Article No. mb981887 J. Mol. Biol. (1998) 280, 721±729

Eye Lens bbbB2-crystallin: Circular Permutation doesnot Influence the Oligomerization State but Enhancesthe Conformational Stability

Karin Wieligmann1, Brian Norledge2, Rainer Jaenicke1 andEva-Maria Mayr1*

1Institut fuÈ r Biophysik undPhysikalische BiochemieUniversitaÈt RegensburgD-93040, RegensburgGermany2Laboratory of MolecularBiology, Department ofCrystallography, BirkbeckCollege, Malet Street, LondonWC1E 7HX, UK

Abbreviations used: cpbB2, circucrystallin; bB2�NC, bB2-crystallinterminal extensions; IPTG, isopropCD, circular dichroism.

0022±2836/98/290721±9 $30.00/0

The related vertebrate eye lens polypeptides, bB2- and gB-crystallin, eachfold into two similar b-sheet domains. The main difference is the state ofoligomerization resulting from intermolecular domain interactions in theoligomeric b-crystallins and intramolecular contacts in the monomericg-crystallins. The question arises whether it is possible to create a mono-meric gB-like bB2-molecule by protein engineering methods. We wantedto produce such a molecule by circularly permuting the domains of bB2-crystallin. The new termini were created from the original connectingpeptide, and the new linker from stumps of the original extensions, whilethe rest of the ¯exible extensions were deleted. As judged by circulardichroism and ¯uorescence, the permutation causes little change in thestructure of the protein. The circularly permuted protein forms dimers aswild-type bB2-crystallin. On the other hand, cpbB2 shows a slightlyenhanced stability against urea with a midpoint of transition of 2.1 Murea versus 1.9 M for the wild-type protein lacking N and C-terminalarms, thus indicating stronger domain interactions. To our knowledgethis is the ®rst circularly permuted protein which exhibits a higher stab-ility than the corresponding wild-type protein.

# 1998 Academic Press

Keywords: crystallins; circular permutation; domain association;oligomerization; protein stability

*Corresponding author

Introduction

The b and g-crystallins are water-soluble struc-tural proteins of the vertebrate eye lens. High solu-bility is an important attribute of crystallinproteins as it permits both light refraction andtransparency, while protein long-term stability isrequired as there is little protein turnover in theeye lens (Jaenicke, 1994; Wistow & Piatigorsky,1988). Two members of the b/g-crystallin super-family, bB2- and gB-crystallin, which share asequence identity of 36%, have been extensivelystudied. Each protein comprises mainly b structurefolded into two very similar domains. Eachdomain consists of two similar Greek key motifsthat intercalate to form two four-stranded anti-par-allel b-sheets (Blundell et al., 1981; Bax et al., 1990).

larly permuted bB2-lacking N and C-yl-b,D-thiogalactoside;

The crystallin-domains are always found associ-ated in pairs, by either forming intermolecular con-tacts in the case of oligomeric bB2-crystallin, orintramolecular interactions in monomeric gB-crys-tallin. The connecting peptide between the twodomains is bent in gB and extended in bB2-crystal-lin (Figure 1). Another major sequence differencebetween monomeric gB-crystallin and dimeric bB2-crystallin is the addition of N and C-terminalextensions in the dimer. In previous protein engin-eering experiments attempts were made to de®newhether the mode of association is determined bythe sequence of the connecting peptide, the domaininterface, or the sequence extensions of bB2-crystal-lin. It has been shown by substituting the bB2 con-necting peptide, residues 82 to 87, into gB-crystallin that the monomeric state is independentof the sequence of the linker (Mayr et al., 1994).Similarly, bB2 remained a dimer when the corre-sponding residues, 82 to 87 of the gB-linker, weregrafted into bB2 (Trinkl, 1995). However, whenresidues 80 to 87 of gB are substituted into bB2-

# 1998 Academic Press

Figure 1. A Ca backbone of the polypeptide chain ofmonomeric gB-crystallin (thick line), residues 1 to 174,the N-terminal domain on the right, is superposed onone pair of N and C-terminal domains of bovine bB2(thin line). Since the crystal structure did not resolve the¯exible extensions of bB2 only residues ÿ2 through to175 are shown. Note that for each polypeptide of bB2the position of the last observed residue, W175, is closeto the start of the N-terminal domain from the partnersubunit. The scissors indicate the positions where thelinker is cut in the cpbB2 molecule.

