengdu 610066, Chinac College of Animal Science and Veterinary Medicine, Jilin University, Changchun 130062, Chinad Department of Animal Science, Cornell University, Ithaca, NY 14853, USA

a r t i c l e i n f o

Article history:

Received 29 August 2012

Received in revised form

6 December 2012

Accepted 7 December 2012

Keywords:

Yak

Casein

Transcriptional abundance

Translational efficiency

13/$ - see front matter & 2012 Elsevier B.V

x.doi.org/10.1016/j.livsci.2012.12.008

esponding author.

ail addresses: yinronghuan@163.com (R.H. Y

@yahoo.cn (Z.H. Zhao).

a b s t r a c t

Caseins are important for cheese making, and their amounts and relative concentrations

have important influence on the nutritional and technological properties of milk. In the

present work, we investigated the mRNA relative proportions and translational efficiency

of yak casein transcripts and showed that, for the first time, the four casein mRNAs were

not transcribed and translated with the same efficiency. The mRNA transcripts for yak

as1-casein (17.5%) and k-casein (20.9%) appeared to be less abundant than those of

b-casein (31.9%) and as2-casein (29.7%). The quantitative determination of the four

casein fractions of yak milk showed that b-casein and as1-casein were the main caseins,

accounting for 48.2% (16.5 g/L) and 30.8 (10.5 g/L), respectively, whereas the as2-casein

(8.7%, 2.9 g/L) and k-casein (12.3%, 4.2 g/L) exhibited less abundance. The as1-casein

transcripts had the highest translational efficiency with a value of 1.8, and the next

highest was b-casein transcripts of which the value was 1.5, whereas the as2-casein

transcripts had the lowest translational efficiency with a value of 0.3. The analysis results

of the sequence context of translation initiation codon AUG of the casein mRNA might

explain, at least in part, the differential transcriptional and translational rate observed

among the casein transcripts. The results from the present work would contribute to

elucidating the molecular regulatory mechanisms of yak casein translation.

& 2012 Elsevier B.V. All rights reserved.

1. Introduction

Caseins are important for cheese making, and theiramounts and relative concentrations have importantinfluence on the nutritional and technological proper-ties of milk (Wedholm et al. 2006). In ruminant, caseinscomprise a family of four peptide chains including as1-casein, b-casein, as2-casein and k-casein (Bevilacqua

. All rights reserved.

in),

et al., 2006). The four caseins are coded by four tightlylinked genes in order CSN1S1, CSN2, CSN1S2 and CSN3

(Rijnkels et al., 1997), and the order and transcriptionalorientation of the genes are highly conserved amongruminant species (Dovc, 2000). In yak milk, the caseinscomprise approximately 84% of the total protein content,being higher than its cow counterpart (Wang and Zou,1995; Huppertz et al., 2006).

Regulation of gene expression is achieved through aseries of complex mechanisms at different levels, includ-ing transcription, pre-mRNA splicing, mRNA stability,and translation, etc. In several ruminant species, studiesdemonstrated that the expression of caseins was also

W.L. Bai et al. / Livestock Science 152 (2013) 74–78 75

regulated at the translational level, such as buffalo (Cosenzaet al., 2011), cattle, goat, and sheep (Bevilacqua et al.,2006). However, little information was available on theexpression characterization of yak caseins. Therefore,the aims of the present work were to (1) investigatethe mRNA relative proportions of yak casein transcripts,and (2) assess the translational efficiency of each caseinspecies.

2. Materials and methods

2.1. Sample, RNA extraction and cDNA synthesis

At the same stage of lactation (week-12 after calving),a total of 10 Maiwa yaks were sampled for milk from twodifferent herds. These animals were in their third calving,and determined to be free of clinical mastitis. Somaticcells were isolated from yak milk samples following themethod described by Boutinaud et al. (2002). Using Trizolregent (Sangon, Shanghai, China), total RNA was extractedfrom isolated somatic cells according to the manufac-turer’s instructions. The purity and quantity of theextracted total RNA were assessed by the ratio of OD260/OD280 with ultraviolet spectrometer, and the integrity oftotal RNA extracted was verified by denaturing agarosegel electrophoresis. The total RNA isolated from somaticcells was treated with DNase I to exclude the residualgenomic DNA. Using 2 mg total RNA per sample, Firststrand cDNA was generated with M-MuLV cDNA Synth-esis Kit (Sangon, Shanghai, China).

