Hier eine Anleitung wie man auf einem Linux System Vtiger ...
Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu...
Transcript of Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu...
![Page 1: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/1.jpg)
Introdução ao Linux
Prof. Dr. Luciano Angelo de Souza Bernardes
![Page 2: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/2.jpg)
Linux
● Linus Benedict Torvalds (1991) 21anos● Computador 386● Insatisfeito com DOS e UNIX
– Caros e inadequados
● Minix foi o modelo
![Page 3: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/3.jpg)
Usar Linux?
● Distribuições Linux são virtualmente sem custo● Não é necessário licença para o seu uso. Não é necessário licença para o seu uso. ● Desenvolvido voluntariamente por Desenvolvido voluntariamente por
programadores experientes e colaboradores programadores experientes e colaboradores que visam a constante melhoria do sistema.que visam a constante melhoria do sistema.
● Código fonte aberto Código fonte aberto ● Linux confiável, estável e muito poderoso● Ambiente de desenvolvimento completo
– Compiladores, ferramentas, linguagens
![Page 4: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/4.jpg)
Usar Linux?
● Convive harmoniosamente no mesmo computador com outros sistemas operacionais
● Acessa discos formatados por outros sistemas operacionais
● Roda aplicações Windows
– Wine ou Máquina Virtual● Facilidade de rede/conectividade● Permite compartilhar software e hardware
![Page 5: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/5.jpg)
Usar Linux?
● Não precisa ser reinicializado devido a instalação de programas ou configuração de periféricos.
● Ampla variedade de softwares comerciais● Fácil upgrade● Suporte padrão a multiprocessadores● Multitarefa verdadeiro● GUI poderosa
![Page 6: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/6.jpg)
Usar Linux?
● “Ressuscita” PCs antigos (Macs e PCs) ● Suportado por várias plataformas● Gerencia grandes quantidade de dados● Quase nunca trava● É eficiente
![Page 7: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/7.jpg)
General Public License (GPL)
● Em termos gerais, a GPL baseia-se em 4 liberdades:– A liberdade de executar o programa, para qualquer
propósito (liberdade nº 0)
– A liberdade de estudar como o programa funciona e adaptá-lo para as suas necessidades (liberdade nº 1). O acesso ao código-fonte é um pré-requisito para esta liberdade.
![Page 8: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/8.jpg)
GPL
– A liberdade de redistribuir cópias de modo que você possa ajudar ao seu próximo (liberdade nº 2).
– A liberdade de aperfeiçoar o programa, e liberar os seus aperfeiçoamentos, de modo que toda a comunidade se beneficie deles (liberdade nº 3). O acesso ao código-fonte é um pré-requisito para esta liberdade.
![Page 9: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/9.jpg)
Distribuições
● Debian ● Fedora ● Gentoo ● Knoppix ● Mandriva
● Red Hat ● Slackware ● SUSE ● Ubuntu ● Yellow Dog Linux
![Page 10: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/10.jpg)
Distribuições
![Page 11: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/11.jpg)
Instalar ou Rodar?
![Page 12: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/12.jpg)
Dual Boot
![Page 13: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/13.jpg)
Ambiente Gráfico (X) - GNOME
![Page 14: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/14.jpg)
Ambiente Gráfico (X) - KDE
![Page 15: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/15.jpg)
Vários X
![Page 16: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/16.jpg)
Vírus
● O que são vírus e como eles agem?●
![Page 17: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/17.jpg)
Antivírus
![Page 18: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/18.jpg)
Super usuário
pink.txtdark_pink.doc
rimel.jpgtux.mpeg
music.mp3
muscle.docpit_bull.jpg
alteres.tar.gzrock.mp3
green.gifthino.mp3order.docuesc.html
Usuários comuns
Estrutura de usuários
![Page 19: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/19.jpg)
Virtualização
● Virtualização é uma técnica que permite compartilhar e utilizar recursos de um único sistema computacional em vários outros denominados de máquinas virtuais
● Cada máquina virtual oferece um sistema computacional completo muito similar a uma máquina física
● Possível ainda interconectar (virtualmente) cada uma dessas máquinas através de interfaces de rede, switches, roteadores e firewalls virtuais.