722 Circular Permutation of �B2-crystallin

crystallin, the dimer is converted into a monomer(Trinkl et al., 1994), although of increased hydro-dynamic radius and with a tendency to aggregate(Trinkl, 1995). These results show that in bB2 theb-crystallin conserved proline at position 80 playsan important role in determining domain associ-ation. The bB2 sequence extensions are disorderedin solution (Carver et al., 1993) and their removaldoes not promote monomer formation (Trinkl et al.,1994; Kroone et al., 1994). It has been suggestedthat these extensions may serve as ``spacers'' toenhance solubility in the eye lens and to preventformation of insoluble aggregates (Trinkl et al.,1994; David & Shearer, 1993).

A very popular method to assess the role of struc-tural elements, such as hinge regions, loops andinterdomain or intersubunit interfaces, in the foldingand stability of proteins, is circular permutation ofthe amino acid sequence (Heinemann & Hahn,1995). Circular permutation consists of linking thenatural amino and carboxyl termini with a new pep-tide bond and cleaving the circular molecule at oneof the surface loops to generate new termini. Thisinterconversion approach can be applied to all pro-teins whatever their structures and multimericstates, provided that chain termini are close to eachother and that loops, where new N and C terminicould be created, are accessible on the surface of the

protein. It has been shown that proteins with novelpolypeptide termini generated by circular permu-tation on either the protein or the gene level can foldin vitro and in vivo into species with enzymatic activi-ties and spectral characteristics similar to those ofthe original wild-type proteins. Most of the circu-larly permuted proteins show a slightly reducedconformational stability, some of them are signi®-cantly destabilized, but no permuted variant withenhanced stability was designed until now(Goldenberg & Creighton, 1983; Luger et al., 1989;Buchwalder et al., 1992; Yang & Schachman, 1993;Zhang et al., 1993; Protasova et al., 1994; Hahn et al.,1994; Mullins et al., 1994; Kreitman et al., 1994; Ritco-Vonsovici et al, 1995; Vignais et al., 1995; Koebnik &Kramer, 1995; Viguera et al., 1995; Pieper et al., 1997;Boissinot et al., 1997). With the method of circularpermutation of domains a given sequence can berearranged without disturbing the interactionbetween secondary structural elements in the pro-tein core.

Here circular permutation of bB2-crystallin wasperformed to get more information about the roleof the linker peptide and the interaction of thedomains in the overall folding and associationprocess. New N and C termini were createdwithin the connecting peptide and the domainswere covalently linked with the help of the ¯ex-ible extensions.

Results and Discussion

Design of circularly permuted bbbB2-crystallin

The design of the circularly permuted protein wasbased on a superposition of the monomeric gB anddimeric bB2-polypeptide chains (Figure 1). The qua-ternary structure of bB2-crystallin suggests that per-mutation of the N and C-terminal domains mightconvert the dimer of four domains to a two-domainmonomer. In order to make such a model with intra-molecular domain pairing, 15 residues of theN-terminal and 11 residues of the C-terminalsequence extensions were deleted and the resultingnew termini, W175 and N ÿ1, were joined. ResiduesV83 to Q86 of the original connecting peptide of thewild-type protein were deleted; this creates a circu-larly permuted two-domain bB2 starting with resi-due E87 and ending with residue K82. Modellingthis version of the circularly permuted bB2 indicatedthat the presence of the bulky side-chain of W175 inthe new linker, just at the point were it joins thesecond domain, might destabilize the structure. Itwas therefore replaced by a glycine residue. Thisexchange places a glycine in cpbB2 in a topologicallyequivalent position to G86 in gB-crystallin. Figure 2Apresents the sequences of cpbB2 and gB-crystallinwith the C-terminal domain of bB2 aligned with theN-terminal domain of gB and vice versa. The number-ing of the amino acids refers to native bB2-crystallin.Figure 2B presents the permutation schematically.The resulting circularly permuted construct consistsof 176 residues: a short N-terminal extension of one

Figure 2. A, Sequence alignment of circularly permuted rat bB2-crystallin and bovine gB-crystallin. The numbering ofcpbB2 is based on wild-type bB2-crystallin according to Bax et al. (1990). The ®rst digit identi®es the amino acid.B, Schematic representation of circularly permuted bB2-crystallin. The numbering of bB2-crystallin is based on gB-crystallin and therefore starts in the negative.

Circular Permutation of �B2-crystallin 723

residue, an 85 residue domain, a linker of ®ve resi-dues, and a second domain of 85 residues.