2.2. Assessment of translational efficiency of different casein

transcripts

The transcriptional level of CSN1S1, CSN2, CSN1S2

and CSN3 of each sample was measured using real-time

Table 1Information of primers used in the present work.

Primer

namea

Gene Sequence (50–30) Reference

sequence in

GenBank

S1-FW CSN1S1 AATCAACTGAGGATCAAGCC NM_181029

S1-RV CSN1S1 TCCAGATAACCCAGGTAACG

N2-FW CSN2 AGCCTCTTCCTCCAACTGTC JN655524

N2-RV CSN2 CCTGAATGGGCATATCTCTC

S2-FW CNS1S2 AGTTCTTCATCTTTACCTGCC NM_174528

S2-RV CNS1S2 TCCTGCTTATATGTTTCCTGG

N3-FW CSN3 TTTCCTAGTTGTGACTATCCTGGC JQ979053

N3-RV CSN3 AGCGTATTGGTTGTTCTTGGTTT

b-FW b-actin GGTCATCACCATCGGCAATGAG NC_007326

b-RV b-actin ACAGCACCGTGTTGGCGTAGAG

SCF-S1-FW CSN1S1 GCTGCTTCTTCCCAGTCTTG NM_181029

SCF-S1-RV CSN1S1 GGAGTCCTTGGTGCTTGATA

SCF-N2-FW CSN2 TACCTTCGTTGCCGGACACTTCTTG NM_181008

SCF-N2-RV CSN2 CACCACCACAGGGGTTTGAGTAAGA

SCF-S2-FW CNS1S2 CCTTTTAGGAAACGAGGACAA NM_174528

SCF-S2-RV CNS1S2 TACTGGAGATACTGGGGGAAC

SCF-N3-FW CSN3 GCCAACTGAACCTACTGCC JQ979053

SCF-N3-RV CSN3 TCTTGGTTTTGCTCCTGGG

a Primer pair for b-actin gene were designed in our previous study (Bai et

quantitative RT-PCR technique by SYBR Green I assay(TaKaRa, Dalian, China), and was normalized againstb-actin (housekeeping gene) mRNA. The results wereanalyzed using the 2�DDCt method (Livak and Schmittgen,2001). In order to obtain the start codon flankingsequence of the casein transcripts for as1-casein, b-casein,as2-casein and k-casein, PCR amplification was performedwith gene specific primers on the first strand cDNAgenerated in this work. Then, the obtained products werepurified and ligated with the pMD18-T Vector (TaKaRa,Dalian, China), and transformed into competent E. coli

DH5a cells. The identified positive clones with the targetfragment were sequenced in both directions by ShanghaiSangon Biological Engineering and Technology Service Co.(Shanghai, China). The information of primers used in thiswork was listed in Table 1. Quantitative determination ofthe four casein fractions in yak milk was performedfollowing the method described by Bevilacqua et al.(2006). We calculated the expression percentage of eachcasein fraction within whole caseins at both mRNA andprotein levels. Finally, the translational efficiency of eachcasein transcript was estimated through calculating theratio of percentage of protein to percentage of transcript.

3. Results and discussion

As shown in Table 2, the mRNA transcripts for yak as1-casein and k-casein appeared to be less abundant thanthose of b-casein and as2-casein. These values of yak weregenerally similar to those reported on the same genes incattle, goat and sheep (Bevilacqua et al., 2006). However,our results were quite different from those in buffalo,where the highest transcript level was recorded in theCSN1S2 gene with a percentage of 55.87%, whereas, theCSN3 gene exhibited the lowest expression (4.47%) in themRNA level (Cosenza et al., 2011). These data suggested

Amplicon size

(bp)

Used for

148 Transcriptional level of CSN1S1 gene

120 Transcriptional level of CSN2 gene

109 Transcriptional level of CNS1S2 gene

80 Transcriptional level of CSN3 gene

161 Normalization of transcript level of casein

genes

119 Start codon flanking sequences

of CSN1S1 gene

354 Start codon flanking sequence

of CSN2 gene

366 Start codon flanking sequence of CSN1S2 gene

132 Start codon flanking sequence of CSN3 gene

al., 2012).

