Eia sujawal

MMMMMMMMAAAAAAAARRRRRRRRIIIIIIII PPPPPPPPEEEEEEEETTTTTTTTRRRRRRRROOOOOOOOLLLLLLLLEEEEEEEEUUUUUUUUMMMMMMMM CCCCCCCCOOOOOOOOMMMMMMMMPPPPPPPPAAAAAAAANNNNNNNNYYYYYYYY LLLLLLLLIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEEDDDDDDDD MMMMMMMMPPPPPPPPCCCCCCCCLLLLLLLL

DDDDDDDDrrrrrrrraaaaaaaafffffffftttttttt RRRRRRRReeeeeeeeppppppppoooooooorrrrrrrrtttttttt

DDDDDDDDaaaaaaaatttttttteeeeeeee:::::::: DDDDDDDDeeeeeeeecccccccceeeeeeeemmmmmmmmbbbbbbbbeeeeeeeerrrrrrrr 22222222000000001111111144444444

DDDDDDDDiiiiiiiivvvvvvvviiiiiiiissssssssiiiiiiiioooooooonnnnnnnn:::::::: EEEEEEEEnnnnnnnnvvvvvvvviiiiiiiirrrrrrrroooooooonnnnnnnnmmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaallllllll SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeeessssssss

SGS Pakistan (Private) Ltd.

EEEEEEEEnnnnnnnnvvvvvvvviiiiiiiirrrrrrrroooooooonnnnnnnnmmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaallllllll IIIIIIIImmmmmmmmppppppppaaaaaaaacccccccctttttttt AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssssmmmmmmmmeeeeeeeennnnnnnntttttttt ((((((((EEEEEEEEIIIIIIIIAAAAAAAA))))))))

SSSSSSSSttttttttuuuuuuuuddddddddyyyyyyyy ooooooooffffffff EEEEEEEExxxxxxxxpppppppplllllllloooooooorrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn AAAAAAAAccccccccttttttttiiiiiiiivvvvvvvviiiiiiiittttttttiiiiiiiieeeeeeeessssssss iiiiiiiinnnnnnnn SSSSSSSSuuuuuuuujjjjjjjjaaaaaaaawwwwwwwwaaaaaaaallllllll

BBBBBBBBlllllllloooooooocccccccckkkkkkkk //////// SSSSSSSSiiiiiiiinnnnnnnnddddddddhhhhhhhh

Executive Summary i of vii

Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014

EXECUTIVE SUMMARY

Mari Petroleum Company Ltd (MPCL) was granted exploration license for the Sujawal Block

(EL-2467-11) Sindh in June 2006 with 100% working interest. In order to carryout Exploration &

Production activities, MPCL conducted an IEE study in August 2007 for a proposed area and

was granted NOC/approval from SEPA in November 2007. Subsequently, MPCL carried out

Seismic data acquisition in the year 2008.

Now, MPCL intends to further amplify the exploration activities including 2D/3D seismic

survey and drilling activities at Sujawal Block (EL-2467-11), after fulfilling the associated

environmental regulations. MPCL has contracted SGS Pakistan (Private) Limited (SGS) to carry

out environmental assessment of the proposed activities in order to assess the environmental

viability of the same. This report has been prepared in accordance with the requirements set-

forth in Sindh Environmental Protection Act 2014 (SEPA), the Pakistan Environmental

Protection Agency (Review of IEE ad EIA) Regulations, 2000 and the guidelines provided in the

Pakistan Environmental Assessment Procedures, 1997. Section-17 of SEPA 2014 which states

that: "No proponent of a project shall commence construction or operation unless he has filed with the

Agency an initial Environmental Examination or Environmental impact Assessment, and has obtained

from the agency approval in this respect thereof”.

The Pakistan Environmental Protection Agency (Review of EIA/IEE) Regulations 2000 clearly

defines the categories of projects requiring an Initial Environmental Examination (IEE) or

Environmental Impact Assessment (EIA) referred to in Schedules I & II respectively. According

to Schedule II, Category I (Environmentally Sensitive Areas), defines that the projects situated

in environmentally sensitive area require an EIA. The EIA study has been carried out in

consideration of:

• Major concerns on the microenvironment in which the project is proposed to be sited;

• Construction and operational phase impacts being confined to and localized into the

microenvironment;

• Sujawal block encompasses number of wildlife protected and reserve forest areas including

Mirpursakro (Game Reserve), Cut Munarki Wildlife Sanctuary, Bijora Chach Wildlife

Sanctuary, Gullel Kohri Wildlife Sanctuary, Munarki Wildlife Sanctuary and Sadnani

Wildlife Sanctuary and most of the protected areas are located along Indus River including

Reserve forests.

Mari Petroleum Company Limited is one of Pakistan’s largest E&P companies operating the

country’s 2nd largest gas reservoir at Mari Field, District Ghotki, Sindh. The Company is

primarily engaged in exploration, development and production of hydrocarbon potentials

(Natural gas, Crude oil, Condensate & LPG) in the country. MPCL is also exploring

opportunities of expanding its business to become a significant player in the International

hydrocarbon Market. At present, in addition to Mari Gas Field, MPCL operates nine exploration

blocks (Ziarat, Hanna, Harnai, Sukkur, Sujawal, Karak, Ghauri, Peshawar East and Khetwaro)

Executive Summary ii of vii


and one D&P Lease (Zarghun South). The Company is also a non-operating joint venture

partner in six exploration blocks (Kohlu, Kalchas, Kohat, Bannu West, Zindan and Hala).

Moreover, the Company is also joint venture partner in block 43B with 25% working interest in

Oman with MOL.

MPCL is planning to conduct further exploration work including seismic (2D/3D) and drilling

activities in Sujawal Block. The Block is located in district Thatta and Sujawal of Sindh, having a

total area of about 2,416.43 square kilometres (km2), whereas, reserve forest areas of the block

comprises of about approximately 570.23 km2. MPCL is planning to acquire 2D seismic data in

approximately 320 Line km (L. Km) and 900 sq. km for 3D data, followed by drilling activity. It

is envisaged that one well will be drilled on the basis of seismic survey data, most probably at

eastern part of the block.

The project duration for construction and operation for drilling well is expected to take 5-6

months. The drilling schedule for well operation is expected to be as under:

Seismic Activities: 24 weeks

Construction Work: 12-16 weeks

Mobilization: 3-4 weeks

Drilling and Testing: 12-16 weeks

Demobilization: 2-3 weeks

The project shall require approximately 1700 gallons of water per day and 2,500 litres of fuel per

day during construction phase and seismic activities respectively and approximately 50,000 to

60,000 gallons of water per day & 8,000-12,000 litres of fuel per day during Operation/Drilling

Phase.

The project area falls in the district Thatta and Sujawal of Sindh province. The district is

bounded in the north by Dadu district, in the south by Runn of Katch area, in the east by

Hyderabad and Badin Districts and in the West by Karachi Division. Total area of both districts

is 17,355 km2 and comprises of 9 talukas, out of which six are coastal and three are non coastal

talukas; and 53 Union Councils. District Sujawal consists of Taluka Mirpur Bathoro, Shah

Bander, Kharochan, Jati and Sujawal, while, District Thatta consists of Taluka Mirpur Sakhro,

Ghorabari, Keti Bandar and Thatta. Among these talukas, EIA study area spreads over in

Mirpur Sakhro, Mirpur Bathoro, Jati Sujawal, Thatta and Ghorabari. Talukas of the districts.

The macro-environment of the project area i.e. district Thatta and Sujawal have varied features

in its physical aspects, which range from coastal swamps to fresh water marshes and lakes and

from river islands to coastal deltas. The current terrain of the districts consists of the Makli Hills

in the vicinity of Thatta town. These hills are 32 km in length and are well known on account of

the ancient tombs which are located here. The north western part of the district consists of hilly

tracts known as Kohistan. Between Sir and Khori Creeks lie the great Sirganda salt deposits

Executive Summary iii of vii


The Lower Indus Platform Basin is bounded to the north by the Central Indus Basin, to the

northwest by the Sulaiman Foldbelt Basin and the Kirthar Fold Belt Basin in the south west.

The climate of the Thatta, Sujawal district is moderate. The mean maximum and minimum

temperature recorded about 40°C and 25°C respectively. The sea breeze blows for eight months

of the year, from March to October, making the hot weather comparatively cool. January is

recorded as the coldest month of the year. The annual average rainfall of the district is recorded

as approximately 200 mm.

Besides Indus, the district Thatta/ Sujawal has numerous water courses which drain from the

hills and are known as Nais. The important Nais is the district is Gagar and Ranpathani. There

are many lakes in the district. The famous are Kalri and Haleji. Kalri is a picturesque lake,

situated about 19 Km south of Thatta. It was formed by joining of two lakes Kinjhar and

Sonehri, and takes its present name from the main canal Kair-Bagha feeder, from which it is

currently fed. This lake acts as a great reservoir for feeding canals of Thatta sub-division. In

project area natural and manmade wetlands exist in which rain or flood and irrigated waste

water is stored. These wetlands are commonly called Dhands. Wetlands have mechanism to

provide shelter to different animals, reptiles, fish and bird’s species & preservation of bio-

diversity. Ground water is available in the project area for domestic and drinking purposes.

Main source of recharging groundwater is Indus River while, ground water table in project area

varies from 20 ft to 60 ft.

The air quality in the area is generally good, with negligible sources of pollution like emissions

from vehicular traffic that causes smoke and dust emissions with localized effect. Elevated noise

is viably absent in project proximities due to absence of noise causing equipments in the project

corridors.

The block has been occupied by agricultural settlements comprising of sugarcane, cotton,

wheat, tomato banana plantations & seasonal vegetables. The macro-environment along the

north east and north west part of the project area is occupied, mainly by agricultural fields and

human settlements. The agricultural lands are spread over both sides of the road leading to

major and minor settlements in the area.