The most appropriate control molecule for thewild-type arrangement of domains is the truncatedversion of rat bB2-crystallin lacking the ¯exiblesequence extensions, bB2�NC (Trinkl et al., 1994).The protein comprises residues N ÿ1 to M173,therefore having nearly the same amino acid com-position as the circularly permuted variant.bB2�NC is puri®ed from the Escherichia coli cellextract in two different oligomeric forms: dimerand tetramer at a ratio of approximately 1:4. Nointerconversion of the two species is observed, buta denaturation and renaturation cycle of the tetra-mer yields only dimers. The stabilities of thesebB2-variants are identical with that of the wild-type protein (Trinkl et al., 1994). For control exper-iments, only the dimeric form was used.

Cloning, expression and purification

The gene coding for the circularly permuted bB2was ampli®ed in three PCR steps using the methodof gene splicing by overlap extension (SOE; Hortonet al., 1989). The resulting gene was cloned into theexpression plasmid pET11a (Studier et al., 1990),sequenced and found to be identical with the

planned circularly permuted bB2 sequence. TheE. coli strain BL21(DE3) (Studier & Moffatt, 1986)was transformed with the new plasmid pETcpbB2.Upon induction with IPTG, cpbB2 was found to bethe most abundant protein in the cytoplasmic frac-tion (Figure 3). cpbB2 was puri®ed from the cyto-plasmic extract of induced cells by sequentialanion and cation-exchange chromatography. Thepuri®cation of the protein was followed by silver-stained SDS-PAGE, as illustrated in Figure 3.Homogeneous cpbB2 was obtained in a yield of5 mg from one litre of E. coli culture. Amino-term-inal sequence analysis gave the expected aminoacid sequence for the ®rst 25 amino acid residuesof the permuted protein including the N-terminalmethionine.

Structure of the permuted protein

The native conformation of the circularly per-muted protein was assessed using CD and ¯uor-escence spectroscopy. The far-UV CD spectra ofcpbB2 and the native control, bB2�NC, which islacking the sequence extensions, are nearly identi-cal and demonstrate a high degree of secondarystructure. The mean residue ellipticities areremarkably large (ÿ10,000 deg cm2 dmolÿ1 at

Figure 4. Spectral properties of circularly permuted bB2and bB2�NC in 0.1 M sodium phosphate (pH 7.0);cpbB2 (Ð); bB2�NC ( ���� ). A, Far-UV CD spectra; B,near-UV CD spectra; C, ¯uorescence emission spectra(excitation wavelength, 280 nm). Protein concentration,400 mg/ml for CD spectra and 20 mg/ml for ¯uorescencespectra.

Figure 3. Silver-stained SDS-PAGE illustrating the puri-®cation of circularly permuted bB2-crystallin. Lane S,molecular mass standard; lane 1, soluble fraction of acell extract of induced cells of E. coli BL21(DE3)/pETcpbB2; lane 2, cpbB2 containing fractions after Q-Sepharose; lane 3, cpbB2 after SP-Sepharose.

724 Circular Permutation of �B2-crystallin

218 nm) compared to other b-sheet proteins(ÿ5000 deg cm2 dmolÿ1; Brahms & Brahms, 1980;and Figure 4A). The near-UV CD spectrum(Figure 4B), which is considered as a sensitive ®n-gerprint of protein tertiary structure, not only con-®rms the native conformation of the permutedprotein but is almost superimposable on thebB2�NC spectrum thus indicating that the domainstructure is not affected by the permutation.Although they have equivalent tyrosine andtryptophan residues, cpbB2 and bB2�NC haveslightly different ¯uorescence emission spectra(Figure 4C). The emission maximum is shiftedfrom 320 nm for bB2�NC to 316 nm for cpbB2.This may be attributed to a more compact confor-mation of the cp-variant with even less solventexposure of the ¯uorophores. Since the paireddomain contact sites do not bury any aromaticside-chains, spectroscopic detection of domaininteractions is not possible. Some circularly per-muted proteins show large differences in CD spec-tra relative to their native counterpart indicatingperturbations in the environment of aromatic resi-dues or less secondary structure, e.g. yeast phos-phoglycerate kinase (Ritco-Vonsovici et al., 1995) orRNAse T1 (Garrett et al., 1996).

State of association

The molecular mass was determined by analyti-cal ultracentrifugation (Table 1). For comparison

the data of bB2�NC are given. Sedimentation vel-ocity experiments at 0.2 to 0.6 mg/ml in 100 mMsodium phosphate buffer (pH 7.0) yielded singlesymmetrical boundaries with sedimentation con-stants s20,W � 3.34(�0.09) S. From high-speed sedi-mentation equilibrium experiments at initial

Table 1. Determination of the molecular mass of cpbB2 and bB2�NC in 0.1 M sodium phosphate buffer (pH 7.0)

ProteinAmino acid

residuesCalculated molecular

mass (kDa)aMolecular mass by analytical

ultracentrifugation (kDa) sc,20,w (S) State of association

cpbB2 176 20.13 39.5�1.8 3.34 DimerbB2�NC 178 20.50 35.5�2.3 3.42 Dimer

a The monomeric molecular masses were calculated from the amino acid sequences using the ``uwgcg'' program.