W.L. Bai et al. / Livestock Science 152 (2013) 74–7876

that the structure and transcriptional characterization ofyak casein genes appear to be more similar to those of thecattle, goat and sheep (Bevilacqua et al., 2006) than tothose of buffalo (Cosenza et al., 2011).

The quantitative determination of the four caseinfractions of yak milk showed that b-casein (48.2%) andas1-casein (30.8%) were the main caseins, whereas theas2-casein (8.7%) and k-casein (12.3%) exhibited lessabundant (Table 2). In buffalo, it was shown that themost abundant casein fractions were b (53.45%) and as1

(20.61%), followed by as2 and k, at 14.28% and 11.66%,respectively (Cosenza et al., 2011). In cattle, goat, andsheep, both b- and as1-casein are major caseins andaccount each for 38% of the whole casein fraction, andas2- and k-caseins are less abundant with a percentageranging between 9% and 13% (Bevilacqua et al., 2006).Although the starting materials from which mRNA wasextracted might be different (milk somatic cells or mam-mary gland cells), studies showed that the relativeamount of protein mRNA from milk somatic cells andmammary tissue is highly correlated (Boutinaud et al.,2002; Murrieta et al., 2006). In milk, therefore, thedifferences of percentage distribution in four casein frac-tions between yak and other ruminants might be related

Table 2

Quantitative characterization of as1-, b-, as2- and k-casein at both mRNA

and protein levels in yak, and their translational efficiency a.

Casein Content of

protein

in milk (g/L)

Relative percentage

in whole casein

fractions (%)

Translational

efficiencyb

mRNA Protein

as1-casein 10.572.3 17.571.8 30.875.2 1.870.2

b-casein 16.573.6 31.971.9 48.277.6 1.570.2

as2-casein 2.970.7 29.672.5 8.771.0 0.370.1

k-casein 4.271.0 20.972.1 12.371.6 0.670.1

a The results for each obtained value were described as mean7SD of

the ten samples.b Translational efficiency for each casein transcript was estimated

through calculating the ratio of percentage of protein to the correspond-

ing percentage of mRNA transcript.

A G

-9 -6 -3

U U G G C A A C

U U G A G A G C

C A A G U A A A

A A A G G U G C

g c c g c c R c

CSN1S1

CSN2

CSN1S2

CSN3

KC-sequence

Fig. 1. Comparison of sequence context of translational initiation codon AUG o

represent the genes encoding as1-casein, b-casein, as2-casein and k-casein, resp

context for in which the R represents A or G. The translation initiation codo

The nucleotide residue matching with the Kozak consensus sequence was enclo

the k-casein transcript was shown by italics with underline.

to the unique nutritional requirements of yak calves inconditions of extreme harshness. On the other hand, thedifferences in the percentage distributions of the fourcasein fractions between yak and the other ruminantspecies (buffalo, cattle, goat and sheep) might accountfor the peculiar technological properties of yak milk. Forexample, it is more suitable for cheese making due to itsgood coagulation properties (Zheng et al., 2001).

To assess the translational efficiency of yak differentcasein transcripts, we calculated the ratio of each caseinfraction: percentage of protein in whole caseins to per-centage of transcripts in total casein mRNA (Table 2).In yak, as1-casein transcript had the highest translationalefficiency. The next higher was b-casein transcript andk-casein in order, whereas the as2-casein transcript hadthe lowest translational efficiency. In cattle, goat andsheep, it was shown that b-casein transcript had highertranslational efficiency than that of as1-casein (Bevilacquaet al., 2006), whereas in buffalo, k-casein was found tobe the highest in translational efficiency (Cosenza et al.,2011).