The project area is located in the eastern and western side of the Indus River, where there is a

number of Reserve Forests. The one major forest type that falls within the study area is Riverine

forest along the banks of the Indus. Major species of the Riverine forest are Babul or Kiker

(Acacia nilotica), Kandi (Prosopis cineraria) Bahun ( Prosopis euphartica) and Lai (Tamarix

Spp.). Acacia nilotica is the most common species in the project area, while Prosopis Spp. is also

fast growing in the project area.

The common and widespread species of birds includes: Common Myna, Bank Myna, Common

Kite, House Crow, House Sparrow, White-cheeked Bulbul, Ring Dove and Little Brown Dove.

During our field visit 18 mammals, 41 birds and 14 reptiles’ species were reported/observed

within the project area. A small number of migrant species of birds was also recorded in the

area. About 08 species of migratory birds were observed in the project area which is, Common

Executive Summary iv of vii


Kestrel, Common Sandpiper, Pale Crag Martin, Common Swallow, Common Chiffchaff, Black

Redstart, White Wagtail and Yellow Wagtail.

According to the census of 1998 the population of Thatta district was recorded at 1.113 million.

The population of project area distributed among urban and rural areas. According to 1998

Cenus report, 11 percent population is characterized as urban and remaining 89 percent is rural.

Current population (2014) of the both the districts is estimated to be 1.6 million. The estimated

population density is 92 person sq. km. The recent (2013-14) literacy rate for both the districts is

36 percent, among them 48 percent are males and 23 percent are females.

People of different castes dwell in the project area. It includes Shora, Khaskheli, Panhwar,

Khuwaja, Baloch, Chandia, Alwani, Otha, Awan, Lashari, Kalmati, Jokhia, Dul, Sayyed, Jat,

Samo, Mallah, Mirbahar, Soho, Rind, Khalifa, Lothya, Halayo, Burfat, Memon, Shaikh, Nahiyo,

Zangiani, Gaho, Sheedi, Palari and Solangi. Majority are Muslims and Sindhi speaking; while a

few are non- Muslims specially scheduled castes of Hindus.

The western boundary of Sajawal block falls inside the declared protected area i.e. Marho

Kotri Wilde life Sanctuary.

The proposed study has been carried out to take into an account likely positive and negative

impacts of exploration activities on the physical, biological and social environment. The

assessment was primarily focused on the impact of activities due to construction at camp site,

well site seismic and drilling operation on the physical, biological and social environment. The

major areas covered in the impact analysis include wastewater, solid waste, biodiversity, water

resources and socioeconomic factors as well as occupational health safety.

A detailed assessment of the environmental issues due to each impact has been carried out.

After assessment of potential impacts, if the predicted impact is classified as significant, suitable

mitigation measures will be suggested to reduce the consequences or likelihood of occurrence

of that particular impact. There is a range of mitigation measures that will be applied during the

different phases of proposed project which can reduce adverse environmental, biological and

social impacts.

Potential impacts of the project are identified by utilizing different means and ways including

desktop screening exercise, using checklist during field visit for collection of baseline data,

professional judgment, published literature on environmental impact of similar projects and

environmental guidelines. It is identified the project activities may involve the clearing of land

for campsite and access track which can cause dust emissions, erosion of land, and generation

of construction waste, noise and damage to the surrounding structures. This may be avoided by

proper management and planned as suggested in Environmental Management Plan. The

seismic and drilling activities generate waste and noise which may affect the water resources,

soil, air biodiversity and the local community settled in the vicinity of the project. Therefore it is

suggested that work may be avoided or kept to minimum at night to avoid community and

wildlife disturbances with reference to noise. To keep the disturbance level at minimum it is

advised to maintain a fair distance from community and water bodies as much as possible.

Executive Summary v of vii


The effect of vegetation clearing and loss of habitat is less significant for development activities

because campsite will be constructed at existing cleared land wherever possible, dense patches

of vegetation will not be removed and new tracks will be avoided as much as possible. Loss of

vegetation will be observed mainly for the development of access track. However, mitigation

measures recommended will ensure that the impacts are kept to the minimum possible.

Improper waste management practices will favour waste accumulation in nearby environment

and may deteriorate aesthetical and environmental conditions of the project site and requires

serious consideration. Surface water quality may deteriorate if pollutants are mixed with

surface runoff during rain and carried to water resources in the vicinity.

The sources of emissions during construction and drilling will not be significantly enough to

alter the ambient air quality. The existing air quality in the area is generally good, with very few

sources of pollution and dust emissions with localised impact.

Emissions in the form of oxides of carbon, nitrogen and sulphur will be produced during

flaring. Flaring is a much better environmental option than venting. As the flare will be kept

downwind of the well site and at least 300 m away from any community no impacts on

communities or workers will occur.

Vehicular movement is not a continuous activity which could cause continuous impacts on

wildlife and local community. As the project facilities will maintain appropriate distances from

human settlements, disturbance to local community due to dust, noise and accident because of

vehicular movement will be insignificant.

The impacts on community due to proposed project are negligible as compared to the potential

improvement of social status of the community as a result of generation of new employment

opportunities. There will be positive impact on sanitation, transportation, communication and

community health due to development in the project area.

Failure to maintain the appropriate project activity distance from the local communities may

possibly create disturbance due to noise, dust, vehicular movement, and improper disposal of

waste generated due to project activities. Access track passing close to the settlement may also

result in disturbance to the locals. Moreover, sharing of local resources may be the point of

conflict between project proponent i.e. MPCL, and local community. All these impacts due to

seismic, construction and drilling activities would be of variable significance that would be

minimized through MPCL Cooperate Social Responsibility (CRS) Policy and through applicable

laws and regulation.

Mitigation measures have been proposed to minimize the environmental & social impacts.

MPCL shall watch over all activities and shall adopt mitigation measures so that the activities

are performed in an environmentally sound manner.

In addition to the impact assessment and mitigation measures suggested, the implementation of

environmental Management Plan (EMP) will be sufficient to mitigate potential environmental

impacts therefore, an EMP has been produced and compiled for the assistance of MPCL which

Executive Summary vi of vii


shall supervise and monitor all the mitigation measures and their effectiveness. The overall

responsibility for compliance with the environmental guidelines and mitigation measures will

rest with MPCL. The contractor will have liabilities under the environmental laws and under

the contract with MPCL to follow the EMP and environmental guidelines.

Based on the environmental baseline and assessment of potential impacts, it has been concluded

that if the activities are undertaken as per suggested mitigation measures and Environmental

Management & Monitoring Plan is effectively implemented, the project activity will not cause

any significant impact on the natural environment, wildlife and local community of the Sujawal

Block.