Circular Permutation of �B2-crystallin 725

protein concentrations of 0.2 to 0.6 mg/ml a mol-ecular mass of 39.5(�1.8) kDa was calculated. Evenat very low protein concentrations (<1 mM) nomonomers could be detected. The molecular massfor one subunit was calculated from the aminoacid composition to be 20,126 Da. Thus, the ultra-centrifugation data con®rm a dimeric state ofassociation. This result was somewhat unexpected,since the model of the circularly permuted proteinsuggested a gB-like molecule with intramoleculardomain pairing. On the other hand, the crystalstructure of cpbB2, which was solved by molecularreplacement at 2.8 AÊ (Wright et al., 1998) con®rmedindeed both facts: the dimeric state of associationand intramolecular domain pairing. In contrast tobB2 wild-type, the connecting peptide has a bentconformation leading to gB-like domain contacts,but two molecules are associated to form a com-pact dimer of four domains (Figure 5).

Folding and stability

Given the dimeric state of cpbB2, the questionarises whether the new mode of oligomerizationhas any stabilizing effect. The stability of the per-muted bB2-variant was investigated using ureaand temperature-induced equilibrium transitions(Figure 6). They were found not to be fully revers-ible due to aggregation at low denaturant concen-trations or high temperatures. In contrast, nativebB2-crystallin and the variant without extensions

Figure 5. Ca backbone trace of the cpbB2 dimer drawnusing SETOR (Evans, 1993). The two monomers, shownin black and grey, are related by a vertical 2-fold axis.The sequence termini are labelled.

(bB2�NC) are known to refold reversibly (Trinklet al., 1994).

Urea-induced unfolding transitions were per-formed at different protein concentrations in orderto investigate the stabilizing effect of quaternarystructure formation. They were monitored usingtwo different methods, ¯uorescence emission andcircular dichroism (Figure 6A and B). Both methodsrevealed unfolding pro®les that are monophasicand show the same cooperativity indicating a sim-ultaneous loss of secondary and tertiary structure.Due to different protein concentrations, the curvesare not superimposable but shifted to higher ureaconcentrations in the case of the higher protein con-centration. The half-concentration of the urea-dependent denaturation transition of cpbB2 is2.1 M for a protein concentration of 20 mg/ml and2.2 M for a protein concentration of 80 mg/ml.Under the same conditions the half-concentration ofthe urea-dependent denaturation transition ofbB2�NC is shown to be 1.9 M at both concen-trations. The stability of bB2�NC is known to beindependent of protein concentration due to anearly dissociation step at low urea concentrations(Trinkl et al., 1994). Since the unfolding of cpbB2shows a dependency on protein concentration,analytical ultracentrifugation was performed inthe presence of 0.8 M urea to exclude any dis-sociation. The obtained sedimentation coef®cient of3.32(�0.1) S and the molecular mass of 36.1(�0.4)kDa clearly demonstrate that no dissociation takesplace before the unfolding step. Presumably, thecircularly permuted variant obeys the two-statemodel of folding. Since renaturation experimentsyielded only about 80% refolded protein, werefrained from performing a quantitative thermo-dynamic analysis of the stability measurements.

The thermal stability of cpbB2 and bB2�NC wasmonitored in the temperature range between 20and 80�C following the loss of secondary structureat 225 nm (Figure 6C). Both proteins show identi-cal stability with a melting-temperature of 63�Cand in each case the denaturation process was irre-versible due to aggregation. In contrast, for wild-type bB2-crystallin heat denaturation was found tobe 90% reversible with a melting temperature of60�C (Trinkl, 1995; Maiti et al., 1988).

Chemical denaturation showed that the circu-larly permuted protein has enhanced stability com-pared to the wild-type protein and the bB2 variantlacking the extensions. To our knowledge, no circu-larly permuted protein described until now hasbeen found to exhibit a higher stability than thecorresponding wild-type. There are some proteins

Figure 6. Urea and temperature-induced denaturationtransitions of circularly permuted bB2-crystallin andbB2�NC in 0.1 M sodium phosphate (pH 7.0). A, Urea-induced denaturation transitions followed by ¯uor-escence emission at 315 nm; protein concentration:20 mg/ml; cpbB2 (*), bB2�NC (~). B, Urea-induceddenaturation transitions followed by the change of ellip-ticity at 220 nm; protein concentration: 80 mg/ml; cpbB2(*), (B2�NC (~). C, Thermal stabilities of cpbB2 andbB2�NC, protein concentration, 200 mg/ml, heating rate1 K/min; cpbB2 (Ð); bB2�NC ( ���� ).