In eukaryotic mRNA, it was demonstrated that the seq-uence context of translation initiation codon AUG plays amajor role in determining the efficiency of translationinitiation (Kozak, 1984). The optimal context for initiationof translation in mammals species is GCCRCCAUGG(called the ‘Kozak consensus sequence’, R represents A

or G, and AUG represents the translation initiation codonwith the A nucleotide of the initiation codon beingreferred to as number þ1) (Kozak, 1991, 2005). In naturalmRNA sequences, this site is often not matched exactly ondifferent mRNAs, but the nucleotides at positions �6, �3,and þ4 are more conserved than others (De Angiolettiet al., 2004).

Our results demonstrated that, in yak, the four caseinmRNAs were not translated with the same efficiency. Inorder to investigate whether the sequence context oftranslation initiation codon AUG might be responsiblefor the differences observed in translation rate of yakcasein mRNAs, we performed a comparison of start codonflanking sequences of the four casein transcripts with theKozak consensus sequence (Fig. 1). In the consensus motif

Start codon

+1 +4 +7

C A U G A A A C U U

C A U G A A G G U C

C A U G A A G U U C

A A U G A U G A A G

c a u g g - - - - -

f the four casein transcripts in yak. The CSN1S1, CSN2, CSN1S2, and CSN3

ectively. KC-sequence¼Kozak consensus sequence, represent the optimal

n AUG in different sequences was outlined in grey with dashed line.

sed in the grey circle. The second of the two consecutive AUG codons in

Table 3Comparison of sequence context of translational initiation codon AUG of the as1-casein transcripts among different ruminant species.

Species GenBank acc. no. Nucleotide positiona

�9 �8 �7 �6 �5 �4 �3 �2 �1 þ1 þ2 þ3 þ4 þ5 þ6

Bos grunniens This study U U G G C A A C C A U G A A A

Bos taurus X00564 U U G A C A A C C A U G A A A

Bubalus bubalis HE573919 U U G A C A A C C A U G A A A

Capra hircus X59836 U U G A C A A C C A U G A A A

Ovis aries X03237 U U G A C A A C C A U G A A A

Kozak consensus sequence G C C G C C R C C A U G G – –

a The nucleotides at position �6, in which yak had G different from with the other species, were shown in italic with bold, and the translational

initiation codon AUG in different species was underlined.

W.L. Bai et al. / Livestock Science 152 (2013) 74–78 77

GCCRCC directly upstream of the initiation codon AUG,CSN1S1 transcript contained five positions with nucleo-tides matching the consensus sequence (at positions �6,�5, �3, �2 and �1), whereas only three positions hadrespectively matching nucleotides in CSN2 (at positions�3, �2 and �1), CSN1S2 (at positions �6, �3 and �1),and CSN3 (at positions �6, �3 and �2) transcripts. Thiscould account for the highest translational efficiencyobserved for CSN1S1 transcripts in yak (Table 2).

On the other hand, although three nucleotides match-ing the consensus motif were present in CSN2, CSN1S2,and CSN3 transcripts of yak, CSN2 transcript had highertranslational efficiency in comparison to that of CSN1S2,and CSN3 (Table 2), which might be related with the threeconsecutive nucleotides (at positions �3, �2 and �1)directly upstream of the initiation codon AUG matchingthe consensus motif (Fig. 1). Unlike CSN1S1, CSN2, andCSN3, however, no matching residues were found to beconsecutive in CSN1S2, which could be an explanation forthe lowest translational efficiency observed for theCSN1S2 transcripts in yak. Similar results were alsoreported in buffalo by Cosenza et al. (2011). As identifiedin cattle, buffalo, goat and sheep (Bevilacqua et al., 2006;Cosenza et al., 2011), two consecutive initiation codonAUG are also present in yak CSN3 transcript (Fig. 1).Usually, the presence of two consecutive initiation codonsis not a favorable condition for the translation efficiency.However, as reported by Cosenza et al. (2011), in buffalospecies this condition may not be true due to the presenceof adenine in position �3 of CSN3 transcript. The presenceof adenine instead of a guanine could represent theoptimal situation to ensure a more accurate and efficienttranslation of buffalo CSN3 transcript compared withother ruminants. Since the yak CSN3 sequence is char-acterized by the presence of guanine in position �3, thesuggestions made for cattle, goat and sheep by Bevilacquaet al. (2006) can be applied to this species.