Executive Summary vii of vii

Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh

2014

Figure ES-I: Location Map of Sujawal Block along

Chapter 02 1 of 4


TABLE OF CONTENTS

EXECUTIVE SUMMARY 1

1. INTRODUCTION 1

1.1. Preamble 1

1.2. The Sujawal Block 1

1.3. Project Title 1

1.4. Project Proponent 1

1.5. Project Overview 2

1.6. Environmental Consultant 2

1.7. EIA Requirement 3

1.8. Project Categorization 3

1.9. Organization of the Report 4

1.10. Contact Details 5

2. SCOPE AND METHODOLOGY 1

2.1 EIA Process 1

2.1.1 Overview of EIA 1

2.1.2 Objective of EIA 1

2.1.3 Scope of EIA 1

2.2 EIA Methodology 2

2.2.1 Understanding of the Proposed Project 2

2.2.2 Legislative Review 2

2.2.3 Secondary Resources/ Baseline Review 2

2.2.4 Scoping Sessions 2

2.2.5 Approval for Field Visit 3

2.2.6 Site Visit and Primary Data Collection 3

2.2.7 Evaluation of Alternatives 3

2.2.8 Identification, Screening and Assessment of Impacts 3

Chapter 02 2 of 4


2.2.9 Impacts Assessment and Mitigation Measures 4

2.2.10 Environmental Management Plan 4

2.2.11 Reporting/Documentation 4

3. LEGAL FRAMEWORK 1

3.1 Constitutional Provision 1

3.2 Framework of Environment and Wildlife Institution in Pakistan 1

3.3 National Environmental Policies 2

3.3.1 National Environmental Policy, 2005 2

3.3.2 National Conservation Strategy 3

3.3.3 National Environmental Action Plan-Support Programme (NEAP-SP) 3

3.3.4 Policy & Procedures for the Filing, Review and Approval of Environmental Assessments 3

3.3.5 Petroleum Exploration & Production Policy 2012 3

3.4 National Environmental Legislation 4

3.4.1 Sindh Environmental Protection Act 2014 5

3.4.2 Pakistan Environmental Protection Agency Review of IEE and EIA Regulations, 2000 6

3.4.3 The National Environmental Quality Standards (NEQS) 6

3.4.4 Self-Monitoring & Reporting Rules 6

3.5 The Forest Act 1927 6

3.6 Sindh Wildlife Protection Ordinance, 1972 (SWPO) and Amendments 2001 7

3.7 Sindh Fisheries Ordinance, 1980 7

3.8 Petroleum Act 1934 8

3.9 The Mines Act 1923 8

3.10 Regulation of Mines and Oil Fields and Mineral Development (Government Control)

Act, 1948 9

3.11 Exploration and Production Rules, 1986 9

3.12 The Oil and Gas (Safety in Drilling and Production) Regulations, 1974 9

3.13 Antiquities Act 1975 and the Sindh Cultural Heritage (Preservation) Act, 1994 9

3.14 Land Acquisition Act, 1894 10

3.15 Pakistan Penal Code (1860) 10

Chapter 02 3 of 4


3.16 Explosive Substances Act 1908 10

3.17 Explosives Act 1884 11

3.18 National Environmental Guidelines 11

3.18.1 The Pakistan Environmental Assessment Procedures, 199 11

3.18.2 Guidelines for Operational Safety, Health and Environmental Management, December 1996 12

3.18.3 Guidelines for Public Consultation 12

3.18.4 Sectoral Guidelines for Environmental Reports Oil & Gas Exploration and Production 12

3.19 International Guidelines 12

3.19.1 World Bank Guidelines on Environment 12

3.19.2 IFC Performance Standards 13

3.19.3 IFC Environmental, Health & Safety Guidelines 13

3.20 International Conventions & Treaties 14

3.20.1 International Convention on Biodiversity 14

3.20.2 The Convention on Conservation of Migratory Species of Wild Animals, 1979 14

3.20.3 The Convention on Wetlands of International Importance, Ramsar 1971 14

3.20.4 Convention on International Trade in Endangered Species of Wild Fauna and Flora (Cites) 15

3.20.5 International Union for Conservation of Nature and Natural Resources (IUCN) Red List 15

3.21 International and National Environment and Conservation Organization 16

3.22 MPCL Corporate Requirements 16

4 PROJECT DESCRIPTION 1

4.1 Introduction 1

4.2 Project Need 1

4.3 Project Objective 2

4.4 Project Area 2

4.5 Proposed Project 2

4.6 Seismic Operations 3

4.7 Methodology for Seismic Survey 3

4.7.1 Camp Site Selection and Access Track 4

4.7.2 Camp Establishment and Mobilization 4

Chapter 02 4 of 4


4.7.3 Land Permitting: 4

4.7.4 Line Survey and Preparation: 4

4.7.5 Data Acquisition: 7

4.7.6 Restoration and Rehabilitation: 9

4.7.7 Accommodation and Suites: 10

4.8 Drilling Operation 10

4.8.1 Sujawal block EL Construction Phase 10

4.8.2 Civil Work Activities 10

4.9 Well Drilling Operation Phase 12

4.9.1 Rig Mobilization 12

4.9.2 Drilling Operation 12

4.9.3 Drilling Mud 13

4.9.4 Disposal of Drilling Wastes 16

4.9.5 Well Completion 16

4.9.6 Well Evaluation and Testing 16

4.9.7 Well Control and Blow Out Prevention 16

4.9.8 Accommodation and Supplies: 17

4.10 Decommissioning/ Restoration Phase 17

4.10.1 Demobilization 17

4.10.2 Restoration 17

4.11 Project Schedule 18

4.12 Resource Usage and Requirement 18

4.12.1 Recruitment 18

4.12.2 Water Requirement 19

4.12.3 Electricity Requirement 19

4.12.4 Fuel Requirements 19

4.12.5 Vehicle Requirements 19

4.13 Waste Generation and Disposal 20

4.13.1 Solid Waste 20

Chapter 02 5 of 4


4.13.2 Wastewater 20

4.13.3 Drill Cutting and Mud Waste 20

4.14 Fire and Emergency Preparedness Plan 21

4.15 Health, Safety and Environmental Management 21

5 PROJECT ALTERNATIVES 1

5.1 Project Alternatives 1

5.1.1 No Project Option 1

5.1.2 Drilling Technologies 1

5.1.3 Drilling Mud System 4

6. ENVIRONEMNTAL AND SOCIAL BASELINE 1

6.1. Physical Environment 1

6.1.1. Geography 1

6.1.2. Topography 2

6.1.3. Geology 3

6.1.4. Climatology and Meteorology 6

6.1.5 Water Resources 12

6.1.6. Air Quality 15

6.1.7. Noise 15

6.2. Vulnerability to Natural Disaster/ Cyclones and Floods 19

6.3. Biological Environment 23

6.3.1 Methodology 23

6.3.2 Ecology of Microenvironment of Project Area 23

6.3.3 Protected Areas 26

6.3.4 Flora 26

6.3.5 Fauna 33

6.4. Socio-Economic Environment 45

6.4.1 Data Collection Strategy 45

6.5. Description of the Project Area 45

6.6. Socio-Cultural Aspects 46

Chapter 02 6 of 4


6.6.1 Demography/Community Structure 47

6.6.2 Ethnicity/Tribes 47

6.6.3 Energy Supplies 47

6.6.4 Infrastructure 47

6.6.5 Transportation & Communication 48

6.7. Community Wellbeing 48

6.7.1 Livelihood 49

6.7.2 Agriculture & Livestock 49

6.7.3 Fishing 49

6.7.4 Other Occupations: 50

6.7.5 Health 50

6.7.6 Education 51

6.7.7 Water 52

6.8. Women Status & Gender Equity 52

6.9. Local Community Institutions 52

6.10. Archeological Sites 53

7. STAKEHOLDER CONSULTATION 1

7.1 Objective of Stakeholder Consultation 1

7.2 Identification of Stakeholders 2

7.3 Classification of Stakeholders 2

7.4 Methodology for Stakeholder Consultation 4

7.5 Consultation with Communities 5

7.5.1 Community Issues and Expectations 7

7.6 Consultation with other Stakeholder 7

7.6.1 Chief Conservator Sindh Forest Department 8

7.6.2 Director Sindh Fisheries Department 8

7.6.3 Conservator Sindh Wildlife Department 9

7.6.4 Sindh Environmental Protection Agency 9

7.6.5 Assistant Commissioner (AC) Sujawal 10

Chapter 02 7 of 4


7.6.6 Municipal Committee Thatta, District Thatta 10

7.6.7 Technical Advisor -WWF Pakistan 11

7.6.8 Health Department 11

7.6.9 Education Department 12

7.6.10 Social Welfare Department 13

7.6.11 Archaeology Department 13

7.6.12 National Rural Support Program 13

7.6.13 Coastal Community Development Department 13

7.6.14 SAFWCO 14

7.6.15 Care Takers of Pir Patho Dargah 14

8 IMPACT PREDICTION, EVALUATION AND MITIGATION MEASURES 1

8.1 Identification of Potential Impacts 1

8.2 Impact Assessment Criteria 2

8.3 Impact Assessment Methodology 2

8.4 Impacts Assessment for Design Phase 6

8.4.1 Project Designing 6

8.5 Impacts Assessment for Seismic and Drilling Phase 6

8.6 Impacts on Physical Environment 7

8.6.1 Topography & Soil 7

8.6.2 Water Resources 10

8.6.3 Ambient Air Quality 13

8.6.4 Noise Pollution and Vibration 15

8.6.5 Waste Generation 16

8.6.6 Vehicular Movement 20

8.7 Impacts on Biological Environment 22

8.7.1 Vegetation 22

8.7.2 Wildlife and Habitats 24

8.8 Socio Economic Impacts 27

8.8.1 Land Acquisition and Compensation 28

Chapter 02 8 of 4


8.8.2 Community Disturbance 28

8.8.3 Restricted Mobility 29

8.8.4 Community Grievances/Complaints 29

8.8.5 Archeological, Cultural and Religious Sites 30

8.8.6 Community Safety 30

8.8.7 Safety of Workers 31

8.8.8 Emergencies and Accidents 31

8.8.9 Employment 32

8.8.10 Local Economy 32

9 ENVIRONMENTAL MANAGEMENT PLAN 1

9.1 Introduction 1

9.2 Scope of the EMP 1

9.3 Purpose and Objectives of the EMP 1

9.4 Methodology 2

9.5 Components of the EMP 2

9.6 Legislation and Guidelines 3

9.7 Organizational Structure and Responsibilities 3

9.7.1 Project Proponent 3

9.7.2 Contractors 4

9.7.3 Regulators 4

9.7.4 Independent Monitoring Consultant (IMC) 4

9.8 Implementation Stages of EMP 4

9.8.1 Planning and Design Stage 4

9.8.2 Operational Stage 5

9.9 Change Management Plan 7

9.9.1 Changes to the EMP 8

9.9.2 Changes to the Operation 8

9.10 Waste Management Plan 9

9.11 Environmental Monitoring Plan 9

Chapter 02 9 of 4


9.12 Impacts Mitigation Plan 10

10 CONCLUSION 1

11 REFERENCE 1

ANNEXURES

Annexure I MPCL IMS Policy and Vision Mission Statement

Annexure II Sindh EPA Act 2014

Annexure III Pakistan Environmental Protection Agency (Review of IEE and EIA Regulation 2000)

Annexure IV National Environmental Quality Standard (NEQS)

Annexure V MPCL Waste Management Plan

Annexure VI MPCL Restoration Plan

Annexure VII Socio Economic Matrix

Chapter 02 10 of 4


LIST OF TABLES

Table 1.1. Project Study Team

Table 3.1 Relevant Environmental Laws and their Applicability

Table 4.1 Geological Co-Ordinates of Seismic Lines

Table 4.2: Project Schedule

Table 4.3 Workforce Required for Proposed Seismic & Drilling Activity

Table 4.4 Water Requirements during Project Activities

Table 4.5 Electricity Requirements for Camp & Rig Sites During Operations

Table 4.6 Fuel Requirements during Proposed Activities

Table 4.7 Vehicle Requirements during Proposed Activities

Table 7.1 List of Stakeholders

Table 7.2 List of Consulted Villages

Table 6.1 Soil Analysis Results

Table 6.2 Annual Rainfall Data

Table 6.3 Monthly Minimum Temperature Data

Table 6.4 Monthly Maximum Temperature

Table 6.5 Mean Monthly Wind Speed Data

Table 6.6 Mean Monthly Relative Humidity

Table 6.7 Summary of the Water Analysis Results

Table 6.8 Ambient Air Quality Monitoring Results

Table 6.9 Noise Level Monitoring Results

Chapter 02 11 of 4


Table 6.10 Major Disaster History

Table 6.11 List of Wettest Cyclones/ Depressions in the Coastal Areas of Pakistan

Table 6.12 Cover Area Of Protected/ Reserve Area Of Project Area

Table 6.13 List of Floral Species of Project Area

Table 6.14 The List of Mammal Species

Table 6.15 List of Bird Species

Table 6.16 List of Reptiles

Table 6.17 List of Fish and Shrimps

Table 6.18 List of Heath Facility in Project Area

Table 6.19 List of Education Facility

Table 7.1 List of Stakeholders

Table 7.2 List of Villages Visited for Consultation

Table 8.1 Definitions for Consequence and Likelihood of Impacts

Table 8.2 Impact Significant Matrix

Table 8.3 Impact Assessment Criteria

Table 8.4 Impact Assessment Matrix

Table 9.1 Minimum Distance from Environmental Receptors

Table 9.2 Suggested Environmental Training

Table 9.3 Environmental Monitoring Plan

Table 9.4 Impact Mitigation Plan For Seismic, Construction And Drilling Phase

Chapter 02 12 of 4


LIST OF FIGURES

Figure 1.1 Location Map of Sujawal Block along

Figure 1.2 Proposed Seismic Survey

Figure 4.1 Pakistan Primary Energy Mix

Figure 4.2 Location of Seismic Lines within Sujawal EL Block

Figure 4.3 Shot Hole Drilling Operation

Figure 4.4 A Pictorial View of Geophones and Lying of Cables

Figure 4.5 Vibroseis Truck in Operation

Figure 4.6 Typical Drilling Site Layout (not to scale)

Figure 4.7 Pictorial View of Rotary Drilling Rig

Figure 4.8 Schematic Diagram of Mud Recycling System

Figure 6.1 Graphical Summary of Annual Rainfall Data of Last Six Year

Figure 6.2 Graphical Summary of Mean Annual Minimum & Maximum Temperature.