726 Circular Permutation of �B2-crystallin

which seem to be strongly destabilized by themanipulations, e.g. RNase T1 (Garrett et al., 1996),yeast PGK (Ritco-Vonsovici et al., 1995) or a-spec-trin SH3 domain (Viguera et al., 1995). Some otherpermuted proteins, like GAPDH from Bacillus stear-othermophilus (Vignais et al., 1995) or T4 lysozyme(Zhang et al., 1993) show only marginal differences

in stability relative to the wild-type. The observedreductions in conformational stability are thoughtto arise mainly from strain introduced by the newlink between N and C termini. In the case ofcpbB2, the strong resemblance in the native proteinof C-terminal extension residues to a linker, allowsthem to be constructed into one. In addition, themore compact conformation of the four paireddomains explains the enhanced stability. In thewild-type protein, irrespective of extensions, eachdomain has only one contact site to anotherdomain of the second molecule, but there are nocontacts within one subunit. In the circularly per-muted bB2-crystallin, each domain interacts withtwo other domains, one in the same subunit andone in the other subunit (Figure 5).

Conclusions

Given the enhanced stability of the circularlypermuted bB2-crystallin, the question arises as towhy wild-type bB2 evolved with an extended con-necting peptide. On considering this problem onemust bear in mind the situation in the eye lenswhere bB2 polypeptides associate with relatedb-crystallins to form heterologous dimers and high-er oligomers in preference to self-association tohomodimers (Slingsby & Bateman, 1990). Evi-dently, the divergent evolution of the major com-ponents of the lens, b-crystallins, into basic andacidic protomers (Lubsen et al., 1988), involvedselection of heterologous interface regions that aremore complementary than isologous contacts,resulting in a phenotype with enhanced stability.Furthermore, the less stable four-domain homodi-mer of wild-type bB2, with only one contact sitefor each domain, will easily make new liaisons byexchanging with more favourable partner subunits.Increased polydispersity of lens crystallin com-ponents may be advantageous for lens transparencyby hindering regular long-range interactions thatcause refractive index ¯uctuations. Lens transpar-ency will also be endangered by small amounts ofnon-speci®c protein aggregation derived from mis-folding. Our work suggests that either less contactsites or sequence extensions confer the useful prop-erty of assisting complete refolding of the protein.

Materials and Methods

Materials

Ultrapure urea was obtained from ICN Biomedicals(Costa Mesa, Ca). Restriction enzymes and correspondingreaction buffers were from Boehringer (Mannheim,Germany) and Pharmacia (Uppsala, Sweden). Oligonu-cleotides were supplied by MWG-Biotech (Ebersberg,Germany). All other chemicals were analytical grade sub-stances purchased from Merck (Darmstadt, Germany).

Molecular cloning procedures and expression

Molecular cloning techniques were based onSambrook et al. (1989). The gene coding for circularly

Circular Permutation of �B2-crystallin 727

permuted (B2 was obtained according to the ``gene spli-cing by overlap extension'' method (SOE; Hortonet al.,1989) using the expression plasmid pETbB2. Twosets of oligonucleotide primers are required:

linkerA: 50cgtgacatgcagggtaaccctaagatcatcatcttc 30

linkerB: 50gatcttagggttaccctgcatgtcacggatgcgacg 30

cpA: 50atcttgtgctccggatcctattatttgatgggtctcagagaact 30

cpB: 50atcaaagtggaccatatggagcacaagatcatcttatat 30.

The ®rst primer set (linkerA and cpA) was used in the®rst PCR step to amplify the gene fragment coding forthe N-terminal domain, the second primer set (linkerBand cpB) was used in the second PCR step to amplifythe gene fragment coding for the C-terminal domain.The resulting fragments share a common overlappingsequence. They were isolated and combined in a thirdPCR step with the cpA and cpB primers to create anampli®ed fragment containing the circularly permutedsequence. The cpbB2 gene was cloned into theexpression plasmid pET11a (Studier et al., 1990) via therestriction sites NdeI and BamHI. Cells of E. coliBL21(DE3) (Studier & Moffatt, 1986) harbouring thecpbB2 expression plasmid were grown in ten litres ofLB-medium containing ampicillin (100 mg/ml) at 29�C.At an absorbance at 550 nm of 0.8, IPTG was added to a®nal concentration of 1 mM, and the cells were grownfurther for 16 hours. At this time the cells had reachedan A550 of 3.5 and were harvested by centrifugation (Sor-vall GS3, 5000 rpm, 15 minutes, 4�C). The plasmidpETbB2�NC (Trinkl et al., 1994) was used for bacterialexpression of bB2�NC.