Unlike recorded in buffalo, cattle, goat, and sheep(Bevilacqua et al., 2006; Cosenza et al., 2011), yak CSN1S1

transcript had highest translational efficiency in the fourcasein transcripts, whereas in buffalo CSN3, and in cattle,goat and sheep, CSN2 transcripts had the highest transla-tional efficiency, respectively. For the higher translationalefficiency of yak CSN1S1 transcript, a possible explanationwas found via a comparison of sequence context oftranslation initiation codon AUG in CSN1S1 transcript

with the Kozak consensus sequence (Table 3). As shownin Table 3, generally, the sequence context of translationinitiation codon AUG of CSN1S1 transcript was conservedwell among the ruminant species. However, it should benoted that CSN1S1 transcript of the other species (buffalo,cattle, goat, and sheep) were Adenine in the position �6,but yak had a Guanine at position �6, matching exactlywith the nucleotides (�6G) of Kozak consensus sequence.Taken together, it was suggested that yak having Guanineat position �6 appears to be unique to CSN1S1 transcriptin comparison to its closely related species.

According to the investigation by Kozak (1987), the �6G

is present in 44% of the 699 vertebrate mRNA sequencesanalyzed. This high conservation of it suggests that the G atposition �6 also is important in the initiation of translation(De Angioletti et al., 2004). An outstanding example existsin rabbit, where the substitution of this �6G with a T inb-globin 50UTR reduced the efficiency of the translationinitiation process in experiment in vitro (Kozak, 1994).Also, in human, in vitro transcription/translation experi-ments demonstrated that the substitution of �6G with a C

decreased the efficiency of translation of the b-globin chainby about 30% (De Angioletti et al., 2004). Therefore, thepresence of the G at position �6 of yak CSN1S1 transcriptmight provide an more optimal situation to make itstranslation process more efficient in comparison to thoseof the other ruminant species (buffalo, cattle, goat, andsheep) being A at the position �6.

In fact, translational regulation can be controlledthrough a series of complex mechanisms at multiplelevels. For the mRNA itself, apart from the sequencecontext of the translation initiation codon AUG, the lengthof the 50 and 30 UTR, structural characteristics, upstreamopen reading frames, and mRNA stability, etc. also areimportant in determining the translational efficiency(Kozak, 1991; Morris and Geballe, 2000). Recent findingson translational regulation via non-coding RNAs furtheradd to the complexities of gene expression control(Vasudevan et al., 2007). Further work will be needed tofully elucidate the molecular mechanism underlying thetranslational regulation of yak casein transcripts.

4. Conclusions

The quantitative characterization of mRNA and proteinlevels of yak casein demonstrated that the four casein

W.L. Bai et al. / Livestock Science 152 (2013) 74–7878

mRNA were not transcribed and translated with the sameefficiency. In the present work, we analyzed the sequencecontext of translation initiation codon AUG of the caseinmRNA, and the results might explain, at least in part, thedifferential translational rate observed among the caseintranscripts. The results from the present work wouldcontribute to elucidating the molecular regulatorymechanisms of yak casein translation. Also, they mightprovide a foundation for understanding the lactationbiology of yak.

Conflict of interest

The authors declare that there are no conflicts ofinterest.

Acknowledgments

This work was supported financially by a grant fromGenetically Modified Organisms Breeding Major Projects ofChina (No. 2009ZX08009-156B), National R&D Project ofTransgenic Organisms of Ministry of Science and Technol-ogy of China (No. 2011ZX08007-001), and the NationalHigh Technology Development Project (2013AA102505).