Figure 6.3 Graphical Summary of Mean Annual Wind Speed.

Figure 6.4 Graphical Summary of Mean Annual Relative Humidity.

Figure 6.5 Environmental Monitoring Location Map

Figure 6.6A to 66 E Forest Maps Provided by Sindh Forest Department

Figure 6.7 Biological Survey Map

Figure 6.8 Social Survey Map

Chapter 01 1 of 7


1. INTRODUCTION

1.1. PREAMBLE

This report presents the findings of an Environmental Impact Assessment (EIA) for the

Exploration Activities in Sujawal (2467-11) located in Sindh Province. The project proponent,

Mari Petroleum Company Limited (hereinafter referred as MPCL) has appointed SGS to

undertake this EIA.

The Mari Petroleum Company Ltd was granted exploration license for the Sujawal Block (EL-

2467-11) Sindh in June 2006 with 100% working interest. In order to carryout Exploration &

Production activities, MPCL conducted EIA study in August 2007 for a proposed area and was

granted NOC/approval from SEPA in November 2007. Subsequently, MPCL carried out Seismic

data acquisition in the year 2008.

MPCL intends to carry out further Exploration activities which include 2D/3D Seismic, drilling

and associated activities in the remaining part of the Block after fulfilling environmental

regulations.

1.2. THE SUJAWAL BLOCK

Sujawal Block lies in the South Western part of Sindh Province covering an area of 2416.43 sq.

km and fall in Sujawal and Thatta districts of Sindh province Pakistan (Figure-1.1).

1.3. PROJECT TITLE

This study is titled as “Environmental Impact Assessment of Exploration Activities in Sujawal

Block-Sindh”.

1.4. PROJECT PROPONENT

Mari Petroleum Company Limited is one of Pakistan’s largest E&P companies operating the

country’s 2nd largest gas reservoir at Mari Field, District Ghotki, Sindh. The Company is

primarily engaged in Exploration, development and Production of hydrocarbon potentials

(Natural gas, Crude oil, Condensate & LPG) in the country. MPCL is also exploring

opportunities of expanding its business to become a player in the International hydrocarbon

market.

Starting with just the production and sale of natural gas from a single field, the Company has

expanded its scope of business over the years. It now offers full spectrum exploration,

production and sale of oil, gas and other petroleum products in various concession areas, a feat

which required a change of name reflecting the extended scope of business.

Mari Gas Company Limited was incorporated in mid 80's by Fauji Foundation, Govt. of

Pakistan and Oil & Gas Development Corporation (now Oil & Gas Development Company

Limited) to take over the assets, liabilities and operation of Fauji Foundation (Mari Gas) and

Chapter 01 2 of 7


Pak Stanvac Petroleum Project. The Company commenced business in its own name in

December 1984.

The Company was renamed Mari Petroleum Company Limited in November 2012. At present,

in addition to Mari Gas Field, MPCL operates nine exploration blocks (Ziarat, Hanna, Harnai,

Sukkur, Sujawal, Karak, Ghauri, Peshawar East and Khetwaro) and one D&P Lease (Zarghun

South). The Company is also a non-operating joint venture partner in six exploration blocks

(Kohlu, Kalchas, Kohat, Bannu West, Zindan and Hala). Moreover, the Company is also joint

venture partner in block 43B with 25% working interest in Oman with MOL.

Mari Petroleum Company Limited (MPCL) has made a gas/ condensate discovery at Sujawal X-

1 in the Sujawal Block located in Sindh Province. This success of the Sujawal X-1 is an addition

to the indigenous reserve base of the nation, which would ultimately result in saving of foreign

exchange. The first exploratory well in the block was spud-in on February 6, 2010 and was

drilled down to a depth of 3,000 meters in Lower Goru Formation of Cretaceous age. MPCL

IMS policy and vision mission statement given in Annexure 1.

Success Ratio of MPCL as Compared to Other E&P Companies

Name of Company No. of Exploratory

Wells Drilled

No. of

Discoveries Success Ratio (%)

MPCL 13 9 1: 1.44 (69.23%)

*Other E&P

Companies 757 228 1: 3.3 (30.1%)

*Source: Pakistan Energy Yearbook 2010 (Ministry of P & NR - HDIP)

1.5. PROJECT OVERVIEW

MPCL is planning to perform further exploration work in Sujawal block which includes both

seismic (2D/3D) and drilling activities (hereinafter referred as exploration activities). The Block

lies in Thatta & Sujawal districts of Sindh having a total area of about 2416.43 km2 whereas

reserves forest area of the block comprises of about approximately 570.23 km2. MPCL is

planning to acquire 2D seismic data in approximately 320L. Km and about 900 Sq. for 3D

followed by drilling of a deep well.

The EIA report covers approximately 320 Line Km (L. Km) of 2D and about 900 Sq. Km 3D

seismic operation and a drilling of deep well in Eastern part of the block. Location and vicinity

map of Sujawal block along with district boundaries is attached as Figure 1.1 while Figure 1.2

shows proposed seismic activities to be undertaken.

1.6. ENVIRONMENTAL CONSULTANT

MPCL has appointed SGS to carry out the Environmental Impact Assessment (EIA) study of the

proposed project activities in order to assess the environmental aspects of the project. SGS put

Chapter 01 3 of 7


together a team of consultants to complete the EIA project. The EIA project team comprises of

Ecologist, Environmentalist, Wildlife Expert, Environmental Chemist, Sociologist and Impact

Assessment Experts having diversified experience on local and international assignments. The

project team involved in this study are presented in Table 1.1.

Table 1.1: EIA Study Team

S. No. Name Responsibility in EIA Team

1. Ms. Tasneem Ilyas Project Director

2. Mr. Syed Faseeh Project Manager

3. Mr. Rafi ul Haq Lead Consultant-Senior Ecologist

4. Mr. Athar Khan Project Coordinator

5. Mr. Abdul Rehman Technical Report Writer

6. Dr. Ali Ghalib Wildlife Expert

7. Miss Fiza Qureshi Sociologist

8. Mr. Mumtaz Hassan Water Pollution Expert

9. Mr. Fahad Saleem Subject Expert/Technical Report Writer

10. Mr. Aamir Aziz Environmentalist/Technical Report Writer

11. Mr. Sajid Nazir Field Monitoring Team Leader

1.7. EIA REQUIREMENT

Sujawal block encompass number of wildlife protected areas including Mirpursakro (Game

Reserve), Cut Munarki Wildlife Sanctuary, Bijora Chach Wildlife Sanctuary, Gullel Kohri

Wildlife Sanctuary, Munarki Wildlife Sanctuary and Sadnani Wildlife Sanctuary and most of

the protected areas are located along Indus River including Reserve forests.

The EIA has been prepared to conform to the requirements of the Sindh Environmental

Protection Act 2014 (SEPA), the Pakistan Environmental Protection Agency (Review of IEE ad

EIA) Regulations, 2000 and the guidelines provided in the Pakistan Environmental Assessment

Procedures, 1997.

Section-17 of SEPA 2014 states that:

"No proponent of a project shall commence construction or operation unless he has filed with

the Agency an initial Environmental Examination or Environmental impact Assessment, and

has obtained from the agency approval in this respect thereof.

1.8. PROJECT CATEGORIZATION

The Pakistan Environmental Protection Agency (Review of EIA/IEE) Regulations 2000 evidently

define the categories of projects requiring an Initial Environmental Examination (IEE) or

Environmental Impact Assessment (EIA) in Schedules I & II respectively. As per IEE / EIA

Chapter 01 4 of 7


Regulations, 2000, all projects located in environmentally sensitive or critical areas- including

Wildlife Sanctuaries, National Parks or Game Reserves- require an EIA.

Therefore an EIA study has been conducted for proposed project activities and the report will

be submitted to Sindh EPA for review and approval.

1.9. ORGANIZATION OF THE REPORT

This report has been structured in the following manner:

Executive Summary provides a synopsis of the EIA study.

Chapter 1 (Introduction) gives an overview of the project.

Chapter 2 (EIA Process and Methodology) gives an overview of the EIA process and

methodology.

Chapter 3 (Legal Framework) gives an overview of applicable national policies, and legislations

with international guidelines relevant to EIA of proposed project.

Chapter 4 (Project Description) provides the description of the proposed project, its layout plan

and associated activities, raw material details and utility requirement and project alternatives.

Chapter 5 (Project Alternatives) provides a discussion of the different alternatives considered

for the project.

Chapter 6 (Description of Baseline Environment) provides a description of the micro-

environment and macro-environment of the proposed project site. This chapter describes the

physical, ecological and socioeconomic resources of project area and surroundings.

Chapter 7 (Stakeholder Consultation) provide the details of stakeholder consultation

methodology and its findings.

Chapter 8 (Impact Assessment and Mitigation Measures) describes the potential

environmental and social impacts of proposed project on the different features of the micro and

macro-environment.