Protein purification

The cells harbouring the plasmid pETcpbB2 werelysed by French press treatment in buffer A (50 mMTris-HCl (pH 8.5), 500 mM PMSF, 2 mM EDTA). Allpuri®cation steps were carried out at 4�C. The solublefraction of the E. coli extract was dialysed against bufferA and applied to a Q-Sepharose FF column (6 cm �1.5 cm; Pharmacia) equilibrated with the same buffer.After washing the column with buffer A, cpbB2 waseluted with 600 ml of a linear gradient of 0 to 500 mMNaCl in buffer A, and fractions of 5 ml were collected.Fractions containing cpbB2 (corresponding to NaCl con-centrations of 45 to 75 mM) were combined, dialysedagainst fve litres of buffer B (50 mM sodium acetate/NaOH (pH 4.8), 2 mM EDTA) and applied onto a SP-Sepharose FF column (6 cm � 1.5 cm, Pharmacia). Afterwashing the column with buffer B, cpbB2 was eluted asa single peak using a linear gradient (200 ml) of 0 to 1 MNaCl in buffer B. Fractions containing cpbB2 werepooled and dialysed against buffer C (100 mM sodiumphosphate, pH 7.0). The protein was recovered in ahomogeneous form as checked by SDS-PAGE (Fling &Gregerson, 1986) and silver staining. The puri®cation ofbB2�NC was performed as described by Trinkl et al.(1994). For long-term storage the proteins were shockfrozen with liquid nitrogen in small portions and storedat ÿ20�C in buffer C.

Spectroscopic measurements

UV-absorption spectra (240 to 350 nm) were recordedusing a Cary 1/3 (Varian) absorption spectrophotometer.Fluorescence emission spectra (300 to 400 nm) wererecorded on a Perkin Elmer MPF-3L spectrophotometer

equipped with a thermostated cuvette holder. The exci-tation wavelength was 280 nm, the excitation and emis-sion band widths 4 nm and 6 nm, respectively; theprotein concentration was 20 mg/ml. Circular dichroicspectra were monitored on a Jasco J-715 spectropolari-meter at a protein concentration of 400 mg/ml, using0.1 cm quartz cuvettes for far-UV CD spectra (250 to200 nm) and 1 cm quartz cuvettes for near-UV CD spec-tra (350 to 250 nm).

Protein concentration

The speci®c absorption coef®cient of cpbB2, A280nm,

0.1%, 1 cm � 1.89, was determined as described by Gill &von Hippel (1989) by comparing the absorbance ofnative and denatured cpbB2 (6 M GdmCl) at 280 nm.

Stability measurements

Denaturant-induced equilibrium transitions weremonitored by incubating the proteins at 20�C for30 hours at varying urea concentrations in 0.1 Msodium phosphate (pH 7.0). Denaturant concentrationswere calculated from the refractive indices of the sol-utions (Pace, 1986). The transitions were followed by¯uorescence and far-UV CD. The relative change in¯uorescence intensities was recorded at 315 nm (exci-tation at 280 nm). For CD measurements, the change inellipticity at 220 nm was recorded. Protein concen-trations were 20 mg/ml for ¯uorescence measurementsand 80 mg/ml for CD measurements. The thermal stab-ility was measured by heating the protein solutionfrom 20�C to 80�C at a constant heating rate of 1 K/min. The change in ellipticity was monitored at225 nm, the protein concentration was 200 mg/ml.

Determination of molecular mass

Sedimentation velocity and sedimentation equili-brium measurements were performed in a Beckmanmodel E ultracentrifuge equipped with a high-sensi-tivity light source and photoelectric scanning system,making use of double sector cells (12 mm) with sap-phire windows in an An-G rotor. In order to detectpossible concentration-dependent dissociation, themeniscus-depletion technique (Yphantis, 1964) wasapplied. Experiments were performed at 24�C, using ascanning wavelength of 280 nm. The s-values weredetermined at 15,000 and 44,000 rev/min, plotting lnrversus time, and correcting for water viscosity at 20�C.Sedimentation equilibria at 15,000 rev/min were calcu-lated from lnc versus r2 plots.