References

Bai, W.L., Yang, R.J., Yin, R.H., Jiang, W.Q., Luo, G.B., Yin, R.L., Zhao, S.J.,Li, C., Zhao, Z.H., 2012. Molecular characterization and expressionanalysis of osteopontin cDNA from lactating mammary gland in yak(Bos grunniens). Mol. Biol. Rep. 39, 3627–3635.

Bevilacqua, C., Helbling, J.C., Miranda, G., Martin, P., 2006. Translationalefficiency of casein transcripts in the mammary tissue of lactatingruminants. Reprod. Nutr. Dev. 46, 567–578.

Boutinaud, M., Rulquin, H., Keisler, D.H., Djiane, J., Jammes, H., 2002. Useof somatic cells from goat milk for dynamic studies of geneexpression in the mammary gland. J. Anim. Sci. 80, 1258–1269.

Cosenza, G., Pauciullo, A., Coletta, A., Di Francia, A., Feligini, M., Gallo, D.,Di Berardino, D., Ramunno, L., 2011. Translational efficiency of caseintranscripts in Mediterranean river buffalo. J. Dairy Sci. 94,5691–5694.

De Angioletti, M., Lacerra, G., Sabato, V., Carestia, C., 2004. bþ45 G-C: Anovel silent b-thalassaemia mutation, the first in the Kozaksequence. Br. J. Haematol. 124, 224–231.

Dovc, P., 2000. Genetic polymorphisms in milk protein genes and theirimpact on milk composition. Adv. Exp. Med. Biol. 480, 225–230.

Huppertz, T., Fox, P.F., de Kruif, K.G., Kelly, A.L., 2006. High pressure-induced changes in bovine milk proteins: a review. Biochim.Biophys. Acta 1764, 593–598.

Kozak, M., 1984. Point mutations close to the AUG initiator codon affectthe efficiency of translation of rat preproinsulin in vivo. Nature 308,241–246.

Kozak, M., 1987. An analysis of 50-noncoding sequences from 699vertebrate messenger RNAs. Nucleic. Acids Res. 15, 8125–8148.

Kozak, M., 1991. Structural features in eukaryotic mRNAs that modulatethe initiation of translation. J. Biol. Chem. 266, 19867–19870.

Kozak, M., 1994. Features in the 50 non-coding sequences of rabbit a andb-globin mRNAs that affect translational efficiency. J. Mol. Biol. 235,95–110.

Kozak, M., 2005. Regulation of translation via mRNA structure inprokaryotes and eukaryotes. Gene 361, 13–37.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2�DDCt method.Methods 25, 402–408.

Morris, D.R., Geballe, A.P., 2000. Upstream open reading frames asregulators of mRNA translation. Mol. Cell. Biol. 20, 8635–8642.

Murrieta, C.M., Hess, B.W., Scholljegerdes, E.J., Engle, T.E., Hossner, K.L.,Moss, G.E., 2006. Evaluation of milk somatic cells as a source ofmRNA for study of lipogenesis in the mammary gland of lactatingbeef cows supplemented with dietary high-linoleate safflower seeds.J. Anim. Sci. 84, 2399–2405.

Rijnkels, M., Kooiman, P.M., de Boer, H.A., Pieper, F.R., 1997. Organizationof the bovine casein gene locus. Mamm. Genome. 8, 148–152.

Vasudevan, S., Tong, Y., Steitz, J.A., 2007. Switching from repression toactivation: microRNAs can up-regulate translation. Science 318,1931–1934.

Wang, Y.S., Zou, S.X., 1995. Protein in Milk. Biochemistry of Milk. JilinUniversity Press, Changchun, China, pp. 1–48.

Wedholm, A., Larsen, L.B., Lindmark-Mansson, H., Karlsson, A.H., Andren, A.,2006. Effect of protein composition on the cheese-making properties ofmilk from individual dairy cows. J. Dairy Sci. 89, 3296–3305.

Zheng, Y.C., Zhong, G.H., Wang, Y., Mao, Y.J., Jiang, M.F., Peng, X.W.,Liu, W.J., 2001. Coagulation properties of yak milk. J. Southwest.Univ. Nat. (Nat. Sci. Ed.) 27, 216–220.