Chapter 9 (Environmental Management Plan) explains the mitigation measures proposed for

the project in order to minimize the impacts to acceptable limits. It also describes

implementation of mitigation measures on ground and monitoring of environmental

parameters against likely environmental impacts.

Chapter 10 (Conclusion) presents conclusion of EIA study.

Chapter 11 (References) provides references for the secondary data source.

The last Chapter is followed by series of Annexes that provide supporting information.

Chapter 01 5 of 7


1.10. CONTACT DETAILS

Client Consultant

Mari Petroleum Company Limited SGS Pakistan (Private) Limited.

Mr. Syed Faseeh

Manager-Operation & Business Development

21, Mauve Area, 3rd Road, G-10/4, H-3/3, Sector 5, Korangi Industrial Area

Islamabad, Pakistan Karachi, Pakistan.

Tel: +92 51-111-410-410 Tel: +92-21-35121388-95

Fax: +92 51-2352859 Fax: +92-21-35121329

Chapter 01 6 of 7


Figure 1.1: Location Map of Sujawal Block

Chapter 01 7 of 7


Figure 1.2: Proposed Seismic Survey Location

Chapter 02 1 of 4


2. SCOPE AND METHODOLOGY

2.1. EIA PROCESS

2.1.1 OVERVIEW OF EIA

EIA is a systematic process to identify, predict and evaluate the environmental impacts of

proposed actions and projects. This study suggests mitigation measures with practical approach

of implementation of these measures in the form Environmental Management Plan (EMP). The

process is applied prior to major decisions and commitments being made. Wherever

appropriate, environmental, social and safety impacts are also considered as an integral part of

EIA. Particular attention is given to practical implementation of EIA to prevent and mitigate

significant adverse effects of proposed undertakings.

2.1.2 OBJECTIVE OF EIA

The overall objective of this EIA study includes:

• To explicate the anticipated impacts of proposed intervention;

• Identification of potential environmental impacts;

• Screening of potential impacts to identify significant environmental impacts;

• Evaluation of significant environmental impacts;

• To find out environmentally viable project alternatives;

• To propose appropriate mitigation measures. Discussing appropriate mitigating methods;

2.1.3 SCOPE OF EIA

The scope of EIA is to examine the impacts that will possibly arise from the proposed

exploration activities which include seismic survey and drilling of deep well. This EIA covers

only this segment of the exploration programme and any further activities planned by MPCL

would be the question of separate EIA. This comprehensive EIA study would be carried out in

accordance with the requirements mentioned in the EPA Guidelines and includes:

• Assessment of physical, biological and socio-economic impacts of different stages of

proposed project activities.

• Contemplation of adverse environmental and socio-economic impacts, if any and

suggesting adequate mitigation measures.

• Development of Environmental Management Plan (EMP) which will provide practical

approach in order to manage adverse environmental and socioeconomic impacts, if any.

Chapter 02 2 of 4


2.2. EIA METHODOLOGY

The EIA project undergoes a series of stages prior to report preparation. The process and

approach followed for the proposed project is defined in the subsequence:

2.2.1 UNDERSTANDING OF THE PROPOSED PROJECT

This step requires collection of information from the proponent on the proposed project,

understanding of the project flow and identification of potential impacts associated with the

proposed activities. A sufficient amount of information regarding the proposed project and its

related activities was collected from MPCL.

2.2.2 LEGISLATIVE REVIEW

SGS team carried out the legislative review of applicable laws, regulations, guidelines and

standards which includes national legislation, international agreements, and environmental

guidelines. In addition, best industry practices were recommended consistent with the

environmental standards that the proponent will require to adhere to, during the different

stages of project.

2.2.3 SECONDARY RESOURCES/ BASELINE REVIEW

Environmental impacts are measured through changes in environment, resulting from a

designated action or activity. In order to identify such changes, it is essential to have as

complete understanding of the nature of existing environment, prior to its interaction with the

proposed activity. This translates into the need to characterize the existing baseline

environmental condition, including establishing prevailing conditions for a range of

environmental media, notably air, water, soil and groundwater, flora and fauna and the human

environment.

This was achieved through a detailed review of available secondary literature, the undertaking

of project specific baseline studies and surveys on physical, biological and socio-economic

environment of the project area. All data sources were reviewed to collect information relevant

to the physical, biological and socio-economic environment within the project area.

2.2.4 SCOPING SESSIONS

Scoping is a vital early step, which identifies the issues that are likely to be important during the

environmental assessment, and eliminates those that are not. Scoping is a process of interaction

between the interested public, government agencies and the proponent. Scoping refers to the

process of identifying the appropriate boundaries of the environmental assessment, the

important issues and concerns, the information necessary for decision making and the

significant impacts and factors to be considered. For scoping process, stakeholders were

carefully selected. The stakeholders included regulators, government representatives and

prominent Non Government Organizations (NGOs).

Chapter 02 3 of 4


Meetings were held with the officials of Sindh EPA, Sindh Wildlife Department, Sindh Forest

Department, Sindh Fisheries Department, Archaeological Department, Assistant Commissioner

and Municipal officers, NGOs: WWF Pakistan, National Rural Support Program (NRSP), to

obtain a better understanding of the project area and its relevant features. All these

organizations provided assistance to the SGS team while conducting this EIA.

2.2.5 APPROVAL FOR FIELD VISIT

SGS team met with Chief Conservator Forest, Sindh Forest Department (SFD) and Conservator

Wildlife, Sindh Wildlife Department (SWD) Conservator Forest Department to obtain a better

understanding of the project area and its relevant features, as mentioned above. In addition,

SGS team obtained formal approval from these departments for baseline data collection within

riverine forest areas and wildlife protected areas. SGS team also requested for their

representatives to accompany SGS team during field visit.

2.2.6 SITE VISIT AND PRIMARY DATA COLLECTION

SGS team visited the project area and its vicinity from October 17 to 22, 2014 to conduct baseline

environmental survey. The team comprised of, ecologist, wildlife expert, environmental experts

and sociologist. During the site visit, primary information on the physical, biological and socio-

economic background conditions of the project area were collected. In addition, discussions

were held with the members of the community resident in the area to collect area-specific

primary information along with their views and concerns regarding the project and its

activities.

2.2.7 EVALUATION OF ALTERNATIVES

To ascertain an environmentally sound preferred option for achieving the objectives of the

proposed project, alternatives were studied in collaboration with the project proponent. All

alternatives which include no project option, alternative site, timing, and alternative

technologies were reviewed and discussed to establish the environmental soundness of the

operations. Technology selection was accomplished by considering options which were

environmentally, economically and socially suitable. A detail of alternatives has been provided

in section 7 of the report.

2.2.8 IDENTIFICATION, SCREENING AND ASSESSMENT OF IMPACTS

The information collected in the previous phases was used to assess and identify the major

issues of environmental concerns and indicate their relative importance to the design of the

project. Potential impacts arising from each phase of the proposed seismic, construction and

drilling activities were identified. The issues studied during impact assessment include

potential impacts on:

• Physical environment of the area

• Biological environment of the area

Chapter 02 4 of 4


• Socio-economic environment of the area

Screening and assessment of anticipated impacts, and those that are cumulative, unavoidable or

irreversible were also carried out. Impacts were identified particularly in the wildlife reserve

and assessed on the basis of field data collected from project area, secondary data and expert’s

opinion on the same.

2.2.9 IMPACTS ASSESSMENT AND MITIGATION MEASURES

One of the main tasks of impact assessment is to predict unacceptable adverse effects and their

prevention through the implementation of appropriate project modifications, also known as

mitigation measures. Mitigation measures are helpful to prevent or minimize all potential

adverse environmental impacts of proposed intervention.

Impacts are identified keeping in view the baseline condition of the project area and any change

due to proposed operations on the baseline environmental condition. Considering identified

impacts, appropriate and practicable mitigation measures have been recommended to

eliminate, minimize or compensate for the potential environmental and social impacts on the

project zone of influence.

2.2.10 ENVIRONMENTAL MANAGEMENT PLAN

Environmental Management Plan (EMP) has been developed in order to assist and enable

MPCL for effective management and implementation of mitigation measures. EMP will guide

them throughout the project lifecycle how to maintain environmental and social conditions and

implement occupational safety measures. This plan also delineates the information required to

manage environmental and occupational safety risks arising from proposed project activities as

well as social issues.

EMP will also include environmental monitoring plans in order to comply with local legislative

requirements.

2.2.11 REPORTING/DOCUMENTATION

The EIA report has been prepared under the guidelines issued by the Sindh Environmental

Protection Agency (SEPA) Act 2014 and submitted to SEPA. The organization of the report is

described in the preceding chapter.

Chapter 03 1 of 16


3. LEGAL FRAMEWORK

This chapter provides an overview of the environmental policies, legislation, and guidelines

that may have relevance to the proposed project. These include national environmental policy,

legislation and guidelines; and international conventions and guidelines. MPCL will be

required to adhere to the relevant requirements of the policies and legislation during the

construction and operation of the proposed activities; which has also been incorporated in the

mitigation measures and the EMP provided in the EIA.

3.1 CONSTITUTIONAL PROVISION

According to the Constitution of Pakistan, the legislative powers lie with the federal parliament

and the legislative assemblies of the four provinces of Pakistan. The Fourth Schedule of the

constitution provides two lists of issues. One list, the Federal Legislative List, includes issues on

which only the federal government has legislative powers. The second list, the Concurrent

Legislative List includes issues on which both the federal and the provincial governments have

legislative powers. If a particular legislation passed by a provincial assembly comes into conflict

with a law enacted by the national assembly, then according to the constitution, the federal

legislation will prevail over the provincial legislation to the extent of the inconsistency. The

subject of ‘environmental pollution and ecology’ is included in the concurrent list of the

constitution. Thus, allowing both the federal and provincial governments to enact laws on the

subject. To date, only the federal government has enacted laws on environment, and the

provincial environmental institutions derive their power from federal law. Article 9 of the

constitution defines the right to life as a fundamental right in these words “No person shall be

deprived of life or liberty save in accordance with law”.