![Page 20: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/20.jpg)
Virtualização
● Vantagem: diversidade de plataformas de software, sem aumentar plataforma de hardware
● Processos disputam o tempo do processador (chaveamento)
● Tem de alocar memória RAM, espaço em HD
![Page 21: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/21.jpg)
Virtualização
![Page 22: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/22.jpg)
Linux na Bioinformática
● Uso de computadores para resolver problemas da biológicos
● Geração de muitos e complexos dados, requer poder de computação crescente
● Computadores que poder de computação usam Linux/Unix
● Linux/Unix tem poderosas ferramentas de processamento de texto (sequência de DNA)
![Page 23: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/23.jpg)
Linux na Bioinformática
● Muitas ferramentas de bioinformática tem interface WEB e muitas mais estão disponíveis por comando de linha
● Muitas novas ferramentas de bioinformática tem sido criada para Linux/UNIX (mais fácil para os programadores)
![Page 24: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/24.jpg)
Livre para Bioinformática
● Linux● MySQL● Perl● Blast e Fasta● Clustal● Phylip● Phred/Phrap/Consed● EMBOSS
![Page 25: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/25.jpg)
Linux Básico
● Cópia livre de websites● Disponível como conjunto de Cds● Instalação é muito simples● Usuários com áreas●
![Page 26: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/26.jpg)
Terminal (shell)
![Page 27: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/27.jpg)
Comando - man
man: manual de uso da maioria dos comandos disponíveis no S.O.
Sintaxe:$man [comando]
Uso:$man ls
![Page 28: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/28.jpg)
Comando - apropos
apropos: busca o padrão em manuais e descrições
Sintaxe:$apropos [padrao]
Uso:$apropos list$apropos “list files”$apropos pdf convert
![Page 29: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/29.jpg)
Comando - | (pipe)
| : “pipe”; comando de canalização, que encadeia processos pelos seus resultados, de forma que a saída (resultado) de um é entrada (input) para um próximo.
Sintaxe:$[comando] | [comando]
Uso:$ ls * |less
![Page 30: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/30.jpg)
Comando - && (ampersand)
&&: “and”; permite a execução mais de um comando na linha, sucessivos, porém não independentes; “e comercial” ou “sinal tironiano”
Sintaxe:$[comando] && [comando]
Uso:$make && make install
Se make = 0 (sucesso) faça make install
![Page 31: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/31.jpg)
Comando - ; (ponto e vírgula)
; : também funciona como um “and”; permite a execução mais de um comando na linha, sucessivos e independentes; “e comercial” ou “sinal tironiano”Sintaxe:$[comando] ; [comando]
Uso:$make ; make install
Faça make e faça make install
![Page 32: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/32.jpg)
Comando - expansões
*: “caracter coringa”; nenhuma ou mais ocorrência de qualquer caracter?: uma ocorrência de qualquer caracter
Uso:$ls l arq_*.txt$ls l arq_??.txt
![Page 33: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/33.jpg)
Comando - expansões
[]: conjunto de números{}:conjunto de nomes! : negação
Uso:$ls l arq_[14].txt$ls l arq_[!14].txt$ls l arq_{01,03,07}.txt
![Page 34: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/34.jpg)
Comando - grep
grep: busca um padrão dentro de arquivos
Sintaxe:$grep padrao [nome_arq]
Uso:$grep e “hit” arq_*.txt$egrep “hit” arq_*.txt$fgrep f padrao.txt arq_*.txt
Sintaxe:$
![Page 35: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/35.jpg)
Comando - find
find: procura por arquivos/diretórios em uma dada árvore de diretórios
Sintaxe:$
find: procura por arquivos/diretórios em uma dada árvore de diretórios
