Estudi d’associació de mutacions genòmiques rares en la...
Transcript of Estudi d’associació de mutacions genòmiques rares en la...
![Page 1: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/1.jpg)
Estudi d’associació de mutacions genòmiques rares en la predisposició al càncer a partir de tècniques de seqüenciació de nova generació
Geòrgia Escaramís Babiano
Grup de Genòmica i Malaltia
Departament de Bioinformàtica i Genòmica
Centre de Regulació Genòmica
19 de Desembre de 2016
![Page 2: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/2.jpg)
Index
Variation in Human Genome
Next Generation Sequencing
Cancer Predisposition Genes
Rare Variant Association Study (RVAS) Pipeline/Methods
RVAS in Chronic Lymphocytic Leukemia Project
RVAS in Pan-Cancer of Whole Genomes Project
![Page 3: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/3.jpg)
• Human Genome sequence of billions of bases (letters) A, G, T, C
TAGTCATTACAAATAACTCCTTTATTTCCGTTCCCTCTCCCCTCAAATGG
CTCATGTCCACATCAACAAGGCAAGGAAACATCTATGACCCCAACTATGA
AACATAGAAGCAGCTAATTCTGACTACATTGAAGCAGAGCACACACAATT
TGAAAGAAGCATAAGGAAGTATACAACAAACATGCATAAAAACCTTATGC
AACCACATCTGGGCCTTGTATTTATCACTCATTTTTATGATATTTTCTTC
TTTCGAAAGAATAGGATGAACCCATGCTCAAAACCTTTCTAAAGCATTTT
CAAAATACAGCTTTTTTGGTGGTACTTCAAAATAGGTTGGCACAAAACAA…
• Distributed over 24 chromosomes, each of which contains between 45 and 280MB
Variation in the Human Genome
![Page 4: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/4.jpg)
Variation in the Human Genome
Chromosomal variants
Substantial changes in chromosome
structure with strong effects on phenotype
Changes in the number of chromosomes
Polyploidy: the presence of three or more complete sets of chromosomes
Aneuploidy: the presence of additional chromosomes or missing individual chromosomes
Changes in the structure of the chromosomes
Translocations: a segment of one chromosome becomes attached to a non homologous chromosome
![Page 5: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/5.jpg)
Variation in the Human Genome
Structural variants
Copy Number Variant (CNV)
Deletion
Insertion
Duplication
Inversion
Usually complex regions
with segmental duplications
![Page 6: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/6.jpg)
Variation in the Human Genome
Structural variants
Copy Number Variant (CNV)
Deletion
Insertion
Duplication
Inversion
Usually complex regions
with segmental duplications
![Page 7: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/7.jpg)
Variation in the Human Genome
Structural variants
Copy Number Variant (CNV)
Deletion
Insertion
Duplication
Inversion
Usually complex regions
with segmental duplications
![Page 8: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/8.jpg)
Variation in the Human Genome
Relatively short variants
Single Nucleotide Polymorphism (SNP)
Insertions and deletions (indel)
Homozygote CC Heterozygote CT Homozygote TT
Maternal
chromosome
Paternal
chromosome
Genotypic frequencies
(+ strand)
CC 60 indiv (60%)
CT 30 indiv (30%)
TT 10 indiv (10%)
Genotypic frequencies
(- strand)
GG 60%
GA 30%
AA 10%c
Allelic frequencies
(+ strand)
C = (60*2 +30)/200 = 75% = 0.75
T = (30 + 10*2)/200 = 25% = 0.25
Minor allele frequency = MAF
Subject Subject 2 Subject 3
![Page 9: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/9.jpg)
http://www.nimr.mrc.ac.uk/mill-hill-essays/bringing-it-all-back-home-next-generation-sequencing-technology-and-you
Next Generation Sequencing
![Page 10: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/10.jpg)
Next Generation Sequencing
![Page 11: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/11.jpg)
Cancer Predisposition Genes - Background
• Definition of cancer predisposition genes (CPG)
“genes in which rare mutations confer high or moderate risks of cancer (greater than two fold relative risks) and to those for which at least 5% of individuals with the relevant mutations develop cancer”
![Page 12: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/12.jpg)
• Rare variants have larger effect sizes than common variants
Manolio et al., Nature 2009
Cancer Predisposition Genes - Background
![Page 13: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/13.jpg)
• Cancer Predisposition Genes
Rahman et al., Nature, 2014
Cancer Predisposition Genes - Background
![Page 14: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/14.jpg)
• Overlap of Somatic and Germline Cancer Genes
Rahman et al., Nature, 2014
• COSMIC database-468 somatically mutated genes • Mutual integration of somatically and germline mutated genes, an useful approach
for identification of new cancer genes.