3.2 FRAMEWORK OF ENVIRONMENT AND WILDLIFE INSTITUTION

IN PAKISTAN

The Federal Ministry of Environment was the main government organization responsible for

the protection of environment and resource conservation. It was headed by a federal minister.

The Ministry worked with PEPC, and the Federal and Provincial EPAs formed under the PEPA

1997. The roles, responsibilities and authorities of PEPC and the EPA’s have been defined in the

PEPA 1997. However, after 18th constitutional amendment, the said ministry has been

devolved into provinces and Pakistan Environmental Protection Agency is working under the

umbrella of Climate Change Division.

Now, Pakistan Environmental Protection Agency is an attached department of the Climate

Change Division and responsible to implement the Pakistan Environmental Protection Act 1997,

in the country, an Act to provide for the protection, conservation, rehabilitation and

improvement of environment, for the prevention and control of pollution, and promotion of

Chapter 03 2 of 16


sustainable development. Pakistan Environmental Protection Agency also provides all kind of

technical assistance to the Climate Change Division.

The National Council for Conservation of Wildlife (NCCW) is responsible for formulation of

national wildlife policies, co-ordination with provincial wildlife department on the

implementation of these policies and co-ordination with international organisations on matters

related to international treaties/conventions. The NCCW works under the Ministry of Climate

Change and is headed by the Inspector General Forests. NCCW comprises of an advisory

council, which is chaired by the Minister of Climate Change and includes representatives from

all Provinces, AJK and Northern Areas, NGOs, members of civil society and other federal

ministries. A small NCCW secretariat is based in Islamabad handles the day-to-day affairs and

the implementation of policies and recommendations of the advisory council. At provincial

level almost each province has a wildlife department and a wildlife protection act.

3.3 NATIONAL ENVIRONMENTAL POLICIES

3.3.1 NATIONAL ENVIRONMENTAL POLICY, 2005

The National Environmental Policy (NEP) was approved by the Pakistan Environmental

Protection Council (PEPC) in its 10th meeting on 27th December, 2004 under the chairmanship

of the Prime Minister of Pakistan and thereafter approved by the Cabinet on 29th June 2005.

NEP is the primary policy of Government of Pakistan that addresses the environmental issues

of the country. The broad Goal of NEP is, “To protect, conserve and restore Pakistan’s

environment in order to improve the quality of life of the citizens through sustainable

development”. The NEP identifies the following set of sectoral and cross-sectoral guidelines to

achieve its Goal of sustainable development.

Sectoral Guidelines:

Water and sanitation, Air quality and noise, Waste management, Forestry, Biodiversity and

Protected areas, Climate change and Ozone depletion, Energy efficiency and renewable,

agriculture and livestock, and Multilateral environmental agreements.

Cross Sectoral Guidelines:

The NEP suggests the following policy instruments to overcome the environmental problems

throughout the country:

• Integration of environment into development planning,

• Legislation and regulatory framework,

• Capacity development,

• Economic and market based instrument,

• Public awareness and education, and

• Public private civil society partnership.

Chapter 03 3 of 16


3.3.2 NATIONAL CONSERVATION STRATEGY

Before the approval of National Environmental Policy (NEP) the National Conservation

Strategy (NCS) was considered as the Government’s primary policy document on national

environmental issues. The Strategy approved by the Federal Cabinet in March 1992 and was

also recognized by International Financial Institutions, principally the World Bank At the

moment this strategy just exists as a national conservation program. The NCS identifies 14 core

areas including conservation of biodiversity; pollution prevention and abatement; soil and

water conservation; and preservation of cultural heritage, and recommends immediate

attention to these core areas in order to preserve the country’s environment.

NCS does not directly apply to projects. However, MPCL should ensure that the project should

not add to the aggravation of the 14 core environmental issues identified in the NCS and

mitigation measures should be adopted to minimise or avoid any contribution of the project in

these areas.

3.3.3 NATIONAL ENVIRONMENTAL ACTION PLAN-SUPPORT PROGRAMME

(NEAP-SP)

The Government of Pakistan and United Nations Development Programme (UNDP) have

jointly initiated an umbrella support programme called the “National Environmental Action

Plan-Support Programme (NEAP-SP)” signed in October 2001 and implemented in 2002. The

development objective supported by NEAP-SP is environmental sustainability and poverty

reduction in the context of economic growth.

3.3.4 POLICY & PROCEDURES FOR THE FILING, REVIEW AND APPROVAL OF

ENVIRONMENTAL ASSESSMENTS

The Policy & Procedures for the Filing, Review and Approval of Environmental Assessments,

prepared by the PEPA under the powers conferred upon it by the Pakistan Environmental

Protection Act, provide the necessary details on the preparation, submission, and review of the

Initial Environmental Examination (IEE) and the Environmental Impact Assessment (EIA). It

provides schedules of proposals that require either an Initial Environmental Examination (IEE)

or an Environmental Impact Assessment (EIA).

3.3.5 PETROLEUM EXPLORATION & PRODUCTION POLICY 2012

Government of Pakistan introduced the first petroleum Policy document in 1991.This was then

followed by new Petroleum Policies of 1993, 1994, 1997, 2001, 2007 and 2009.

Policy 2009 had to be amended by new Petroleum Policy 2012 as the new market conditions

warranted urgent changes required for investment promotion in view of increasing

international energy prices. It also reflects the resolve of Government of Pakistan to accelerate

exploitation of indigenous natural resources by attracting foreign investment with technology

as well as promoting local companies to participate in E&P activities on a level playing field.

Chapter 03 4 of 16


The purpose of Petroleum Exploration and Production Policy 2012 is to establish the policies,

procedures, tax and pricing regime in respect of petroleum exploration and production (E&P)

sector.

The Petroleum Exploration & Production Policy 2012 maintains a system based upon the two

different types of agreements to obtain E&P rights in Pakistan:

• For onshore operations, a system based upon a Petroleum Concession Agreement (PCA).

• For offshore operations, a system based upon a Production Sharing Agreement (PSA).

This Policy has incorporated the significant achievements of the Pakistani petroleum industry

with established good international oilfield practices.

3.4 NATIONAL ENVIRONMENTAL LEGISLATION

The legislative assembly of Sindh province of Pakistan passed the bill on 24th February 2014 to

enact Sindh Environmental Protection Act 2014. The Act envisages protection, improvement,

conservation and rehabilitation of environment of Sindh with the help of legal action against

polluters and green awakening of communities.

The definition of environmental law can be derived from the legal definition of ‘environment’.

In Section 2(xii) of the Sindh Environmental Protection Act 2014 (SEPA) environment is defined

to include air, water, land and layers of the atmosphere; living organisms and inorganic matter;

the ecosystem and ecological relationships; buildings, structures, roads, facilities and works;

social and economic conditions affecting community life; and the interrelationship between

these elements. From this definition, an environmental law can be considered to include all laws

that are designed to, or that directly or indirectly affect, the management of natural resources

including the control of pollution of these natural resources.

By this definition, environmental laws include a) laws that have been specifically enacted to

protect the environment such as the SEPA 2014, and b) laws relating to subject such as forest,

water resources, wildlife, land, agriculture, health, and town planning. Table 3.1 shows key

environment, health and safety related legislative powers of federal and provincial government,

enforcing agencies and pertinent laws.

Table 3.1: Relevant Environmental Laws and their Applicability

Subject Legislative

Power Enforcing Agencies Pertinent Laws

Environmental

Pollution and

Ecology

Federal and

Provincial

Ministry of Climate

Change,

Pakistan

Environmental

Protection Agency,

Sindh

Sindh Environnemental

Protection Act, 2014

National Environnemental

Quality Standards (NEQS),

National Environnemental

Quality Standards (NEQS),

Environmental Laboratories

Chapter 03 5 of 16


Environmental

Protection Agency,

2000,

NEQS (Self-Monitoring and

Reporting by Industry) Rules

2005 (Amended)

Regulation of

Labour and

Safety in Mines,

Factories and Oil

Fields

Federal and

Provincial

Chief Inspector of

Mines

Chief Inspector of

Industries

Mines Act, 1923

Factories Act, 1934

Sindh Factories Rules, 1978

Hazardous Occupation

Rules 1963

Ancient and historical

Monuments and

Archaeological Sites

Federal and

Provincial

Department of

Museum

Antiquities Act, 1975

Sindh Cultural Heritage

(Preservation) Act, 1994

Wildlife Federal and

Provincial

Sindh Wildlife

Department Sindh

Wildlife Protection

Ordinance 1972

Forestry Federal and

Provincial

Sindh Forest

Department Forest Act, 1927

3.4.1 SINDH ENVIRONMENTAL PROTECTION ACT 2014

The Sindh Environmental Protection Act, 2014 (SEPA) is the basic legislative tool empowering

the provincial government to frame regulations for the protection, conservation, rehabilitation

and improvement of the environment. The SEPA is broadly applicable to air, water, soil,

hazardous waste, marine and noise pollution. Penalties have been prescribed for those

contravening the provisions of the Act. The powers of the provincial Environmental Protection

Agencies (EPAs) were also considerably enhanced under this legislation and they have been

given the power to conduct inquiries into possible breaches of environmental law either of their

own accord, or upon the registration of a complaint. Sindh Environmental Protection Act, 2014

(SEPA) attached as Annexure 1I.

It equally lays emphasis for the preservation of the natural resources of Sindh and to adopt

ways and means for restoring the balance in its eco-system by avoiding all types of

environmental hazards.

Under section 17 of SEPA, ‘’no proponent of a project shall commence construction or operation

unless he has filed with the Agency an initial environmental examination or environmental

impact assessment and has obtained from Agency approval in respect thereof. ‘’

SEPA shall review the IEE & EIA and accord approval subject to such terms and conditions as it

may prescribe or require. The agency shall communicate within four (04) months it approval or

otherwise from the date EIA is filed failing which the EIA shall deemed to have been approved.