Sintaxe:$find ./ name “[nome_dir/arq]”
Uso:$find ./ name “*.bla” exec grep e “No hits” {} \;$find . name "*htm" exec cp {} {}~ \;
Sintaxe:$
![Page 36: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/36.jpg)
Comando - cut
cut: corta em n-colunas segundo um padrão
Sintaxe:$cut [padrão] [nome_arq]
Uso:$cut c1030 arquivo_01.txt$cut d “:” f 1 arquivo_01.txt$find ./ name “*.bla” exec grep e “No hits” {} \; | cut d “:” f 1
![Page 37: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/37.jpg)
Comando - >, < ou >>
>: envia conteúdo para um arquivo<: carrega conteúdo de um arquivo
Sintaxe:$[comando] >, < ou >> [nome_arq]
Uso:$cat arq_01.txt > arq_02$cat arq_01.txt >> arq_02$tr az AZ < arq_01.txt
![Page 38: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/38.jpg)
Comando - cat
cat: capitura conteúdo de ou para um arquivo
Sintaxe:$cat [nome_arq]
Uso:$cat arquivo_01.txt$cat arq01.txt > arq02.txt$cat arq03.txt >> arq02.txt
![Page 39: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/39.jpg)
Comando - rev
rev: reverte a ordem de uma linha
Sintaxe:$rev [nome_arq]
Uso:$rev arq_01.txt
Bioinformática: sentido reverse Não tem opções de parâmetros
![Page 40: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/40.jpg)
Comando - `` (crase)
crase: utilizada para embutir comandos
Uso:$cp `find . name "*bla" exec grep e "No hits" {} H \;|cut d ":" f 1` no_hits/.
![Page 41: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/41.jpg)
Comando - ls
list : lista arquivosUso:$ls (ord. col)$ls l$ls ltr$ls lSr (ordena)$ls lh$ls m (vírgulas)$ls *
Uso:$ls d$ls I$ls 1 (1 per line)$ls g/n/ o$ls v (natural nro)$ls x (ord. Line)$ls a
![Page 42: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/42.jpg)
Comandos
● head● tail● Sort● Split● Echo● Touch● Nl● Cp
● Mv● Rename● Sed● Uniq● Cd● Mkdir● Wc● etc
![Page 43: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/43.jpg)
Comando - for
for: executa ações repetidamente
Sintaxe:$for word [ in wordlist ... ] ; do actions ; done
Uso:$for i in ls *.txt;do wc $i;done
![Page 44: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/44.jpg)
Comandos
Uso:$for i in {A..H}; do for j in {01..12};do touch echo "arquivo"$i$j;done;done$ls 1 arquivo* > tmp_arq$less tmp_arq$sort R tmp_arq > tmp_arq_rand$split l 30 tmp_arq_rand$for i in `grep e "arquivo" xaa`; do echo "No hits" > $i; done
![Page 45: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/45.jpg)
Practical Extraction and Report Language (Perl)
Existe mais de uma maneira de fazer{TMTOWTDI}
![Page 46: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/46.jpg)
Perl
● Perl foi criada para sistemas operacionais tipo Unix;
● Antes, existiam conglomerados de ferramentas: AWK, sed, linguagens shell e programas em C;
![Page 47: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/47.jpg)
Perl
● E, encontrando um pérola de grande valor, foi, vendeu tudo quanto tinha, e comprou-a. (Mt 13:46);
● Larry Wall
● 1954, 1976, 1987;
● Programador, Linguista e Autor;
● NASA Jet Propulsion Laboratory;
● Prêmios:– “International Obfuscated C Code Contest”
– Free Software Fundation (1998);
![Page 48: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/48.jpg)
Perl
● Ling. de computador: possibilitam x facilitam;
● Facilita:– tarefas fáceis;
– manipulações (textos, nros, arquivos, diretorios, computadores, redes, programas);
– execução de programas externos (envio e recebimento de resultados);
– desenvolvimento, modificação e depuração;
– compilação e execução em S.Os. modernos;
![Page 49: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/49.jpg)
Perl
● Linguagem de cola do Unix;
● Portável;
● A “mágica” está nas muitas origens :– Utilidade do seu conjunto de recursos;– Criatividade das comunidades;– Exuberância do movimento para “Open Source”;– Vigor híbrido;