10% of somatically mutated genes 40% of germline mutated genes
Cancer Predisposition Genes - Background
![Page 15: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/15.jpg)
• Approaches to identify cancer predisposition genes
Candidate gene
Genome-wide linkage/association studies
Exome/Genome Sequencing
Rahman et al., Nature, 2014
Cancer Predisposition Genes - Background
![Page 16: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/16.jpg)
Epidemiological Design
• Genes enriched in rare mutations in cases vs controls
Functional impact: Functional impact:
Cases Controls
Gen
es
Gen
es
Susceptibility genes
![Page 17: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/17.jpg)
Pipeline
* Lee et al. Am J Hum Genet. 2012 + Sun et al. Genet Epidemiol. 2013
x Liu et al. PLoS Genet. 2010
Dataset for AF
estimates
CASES CONTROLS
QC and Impact Filter
Rare variant association study
Outliers Variant
Classification
Burden test
(KBACx)
Sequence Kernel
Association Test*
(SKAT-O)
Mixed Effects
Model+
(Mist)
CASES Susceptibility
Genes
CADD impact
factor score
(EVS, 1KG, local)
Local Controls Split is repeated N times (N permutations)
![Page 18: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/18.jpg)
Association Methods
• Common variant analysis • Common variant: Minor allele frequencies (MAF) >= 5% • Using linkage disequilibrium(LD)
• Rare variant analysis • Rare variant: MAF < 1% (or 5%) • High allelic heterogeneity: collectively by multiple rare
variants with moderate to high penetrance's • Associations through LD would not be suitable
![Page 19: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/19.jpg)
Association Methods
Burden test: based on collapsing or summarizing the rare variants within a
region by a single value, which is then tested for association with the trait of
interest. Assumption: all variants have the similar effect magnitudes and
direction.
Heterogeneity effects test: allow different variants within a region to have
different directions and magnitude of effects, including no effects. Therefore
enriched and depleted variants are well accommodated.
Mixed-effects models: model a set of variants within a region as a function
of variant characteristics while allowing for variant-specific effect
(heterogeneity). Unifies burden and heterogeneity in a single procedure.
![Page 20: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/20.jpg)
Association Methods
Moutsianas et al., PLoS Genetics, 2015
![Page 21: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/21.jpg)
Association Methods (Kernel Based Adaptive Cluster)
• A burden test method
• M+1 mutation patterns (G0 , G1 , … , GM) across k variants
• ni1 and ni0 cases and controls with mutation pattern Gi
• Test statistic:
𝑻 = 𝒏𝒊𝟏𝒏𝟏−𝒏𝒊𝟎𝒏𝟎𝒘𝒊
𝑴
𝒊=𝟏
𝟐
where wi is a kernel-based weight on each mutation pattern Gi
• Allows to accounts for mutation interaction
Leu & Leal, PLoS Genetics, 2010
![Page 22: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/22.jpg)
Association Methods (Variance Component Tests)
confounders sample-based matrix
genotype vector for i-th individual
confounders variant-based vector for j-th mutation effect
t
i
t
ii GXYit log
j
t
jj Z
• Sequence Kernel Association Test Optimized (SKAT-O):
• j random effects with mean 0 and variance wjt
2
• H0: t2= 0
• Mixed-effects Test (MiST):
• Two step hierarchical approach
• j random effects with mean 0 and variance wjt
2
• H0: = 0 , t2= 0
![Page 23: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/23.jpg)
Association Methods (Our proposal)
t
i
t
i
t
ii GZGXYit log
• Generalized Linear Mixed Effects Model
• Estimated using Integrated Nested Laplace Approximation (INLA)
• j random effects with mean 0 and variance wjt2
• H0: = 0 , t2= 0
genotype vector for i-th individual
confounders variant-based vector for j-th mutation effect
![Page 24: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/24.jpg)
RVAS analysis in Chronic Lymphocitic Leukemia (CLL)
project
![Page 25: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/25.jpg)
CLL – Dataset Description
• 437 CLL samples (Whole Exome Seq.) – Spanish population samples – 2 Kits – 3 subtypes (CLL, SLL, MBL)
• 780 Controls (Whole Exome Seq.) – Spanish population samples – 3 Kits – Samples from ~18 different projects