Chapter 03 6 of 16


3.4.2 PAKISTAN ENVIRONMENTAL PROTECTION AGENCY REVIEW OF IEE

AND EIA REGULATIONS, 2000

The Pakistan Environmental Protection Agency Review of IEE and EIA Regulations, 2000 (the

‘Regulations’), prepared by the Pak-EPA under the powers conferred upon it by the PEPA,

provide the necessary details on the preparation, submission, and review of the initial

Environmental Examination (IEE) and the Environmental Impact Assessment (EIA).

The Regulation classifies projects on the basis of expected degree of adverse environmental

impacts and lists them in two separate schedules. The Regulations also require that all projects

located in environmentally sensitive areas require preparation of an EIA. As the proposed

project activities will be carried out in protected area i.e. Riverine forest, Game reserves,

wetlands and Ramsar site, an EIA study is therefore required. Pakistan Environmental

Protection Agency Review of IEE and EIA Regulations, 2000 is attached as Annexure III.

3.4.3 THE NATIONAL ENVIRONMENTAL QUALITY STANDARDS (NEQS)

The NEQS promulgated under the PEPA 1997 specify standards for industrial and municipal

effluents, gaseous emissions, vehicular emissions, and noise levels. The PEPA 1997 empowers

the EPA’s to impose pollution charges in case of non-compliance to the NEQS.

During the construction and post development phase of the project, NEQS will apply to all type

of effluents and emissions. NEQS for municipal and industrial effluents, motor vehicle exhaust

and noise and selected gaseous pollutants from industrial source are provided in Annexure IV.

3.4.4 SELF-MONITORING & REPORTING RULES

Pakistan Environmental Protection Council constituted an Environmental Standards Committee

in 1996 to devise realistic modalities for NEQS enforcement and simplified monitoring

procedures with the consultation of representatives of industrial interest groups, non-

governmental organizations (NGOs) and other stakeholders. Their efforts succeeded in the

bringing up of “Self-Monitoring and Reporting System for Industry”. As per the rules set by

this system, industries have to monitor effluents and emissions in compliance with the NEQS

and report it to provincial or federal EPAs. This system classifies industry into three categories

A, B and C each corresponding to a specified reporting frequency. Proposed power plant

project lies under Category A for both liquid effluent and gaseous emissions and thus reporting

frequency to SEPA required every month.

3.5 THE FOREST ACT 1927

This act is applicable to all regions of Pakistan. It includes procedures for constituting and

managing various types of forests, such as reserved forests and protected forests. The act

empowers the provincial forest departments to declare any forest area as reserved or protected.

The act empowers the provincial forest departments to prohibit the clearing of forests for

cultivation, grazing, hunting, removing forest produce; quarrying and felling, lopping and

Chapter 03 7 of 16


topping of trees, branches in reserved and protected forests. It also defines the duties of forest

related public servants, and penalties for any infringement of the rules.

Sujawal block also encompass reserved forest, which has been declared as protected forest

under this act, therefore the project will implement with any provisions of this Act. Sindh Forest

Department has been informed about development activities and ensure that all activities will

be implemented such that impacts on mangrove shall be minimized, conservation practices

shall be adopted and appropriate mitigation measures, to mitigate the impacts on mangrove

forest, have been suggested in the EIA report.

3.6 SINDH WILDLIFE PROTECTION ORDINANCE, 1972 (SWPO) AND

AMENDMENTS 2001

This ordinance provides for the preservation, protection, and conservation of wildlife by the

formation and management of protected areas and prohibition of hunting of wildlife species

declared protected under the ordinance.

The ordinance also specifies three broad classifications of the protected areas: national parks,

wildlife sanctuaries and game reserves. Activities such as hunting and breaking of land for

mining are prohibited in national parks, as are removing vegetation or polluting water flowing

through the park. Wildlife sanctuaries are areas that have been set-aside as undisturbed

breeding grounds and cultivation and grazing is prohibited in the demarcated areas. Nobody is

allowed to reside in a wildlife sanctuary and entrance for the general public is by special

dispensation. However, these restrictions may be relaxed for scientific purposes or for

betterment of the respective area on the discretion of the governing authority in exceptional

circumstances. Game reserves are designated as areas where hunting or shooting is not allowed

except under special permits.

Two amendments to the Ordinance were issued in January and June 2001 respectively

pertaining to oil and gas activities within national parks and wildlife sanctuaries. The first

amendment allowed the Government to authorize the laying of an underground pipeline

through protected areas. The second amendment allowed exploration and production activities

within national parks and wildlife sanctuaries for which an EIA study have to be prepared by

the proponent and approved by the concerned regulatory departments in accordance with the

SEPA 2014.

3.7 SINDH FISHERIES ORDINANCE, 1980

This Ordinance regulates fishing operations, and applies to inland fisheries in public waters as

well as to territorial waters. Fishing is defined broadly in section 2(d) as the “taking or catching

of fish by any means” while public waters are defined in section 2(r) to include “any waters

other than the private waters and includes territorial waters”. The law applies to “all kinds of

fish” including “molluses, crustaces and kelp-fish”.

Chapter 03 8 of 16


The provincial government has the power to issue leases or fishing licences in any public waters

(section 3(1)). Leaseholders may in turn issue permits for fishing in leased waters (section 3(2)).

The government regulates various aspects of commercial fishing including the size of mesh that

may be employed, the type of fishing equipment that may be used, and processing and

marketing operations (sections 9, 10, 11 and 27). The Ordinance allows the government to

declare “any public waters” to be a sanctuary and to prohibit the killing, capturing or taking of

fish from such waters for a specified period without a “special” permit.

Certain provision of the Ordinance nevertheless serves to protect fish species in general, along

with aquatic environments. Under section 7, for example, the use of explosives, poisons and

“noxious” materials for the purpose of “catching or destroying fish and other aquatic life” is

prohibited in “any waters”. Similarly, section 8 prohibits the discharge of untreated sewage,

“effluence” and factory waste into “any waters”; all such waste must be treated so that it is

“harmless for fish and other aquatic life”. According to the ordinance any discharge of waste

into the water bodies shall not only be prohibited but the offender shall also be punished with

imprisonment for a term which may extend to six months or a fine which may extend to ten

thousand rupees or with both.

The government may appoint fisheries inspectors (section 13) who are empowered to arrest

suspected offenders, seize equipment and fish involved in a suspected offence (section 16),

“compound” offences” (section 26), and call for police assistance (section 18).

The ordinance is relevance to the EIA due to the presence of fish fauna in several water bodies

located within the project area including Indus River and associated water bodies (Dhand) In

this connection, Sindh Fisheries Department has been informed that all project activities near

and/or within water bodies will have to be implemented such that no physical damage to the

habitat or permanent alteration in water quality occurs.

3.8 PETROLEUM ACT 1934

This act regulates the import, transport, storage, production, refining and blending of

petroleum and other flammable substances. The federal government issues licenses and may

make rules to regulate the import, transport and distribution of petroleum (Section 4). The law

requires that all containers carrying “dangerous petroleum” (highly flammable) bear a warning

(Section6). The act also contains provisions regarding the testing and quality control of

petroleum products (Section 14ff.). All powers remain with the federal government.

3.9 THE MINES ACT 1923

This act, which is largely administrative in nature, regulates mining operations and mine

management, and contains provisions regarding the health, safety and working conditions of

mine labour. The power to make rules lies with the “appropriate government” (Section 29),

defined as the federal government in the case of mines extracting radioactive material, oil, gas

and flammable substances, and the provincial government for all other mines.

Chapter 03 9 of 16


3.10 REGULATION OF MINES AND OIL FIELDS AND MINERAL

DEVELOPMENT (GOVERNMENT CONTROL) ACT, 1948

This act regulates the development of mines, oilfields and mineral deposits. The federal

government makes rules related to the development of mines and nuclear substances, oilfields

and gas fields, while provincial governments make rules related to other minerals and their

extraction. This Act provides for enforcement of rules related to the storage and distribution of

"mineral oils", the establishment of prices at which mineral oils may be bought or sold and any

matter ancillary and incidental to the objectives set out in the act.

3.11 EXPLORATION AND PRODUCTION RULES, 1986

The 1986 Exploration and Production Rules address environmental concerns, and require

operators to “prevent pollution, avoid accumulation of trash and prevent damage to the

environment and surroundings.”

3.12 THE OIL AND GAS (SAFETY IN DRILLING AND PRODUCTION)

REGULATIONS, 1974

These regulations outline safety in exploration and production of oil and gas companies

operating in Pakistan. Some of the safety protocols under these regulations include:

• Appointment of a Welfare and Safety Officer in all drilling operations employing more

than 250 workers;

• Safety requirements of workplaces and drilling equipment;

• Fire precautions and fire fighting equipment; personal protective equipment (including

breathing apparatus and safety belts).

3.13 ANTIQUITIES ACT 1975 AND THE SINDH CULTURAL HERITAGE

(PRESERVATION) ACT, 1994

The protection of cultural resources in Pakistan is ensured by the Antiquities Act of 1975.

Antiquities have been defined in the Act as ancient products of human activity, historical sites,

or sites of anthropological or cultural interest, national monuments etc. The act is designed to

protect antiquities from destruction, theft, negligence, unlawful excavation, trade and export.

The law prohibits new construction in the proximity of a protected antiquity and empowers the

Government of Pakistan to prohibit excavation in any area, which may contain articles of

archaeological significance.

The Sindh Cultural Heritage (Preservation) Act, 1994 is the provincial law for the protection of

cultural heritage. Its objectives are similar to those of the Antiquity Act, 1975.

The project area for the EIA contains no notified archaeological site as protected under this act.

Furthermore, the project site is unlikely to contain any buried antiquity. However, the project

staff will be instructed before ground preparation and earthworks to report any archaeological

Chapter 03 10 of 16


artifact or what may appear to be an archaeological relic to the project management. In case of

such a discovery, appropriate action will be taken.