![Page 50: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/50.jpg)
Perl
● Ponto forte é a herança mista;●
● Linguagem sofisticada de uso geral, com rico ambiente de desenvolvimento:– depuradores;– criadores de perfis e referencias cruzadas;– compiladores;– bibliotecas;– Editores orientados à sintaxe;– Outros adornos de uma LP “real”;
![Page 51: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/51.jpg)
Perl
● Uso:
– Engenharia espacial
– Biologia molecular;
– Matemática à linguística;
– Processamento gráfico à documentos;
– Manipulação de BD à gerenciamento de redes;
![Page 52: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/52.jpg)
Perl
● É divertida;
● Tem “graus” de liberdade (é simples e rica);
● É de fácil compilação e execução;
● Não impõe limitações arbitrárias;
● Pega elementos emprestados de outras LP: C, awk, BASIC, Phyton, inglês, grego, ...;
● Não é necessário saber tudo antes de começar (primeiro estágio);
![Page 53: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/53.jpg)
Perl
● Muitas das idéias foram tiradas da LN:
– Importante é transmitir seu recado;
– Qualquer nível de domínio é aceitável;
– Estará corretos se realizar sua função;
![Page 54: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/54.jpg)
Perl
● Todos os recursos funcionam em sinergia: – manipulação de arquivos;
– gerenciamento de processos;
– administração de banco de dados;
– programação cliente-servidor;
– programação de segurança;
– gerenciamento de informações baseado na web;
– e até, programação funcional e orientação a objeto;
● Criada para ser extensível de forma modular
![Page 55: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/55.jpg)
Perl
● Da liberdade pra “fazer a coisa certa”, não importa como você a defina;
● Programadores Perl andam com um largo sorriso no rosto;
● Com Perl você poderá desenvolver as três grandes virtudes do programador: preguiça, impaciência e orgulho;
![Page 56: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/56.jpg)
Perl
● MS Windows– ActivePerl
http://www.activestate.com/Products/ActivePerl/
● GNU/Linux– Nativo
● Apple Mac OS– MacPerl
http://www.macperl.com/
![Page 57: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/57.jpg)
CPAN
Comprehensive Perl Archive Network
![Page 58: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/58.jpg)
Documentação
● Parte da documentação é online;● Manpages são arquivos locais contendo
documentação, organizadas de forma separada:– man perl– man perldoc– man perlre (expressões regulares)– man perlsyn (sintaxe)– man perldata (tipo de dados)– man perlop (operadores e precedência)– man perlfaq1 (perguntas frequentes)
![Page 59: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/59.jpg)
Perl
● Declaração de variáveis implícitas. ● Strings e arrays não necessitam de definição de
tamanho. ● Todas variáveis são inicializadas com um valor
default.● Conjunto rico de operações de busca por "padrões"
em textos.● Conjunto completo de funções aritméticas.● Sintaxe simples, semelhante em alguns aspectos à
"C", mas bem diferente em outros.
“Filosofia de fazer o trabalho rápido e não de forma elegante.”
![Page 60: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/60.jpg)
Perl
● MS Windows– Notepad
– Edit (DOS)
● GNU/Linux – emacs
– vi– mc edit
– kedit
– kwrite
Em qualquer editor de texto a extensão deve ser .pl
![Page 61: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/61.jpg)
Perl
Ex.: programa.plEx.: programa.pl
#!/usr/bin/perl #!/usr/bin/perl
print 'Olá mundoprint 'Olá mundo..';'; # imprime o texto# imprime o texto
![Page 62: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/62.jpg)
Perl - escalares
Uma variável escalar começa com o símbolo $ seguido de uma seqüência de caracteres.