Acknowledgements

We thank Dr Stefan Miller for critically reading themanuscript and for helpful discussions and Glen Wrightfor providing us with the computer diagram of cpbB2.

References

Bax, B., Lapatto, R., Nalini, V., Driessen, H., Lindley,P. F., Mahadevan, D., Blundell, T. L. & Slingsby, C.(1990). X-ray analysis of bB2-crystallin and evol-

728 Circular Permutation of �B2-crystallin

ution of oligomeric lens proteins. Nature, 347, 776±779.

Blundell, T., Lindley, P., Miller, L., Moss, D., Slingsby,C., Tickle, I., Turnell, B. & Wistow, G. (1981). Themolecular structure and stability of the eye lens:X-ray analysis of g-crystallin II. Nature, 289, 771±777.

Boissinot, M., Karnas, S., Lepock, J. R., Cabelli, D. E.,Tainer, J. A., Getzoff, E. D. & Hallewell, R. A.(1997). Function of the Greek key connection ana-lysed using circular permutants of superoxide dis-mutase. EMBO J. 16, 2171±2178.

Brahms, S. & Brahms, J. (1980). Determination of proteinsecondary structure in solution by vacuum ultra-violet circular dichroism. J. Mol. Biol. 138, 149±178.

Buchwalder, A., Szadkowski, H. & Kirschner, K. (1992).A fully active variant of dihydrofolate reductasewith a circularly permuted sequence. Biochemistry,31, 1621±1630.

Carver, J. A., Cooper, P. G. & Truscott, R. J. W. (1993).1H-NMR spectroscopy of bB2-crystallin from bovineeye lens. Conformation of the N- and C-terminalextensions. Eur. J. Biochem. 213, 313±320.

David, L. & Shearer, T. (1993). b-Crystallins insolubi-lized by calpain II in vitro contain cleavage sitessimilar to b-crystallins during cataract. FEBS Letters,324, 265±270.

Evans, S. V. (1993). SETOR: Hardware lighted three-dimensional solid model representations of macro-molecules. J. Mol. Graph. 11, 134±138.

Fling, S. P. & Gregerson, D. S. (1986). Peptide and pro-tein molecular weight determination by electrophor-esis using a high-molarity Tris-buffer systemwithout urea. Anal. Biochem. 155, 83±88.

Garrett, J. B., Mullins, L. S. & Raushel, F. M. (1996). Areturns required for the folding of ribonuclease T1?Protein Sci. 5, 204±211.

Gill, S. C. & von Hippel, P. H. (1989). Calculation ofprotein extinction coef®cients from amino acidsequence data. Anal. Biochem. 182, 319±326.

Goldenberg, D. P. & Creighton, T. E. (1983). Circularand circularly permuted forms of bovine pancreatictrypsin inhibitor. J. Mol. Biol. 165, 407±413.

Hahn, M., Piotukh, K., Borriss, R. & Heinemann, U.(1994). Native-like in vivo folding of a circularly per-muted jellyroll protein shown by crystal structureanalysis. Proc. Natl Acad. Sci. USA, 91, 10417±10421.

Heinemann, U. & Hahn, M. (1995). Circular permutationof polypeptide chains: implications for protein fold-ing and stability. Prog. Biophys. Mol. Biol. 64, 121±143.

Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K. &Pease, L. R. (1989). Engineering hybrid genes with-out the use of restriction enzymes: gene splicing byoverlap extension. Gene, 77, 61±68.

Jaenicke, R. (1994). Eye-lens proteins: Structure, super-structure, stability, genetics. Naturwissenschaften, 81,423±429.

Koebnik, R. & Kramer, L. (1995). Membrane assembly ofcircularly permuted variants of the E. coli outermembrane protein OmpA. J. Mol. Biol. 250, 617±626.

Kreitman, R. J., Puri, R. K. & Pastan, I. (1994). A circu-larly permuted recombinant interleukin 4 toxinwith increased activity. Proc. Natl Acad. Sci. USA,91, 6889±6893.

Kroone, R. C., Elliott, G. S., Ferszt, A., Slingsby, C.,Lubsen, N. H. & Schoenmakers, J. G. G. (1994). Therole of the sequence extensions in b-crystallinassembly. Protein Eng. 7, 1395±1399.

Lubsen, N. H., Aarts, H. J. M. & Schoenmakers, J. G. G.(1988). The evolution of lenticular proteins: theb- and g-crystallin super gene family. Prog. Biophys.Mol. Biol. 51, 47±76.