(none of them is cancer study)
• Multisample call is done together on both, cases (CLL samples) and controls
![Page 26: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/26.jpg)
Number of mutations per patient
Count
Count
Number of mutations per patient
CLL – QC Filtration
![Page 27: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/27.jpg)
PC1
PC
2
CLL – QC Filtration PCA
![Page 28: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/28.jpg)
PC1
PC
2
CLL – QC Filtration PCA
![Page 29: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/29.jpg)
PC1
PC
2
CLL – QC Filtration PCA
![Page 30: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/30.jpg)
Mutations in genes (per 100 patients)
den
sity
CLL – QC Filtration Check
![Page 31: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/31.jpg)
A) 95 quantile of p-values < 0.05 B) 95 quantile of adjusted p-values < 0.05
CLL – Results for 3 methods
![Page 32: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/32.jpg)
• Interacts directly with other 6 cancer risk genes
• It is involved in cell division cycle
• Has one publication showing association between CDC27 and risk in breast cancer
CLL – Results Gene CDC27
![Page 33: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/33.jpg)
RVAS analysis in Pan-Cancer Analysis of Whole Genomes (PCAWG)
project
![Page 34: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/34.jpg)
PCAWG – Project Description
• 2818 whole genomes (normal tissues) of cancer patients across 47
worldwide cancer projects
![Page 35: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/35.jpg)
• Identify cancer specific germline rare mutations
1. Selected regions (GWAS hits, Rahman genes, DNA repair
genes) coding and regulatory variants above functional score threshold, grouped by gene.
2. Genome wide Rare Variant Association (coding and regulatory regions)
PCAWG – Goals
![Page 36: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/36.jpg)
PCAWG – Data Description – Population Structure
![Page 37: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/37.jpg)
PCAWG – QC Check in European Samples
![Page 38: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/38.jpg)
PCAWG – QC Check in European Samples
![Page 39: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/39.jpg)
PCAWG – Data Description in Europeans
Breast cancer vs non-ECTODERM
Medulloblastoma vs non-NEURAL-CREST
Pancreatic cancer vs non-ENDODERM
Ovarian cancer vs non-MESODERM
Lung cancer vs non-ENDODERM
Kidney cancer vs non-MESODERM
CLL vs non-MESODERM
Skin cancer vs non-NEURAL-CREST
Lymphoid vs non-MESODERM
Prostate cancer vs non-ENDODERM
141
275
188
97
99
95
104
157
81
174 1551
1551
1123
1123
1123
1738
1225
1225
1225
1225
![Page 40: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/40.jpg)
PCAWG – Results by Cancer Type in Europeans
Genes Protein Truncating Variants
![Page 41: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/41.jpg)
PCAWG – Results by Cancer Type in Europeans
Genes with Missense Variants
![Page 42: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/42.jpg)
Genes with promoter variants using Funseq2 damaging score
PCAWG – Results by Cancer Type in Europeans
![Page 43: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/43.jpg)
Genes with promoter variants using MDS damaging score
PCAWG – Results by Cancer Type in Europeans
![Page 44: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/44.jpg)
Population substructure: driven by variants more frequent in latino vs european (EXAC / gnomad database)
PCAWG – Results by Cancer Type in Europeans
Chronic Lymphocytic Leukemia
![Page 45: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/45.jpg)
A Subway Map for Cancer Pathways
By Claudia Blentley
![Page 46: Estudi d’associació de mutacions genòmiques rares en la …sct.uab.cat/estadistica/sites/sct.uab.cat.estadistica/files/RVAS... · Pipeline * Lee et al. Am J Hum Genet. 2012 Sun](https://reader033.fdocument.pub/reader033/viewer/2022050410/5f870c167f0ee66e7217ac7a/html5/thumbnails/46.jpg)
Genomics and Disease Group
Estivill, Xavier
Rabionet, Kelly
Domenech, Laura
Prasad, Aparna
Holik, Aliaksei
Genomics and Epigenomic Variation in Disease Group
Ossowski, Stephan
Susak, Hana
Bosio, Mattia
Muyas, Francesc
Acknowledgments