Ex.:
$nome = “Ana Paula”;# define um escalar string.
$numero = 125; # define um escalar inteiro.
$numero = 3.1416; # define um escalar de ponto flutuante.
Não declare variáveis como $1, $2, ...
Perl é Case sensitive. ($numero ≠ $Numero)
![Page 63: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/63.jpg)
Perl - aspas
$var = 10;
‘’ (aspas simples, imprime sem formatação.)
print ‘Camisa $var’; # Camisa $var
“” (aspas duplas, imprime o conteúdo das variáveis)
print “Camisa $var”; # Camisa 10
`` (utilizado para rodar comandos do sistema)
$conteudo = `ls /home`; # conteúdo de /home na var $conteudo
![Page 64: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/64.jpg)
Perl - arrays
As variáveis do tipo array começam com o símbolo @ e seguem a mesma regra para as variáveis
escalares.Ex.:
@cores = (“branco”,“preto”, “amarelo”); # define array de strings
@loteria = (4,8,15,16,23,42); # define um array de inteiros
print $cores[1]; # preto
print $#loteria; # 5
![Page 65: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/65.jpg)
Hash
As variáveis do tipo hash começam com o símbolo % e seguem a mesma regra para as variáveis
escalares.
Ex.:
%hash = ( chave1 => “valor 1”,
chave2 => “valor 2” );
●%cadastro = (nome = “Ana Paula”,idade = “25”)
print $cadastro{nome};# Ana Paula
![Page 66: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/66.jpg)
Lendo do teclado
#!/usr/bin/perl –w
print “Digite seu nome: “;
$nome = <STDIN>;
chomp ($nome);
print “Olá $nome! \n”;
![Page 67: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/67.jpg)
Comando - while
Enquanto a expressão for verdadeira
$x = 0;
while($x <= 20)
{
print "X = $x\n";
$x++;
}
print "Fim\n“;
![Page 68: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/68.jpg)
Comando - until
Até que a expressão seja verdadeira
until($x >= 20)
{
print "X = $x \n";
$x++;
}
![Page 69: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/69.jpg)
Comando - for
Executa o laço até a condição de parada
for ($i=0;$i<100;$i=$i+2)
{
print $i.”\n”;
}
![Page 70: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/70.jpg)
Comando - foreach
Executa o laço para cada elemento%hash = (“chave0” = ”branco”,
“chave1” = “preto”,
“chave2” = “amarelo”);
foreach $key (keys(%hash))
{
chomp $key;
print “$key: $hash{$key} \n ”;
}
![Page 71: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/71.jpg)
Comando - open
Abre arquivo para leitura, gravação e acréscimos
$arquivo = '/fasta/seq_fasta.txt'; # nome do arquivo
open(INFO,open(INFO, $arquivo);# abre o arquivo
@linhas = <INFO><INFO>;# coloca ele em um array
close(INFO);close(INFO);# fecha o arquivo
print @linhas;# exibe o arquivo
![Page 72: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/72.jpg)
Busca por padrão
$r = “aprender Perl parece complicado”;
if( $r =~=~ //Perl// ) {
print “Existe a palavra Perl na string\n”;
$r =~=~ s//Perl//C/g;
print “$r \n”;
}
![Page 73: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/73.jpg)
Comando - split
$info = “Paula:Edgard:Renato:João";
@pessoal = split(/:/,split(/:/, $info);
@pessoal = (“Paula", “Edgard", “Renato", “João");
print @pessoal;
![Page 74: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/74.jpg)
Sub (funções)
subsub nome_idade {
local($nome,$idade);
($nome, $idade) = ($_[0], $_[1]);
print “$nome - $idade.\n";
#renato – 25.