Luger, K., Hommel, U., Herold, M., Hofsteenge, J. &Kirschner, K. (1989). Correct folding of circularlypermuted variants of a ba barrel enzyme in vivo.Science, 243, 206±210.

Maiti, M., Kono, M. & Chakrabarti, B. (1988). Heat-induced changes in the conformation of a- andb-crystallins: unique thermal stability of a-crystallin.FEBS Letters, 236, 109±114.

Mayr, E.-M., Jaenicke, R. & Glockshuber, R. (1994).Domain interactions and connecting peptides inlens crystallins. J. Mol. Biol. 235, 84±88.

Mullins, L. S., Wesseling, K., Kuo, J., Garrett, J. B. &Raushel, F. M. (1994). Transposition of proteinsequences: circular permutation of ribonuclease T1.J. Am. Chem. Soc. 116, 5529±5533.

Pace, C. N. (1986). Determination and analysis of ureaand guanidine hydrochloride denaturation curves.Methods Enzymol. 131, 266±280.

Pieper, U., Hayakawa, K., Li, Z. & Herzberg, O. (1997).Circularly permuted b-lactamase from Staphylococ-cus aureus PC1. Biochemistry, 36, 8767±8774.

Protasova, N. Y., Kireeva, M. L., Murzina, N. V.,Murzin, A. G., Uversky, V. N., Gryaznova, O. I. &Gudkov, A. T. (1994). Circularly permuted dihydro-folate reductase of E. coli has functional activity anda destabilized tertiary structure. Protein Eng. 7,1373±1377.

Ritco-Vonsovici, M., Minard, P., Desmadril, M. & Yon,J. M. (1995). Is the continuity of the domainsrequired for the correct folding of a two-domainprotein?. Biochemistry, 34, 16543±16551.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecu-lar Cloning: A Laboratory Manual, 2nd edit., ColdSpring Harbor Laboratory Press, Cold Spring Har-bor, NY.

Slingsby, C. & Bateman, O. A. (1990). Quaternary inter-actions in eye lens b-crystallins: basic and acidicsubunits of b-crystallins favor heterologous associ-ation. Biochemistry, 29, 6592±6599.

Studier, F. W. & Moffatt, B. A. (1986). Use of bacterio-phage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 189,113±130.

Studier, F. W., Rosenberg, A. H., Dunn, J. J. &Dubendorff, J. W. (1990). Use of T7 RNA polymer-ase to direct expression of cloned genes. MethodsEnzymol. 185, 60±89.

Trinkl, S. (1995). Ein¯uû von Strukturelementen aufAssoziation und StabilitaÈ t von bB2-Kristallin. PhDthesis, University of Regensburg.

Trinkl, S., Glockshuber, R. & Jaenicke, R. (1994). Dimeri-zation of bB2-crystallin: the role of the linker pep-tide and the N- and C-terminal extensions. ProteinSci. 3, 1392±1400.

Vignais, M.-L., Corbier, C., Mulliert, G., Branlant, C. &Branlant, G. (1995). Circular permutation within thecoenzyme binding domain of the tetrameric glycer-aldehyde-3-phosphate dehydrogenase from Bacillussterothermophilus. Protein Sci. 4, 994±1000.

Viguera, A. R., Blanco, F. J. & Serrano, L. (1995). Theorder of secondary structure elements does notdetermine the structure of a protein but does affectits folding kinetics. J. Mol. Biol. 247, 670±681.

Wistow, G. J. & Piatigorsky, J. (1988). Lens crystallins:The evolution and expression of proteins for a

Circular Permutation of �B2-crystallin 729

highly specialized tissue. Annu. Rev. Biochem. 57,479±504.

Wright, G., Basak, A. K., Wieligmann, K., Mayr, E.-M. &Slingsby, C. (1998). Circular permutation of bB2-crystallin affects the topology of domain pairing.Protein Sci. in the press.

Yang, R. Y. & Schachman, H. K. (1993). Aspartat trans-carbamoylase containing circularly permuted cataly-

tic polypeptide chains. Proc. Natl Acad. Sci. USA, 90,

11980±11984.

Yphantis, D. Y. (1964). Equilibrium ultracentrifugation

of dilute solutions. Biochemistry, 3, 297±317.Zhang, T., Bertelsen, E., Benvegnu, & Alber, T. (1993).

Circular permutation of T4 lysozyme. Biochemistry,

32, 12311±12318.

Edited by A. R. Fersht

(Received 23 October 1997; received in revised form 17 April 1998; accepted 28 April 1998)