}
&&nome_idade(“renato”,25);# chama a sub-rotina
![Page 75: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/75.jpg)
Módulos
● use CGI; # web
● use DBI; # conexão com banco de dados
● use GD; # biblioteca gráfica●
● Use Bio; # bibliotecas BioPerl
![Page 76: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/76.jpg)
Exemplo 1
#!/usr/bin/perl# Coleta documentos do PubMed que contenham o termo #“Breast Cancer” e os imprime.use Bio::Biblio;
my $biblio = new Bio::Biblio;my $collection = $biblio->find(“breast cancer”);
while ($collection->has_next) { print $collection->get_next;}
![Page 77: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/77.jpg)
Exemplo 2
#!/usr/bin/perl
# Obtem uma sequencia do RefSeq (NCBI) pelo seu
#numero de acesso
use Bio::DB::RefSeq;
$gb = new Bio::DB::RefSeq;
$seq = $gb->get_Seq_by_acc(“NM_007304”);
print $seq->seq();
![Page 78: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/78.jpg)
Exemplo 3
#!/usr/bin/perl
# Executar processamentos em uma sequencia
use Bio::Seq;
my $seq = Bio::Seq->new( -seq => 'ATGGGGGTGGTGGTACCCT',-id => 'human_id', -accession_number => 'AL000012');
print $seq->seq() . “\n”; #imprime a sequência
# imprime complementar reverso
print $seq->revcom->seq() . “\n”;
# imprime uma tradução
print $seq->translate->seq() . “\n”;
![Page 79: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/79.jpg)
BLASTN 2.2.14 [May-07-2006]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms", Nucleic Acids Res. 25:3389-3402.Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) 5,391,126 sequences; 20,884,317,647 total letters
Searching
Query= Cris_1007007_155_1_A01_01.ab1 [903 71 257] 257 ABI (257 letters)
Score ESequences producing significant alignments: (bits) Value
gb|EF510754.1| Uncultured bacterium clone P2D15-512 16S ribosoma... 392 e-106gb|EF510704.1| Uncultured bacterium clone P2D15-690 16S ribosoma... 392 e-106gb|EF510498.1| Uncultured bacterium clone P2D1-490 16S ribosomal... 392 e-106gb|EF510495.1| Uncultured bacterium clone P2D1-485 16S ribosomal... 392 e-106gb|EF510482.1| Uncultured bacterium clone P2D1-723 16S ribosomal... 392 e-106
![Page 80: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/80.jpg)
>gb|EF510754.1| Uncultured bacterium clone P2D15-512 16S ribosomal RNA gene, partial sequence Length = 1503
Score = 392 bits (198), Expect = e-106 Identities = 201/202 (99%) Strand = Plus / Plus
Query: 30 agtaacgcgtaatcaacctgcccttcagagggggacaacagttggaaacgactgctaata 89 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 89 agtaacgcgtaatcaacctgcccttcagagggggacaacagttggaaacgactgctaata 148
Query: 90 ccgcatacgatctaatctcggcatcgaggatagatgaaaggtggcctctacatgtaagct 149 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 149 ccgcatacgatctaatctcggcatcgaggatagatgaaaggtggcctctacatgtaagct 208
Query: 150 atcactgaaggaggggattgcgtctgattagctagttggaggggtaacggcccaccaagg 209 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 209 atcactgaaggaggggattgcgtctgattagctagttggaggggtaacggcccaccaagg 268
Query: 210 cgatgatcagtatccggtctga 231 |||||||||||| |||||||||Sbjct: 269 cgatgatcagtagccggtctga 290
![Page 81: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/81.jpg)
gb|EF510704.1| Uncultured bacterium clone P2D15-690 16S ribosomal RNA gene, partial sequence Length = 1505
Score = 392 bits (198), Expect = e-106 Identities = 201/202 (99%) Strand = Plus / Plus
Query: 30 agtaacgcgtaatcaacctgcccttcagagggggacaacagttggaaacgactgctaata 89 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 90 agtaacgcgtaatcaacctgcccttcagagggggacaacagttggaaacgactgctaata 149
Query: 90 ccgcatacgatctaatctcggcatcgaggatagatgaaaggtggcctctacatgtaagct 149 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 150 ccgcatacgatctaatctcggcatcgaggatagatgaaaggtggcctctacatgtaagct 209
Query: 150 atcactgaaggaggggattgcgtctgattagctagttggaggggtaacggcccaccaagg 209 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct: 210 atcactgaaggaggggattgcgtctgattagctagttggaggggtaacggcccaccaagg 269
Query: 210 cgatgatcagtatccggtctga 231 |||||||||||| |||||||||Sbjct: 270 cgatgatcagtagccggtctga 291
![Page 82: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/82.jpg)
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Jun 21, 2007 5:50 PM Number of letters in database: 20,884,317,647 Number of sequences in database: 5,391,126 Lambda K H 1.37 0.711 1.31
GappedLambda K H 1.37 0.711 1.31
Matrix: blastn matrix:1 -3Gap Penalties: Existence: 5, Extension: 2Number of Sequences: 5391126Number of Hits to DB: 37,305,687Number of extensions: 1998395Number of successful extensions: 568880Number of sequences better than 1.0e-03: 123547Number of HSP's gapped: 567278Number of HSP's successfully gapped: 147387Length of query: 257Length of database: 20,884,317,647Length adjustment: 22Effective length of query: 235Effective length of database: 20,765,712,875Effective search space: 4879942525625Effective search space used: 4879942525625X1: 11 (21.8 bits)X2: 15 (29.7 bits)X3: 25 (49.6 bits)S1: 13 (26.3 bits)S2: 27 (54.0 bits)
![Page 83: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/83.jpg)
#!/usr/bin/perl
use strict;use warnings;
use Bio::SearchIO;use Bio::SearchIO::Writer::HSPTableWriter;
my ($file_blast) = $ARGV[0];
my $in = new Bio::SearchIO( -format => 'blast', -file => $file_blast);
my $writer = Bio::SearchIO::Writer::HSPTableWriter->new();
my $out = Bio::SearchIO->new( -writer => $writer, -file => ">searchio.out");
while ( my $result = $in->next_result() ) { print "report count:",$in->report_count,"\n";
$out->write_result($result, ($in->report_count - 1 ? 0 : 1) ); }
Parsing blast
![Page 84: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/84.jpg)
Resultado
![Page 85: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/85.jpg)
Bibliografia
Décio Jr. PerlGuia de Consulta Rápida. Novatec.
Larry Wall. Programação Perl.Campus.
Ellen Sievier, Stephen Spainbour &Nathan Patwardban.Perl Guia Completo.Ciência Moderna
Guelich, Gundavaram& Birznieks. ProgramaçãoCGI com PerlCiência Moderna.
![Page 86: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/86.jpg)
Bibliografia
David Cross.Gerenciamento de Dados com Perl.Ciência Moderna
Eric Herrmann.Aprenda em 1 Semana ProgramaçãoCGI com Perl 5.Campus.
David Cross.Gerenciamento de Dados com Perl.Ciência Moderna
Paul J. Deitel,David C. Mcphie,Harvey M. Deitel.Perl, Como Programar.Bookman
![Page 87: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/87.jpg)
Bibliografia
Gibas & Jambeck.DesenvolvendoBioinformática.Campus.
James Tisdall.Beggining PerlFor Bioinformatics.Oreilly & Assoc.
James Tisdall.Mastering PerlFor Bioinformatics.Oreilly & Assoc.
![Page 88: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/88.jpg)
Fauna do Perl
![Page 89: Introdução ao Linux - Início - NBCGIBnbcgib.uesc.br/nbcgib/files/intro_linux_Perl.pdf · Ubuntu Yellow Dog Linux ... Terminal (shell) Comando - man man: manual de uso da maioria](https://reader031.fdocument.pub/reader031/viewer/2022021608/5bb3bd7a09d3f25f6e8c3226/html5/thumbnails/89.jpg)
Obrigado!([email protected])