3.14 LAND ACQUISITION ACT, 1894

The Land Acquisition act (LAA) of 1894 amended from time to time has been the policy

governing land acquisition, resettlement and compensation in the country. The LAA is the most

commonly used law for acquisition of land and other properties for development projects. It

comprises of 55 sections pertaining to area notifications and surveys, acquisition, compensation

and appointment awards and disputes resolution, penalties and exemptions. In the proposed

project there is no such kind of land acquisition or resettlement of proposed project affected

persons.

3.15 PAKISTAN PENAL CODE (1860)

The Pakistan Penal Code (1860) authorizes fines, imprisonment or both for voluntary

corruption or fouling of public spring or reservoirs so as to make them less fit for ordinary use.

The Pakistan Penal Code (PPC) 1860 deals specifically with the pollution of water in Chapter

XIV on public health and safety. Here, “fouling” or “corrupting” the water of a public spring or

reservoir is listed as an offence, punishable with up to three months in prison and/or a fine of

500 rupees (Section 277). This provision is limited in scope, since it applies only to reservoirs

and public springs, and the terms “fouling” and “corrupting” are not defined. But provisions of

PEPA 1997 (Sections 6 and 7) and the NEQS (Appendix I) may be applied to facilitate

enforcement of Section 277. Other sections of this chapter may be interpreted to include the

protection of water resources, including Section 268 on public nuisance, Section 269 on

negligence likely to spread infectious disease, and Section 284 on negligent conduct with respect

to the possession and handling of poisonous substances.

Similarly, Chapter XVII on offences against property contains certain provisions that may be

interpreted to include the protection of water resources. Sections 425–440 deal with “mischief”,

defined as damage to property resulting in destruction or loss of utility. Section 430 provides

specifically for mischief caused to irrigation works, while Section 431 deals with damage to

roads, bridges, rivers or channels. Meanwhile, Chapter XXIII, Section 511 on attempted offences

could also be interpreted to include offences related to the “fouling” or “corrupting” of water.

Under Section 278 of the PPC, the punishment for “making [the] atmosphere noxious to health”

is a maximum fine of 500 rupees. In addition, certain sections of Chapter XIV on public health

and safety concerning “public nuisance” may be interpreted to include air and noise pollution

from vehicles, as well as emissions (Sections 268, 278, 290 and 291).

3.16 EXPLOSIVE SUBSTANCES ACT 1908

This law regulates the possession and use of explosive substances, including materials for the

manufacture of explosives as well as machinery, tools and materials that can be used to cause

an explosion (Section 2). Causing an explosion is punishable with a maximum sentence of life in

Chapter 03 11 of 16


prison, whether or not the event causes any injury to persons or damage to property (Section 3).

The same maximum penalty applies to making or possessing explosives with intent to cause an

explosion (Section 4). Although the law does not specify conditions under which it is legal to

possess explosive materials, possession of such substances for a purpose that is not “lawful” is

an offence (Section 5), implying that some form of regulatory mechanism is to be put in place.

Powers under this act have been delegated to provincial governments, which may restrict or

allow the courts to proceed with the trial of suspected offenders (Section 7). The 1908 law deals

exclusively with causing explosions or intent to cause explosions.

3.17 EXPLOSIVES ACT 1884

This law deals with manufacture, possession, sale, use and transport of explosives. The

government may prohibit the manufacture, possession or import of any explosive substance,

except with a licence (Section 5), or ban outright the manufacture, import or possession of any

material deemed to be of “so dangerous character [sic]” that it is “expedient for the public

safety” to impose such restrictions (Section 6). Under this law, the maximum penalty for

illegally manufacturing, possessing or importing explosives is 5,000 rupees.

The government may declare any substance deemed particularly dangerous to life or property,

owing to its explosive properties, or any of the processes involved in its manufacture to be an

explosive within the meaning of this act (Section 17). Such materials may include a wide range

of chemical substances that are explosive in nature, although the term “dangerous” itself has

not been defined. No regulatory compliance measures are introduced for the handling of

hazardous materials.

3.18 NATIONAL ENVIRONMENTAL GUIDELINES

3.18.1 THE PAKISTAN ENVIRONMENTAL ASSESSMENT PROCEDURES, 1997

The Pakistan Environmental Protection Agency prepared the Pakistan Environmental

Assessment Procedures in 1997. They are based on much of the existing work done by

international donor agencies and Non Governmental Organisations (NGO’s). The package of

regulations prepared by PEPA includes:

• Policy and Procedures for Filing, Review and Approval of Environmental Assessments;

• Guidelines for the Preparation and Review of Environmental Reports;

• Guidelines for Public Consultation;

• Guidelines for Sensitive and Critical Areas; and

• Sectoral Guidelines for various types of projects.

Chapter 03 12 of 16


3.18.2 GUIDELINES FOR OPERATIONAL SAFETY, HEALTH AND

ENVIRONMENTAL MANAGEMENT, DECEMBER 1996

These guidelines are the outcome of a study commissioned by the Directorate General

Petroleum Blocks, Ministry of Petroleum and Natural Resources, Government of Pakistan. The

guidelines list down the relevant laws related to the operational health, safety and environment

and also recommends environmental controls and management practices to be adopted in O&G

exploration projects.

3.18.3 GUIDELINES FOR PUBLIC CONSULTATION

These guidelines are a part of a package of regulations and guidelines. It provides assistance

throughout the environmental assessment of project by involving the public which can lead to

better and more acceptable decision-making.

3.18.4 SECTORAL GUIDELINES FOR ENVIRONMENTAL REPORTS OIL & GAS

EXPLORATION AND PRODUCTION

The guideline will assist proponents to identify the key environmental issues that need to be

assessed as well as mitigation measure and alternatives that need to be considered in the actual

EIA.

This guideline deal with Oil & Gas projects which involved exploration or production of oil and

gas. The environmental issues discussed in this guideline are specific to exploration or

production activities of oil and gas and all such projects should address these issues. The degree

and relevance of the issues will vary from proposal to proposal. The matters identified in this

guideline should provide guidance for the preparation and assessment of most exploration and

production proposals.

3.19 INTERNATIONAL GUIDELINES

3.19.1 WORLD BANK GUIDELINES ON ENVIRONMENT

The principal World Bank publications that contain environmental guidelines are listed below:

• Environmental Assessment-Operational Policy 4.01. Washington, DC, USA. World Bank

1999.

• Environmental Assessment Sourcebook, Volume I: Policies, Procedures, and Cross-Sectoral

Issues. World Bank Technical Paper Number 139, Environment Department, the World

Bank, 1991,

The first two publications provide general guidelines for conducting EIAs, and address EIA

practitioners as well as project designers. While the Sourcebook in particular has been designed

with Bank projects in mind, and is especially relevant for the impact assessment of large-scale

infrastructure projects, it contains a wealth of useful information, for environmentalists and

project proponents.

Chapter 03 13 of 16


The Sourcebook identifies a number of areas of concern, which should be addressed during

impact assessment. It sets out guidelines for the determination of impacts, provides a checklist

of tools to identify possible biodiversity issues and suggests possible mitigation measures.

Possible development project impacts on different areas such as wild lands, wetlands and

forests are also identified and mitigation measures suggested.

3.19.2 IFC PERFORMANCE STANDARDS

International Finance Corporation (IFC), a member of the World Bank Group, is the largest

global development institution focused on the private sector in developing countries. IFC's

Sustainability Framework applies to all investments and advisory clients whose projects go

through IFC's credit review process.

IFC's Performance Standards define clients' roles and responsibilities for managing their

projects and the requirements for receiving and retaining IFC support. The standards include

requirements to disclose information. The Performance Standards may also be applied by other

financial institutions electing to apply them to projects in emerging markets.

The eight Performance Standards establish standards that the client is to meet throughout the

life of an investment by IFC or other relevant financial Institution.

• Performance Standard-1: Social and Environmental Assessment and Management System;

• Performance Standard-2: Labour and Working Conditions;

• Performance Standard-3: Pollution Prevention and Abatement;

• Performance Standard-4: Community Health, Safety and Security;

• Performance Standard-5: Land Acquisition and Involuntary Resettlement;

• Performance Standard-6: Biodiversity Conservation and Sustainable Natural Resource

Management;

• Performance Standard-7: Indigenous People;

• Performance Standard-8: Cultural Heritage.

3.19.3 IFC ENVIRONMENTAL, HEALTH & SAFETY GUIDELINES

IFC has also developed Environmental, Health, and Safety (EHS) Guidelines. These guidelines

are technical reference documents with general and industry specific examples of Good

International Industry Practice (GIIP).

The EHS Guidelines are required to adhere by IFC clients under Performance Standard 3 on

Pollution Prevention and Abatement.

Chapter 03 14 of 16


3.20 INTERNATIONAL CONVENTIONS & TREATIES

3.20.1 INTERNATIONAL CONVENTION ON BIODIVERSITY

The International Convention on Biodiversity was adopted during the Earth Summit of 1992 at

Rio de Janeiro. The Convention requires parties to develop national plans for the conservation

and sustainable use of biodiversity, and to integrate these plans into national development

programmes and policies. Parties are also required to identify components of biodiversity that

are important for conservation, and to develop systems to monitor the use of such components

with a view to promote their sustainable use.

3.20.2 THE CONVENTION ON CONSERVATION OF MIGRATORY SPECIES OF

WILD ANIMALS, 1979

The Convention on the Conservation of Migratory Species of Wild Animals (CMS), 1979,

requires countries to take action to avoid endangering migratory species. The term "migratory

species" refers to the species of wild animals, a significant proportion of whose members

cyclically and predictably cross one or more national jurisdictional boundaries. The parties are

also required to promote or co-operate with other countries in matters of research on migratory

species.

The Convention contains two appendices. Appendix I contain the list of migratory species that

are endangered according to the best scientific evidence available. For these species, the

member states to the Convention are required endeavour to:

• Conserve and restore their habitats;

• Prohibit their hunting, fishing, capturing, harassing and deliberate killing;

• Remove obstacles and minimize activities that seriously hinder their migration;

• Control other factors that might endanger them, including control of introduced exotic

species.

Appendix II lists the migratory species, or groups of species, that have an unfavourable

conservation status as well as those that would benefit significantly from the international co-

operation that could be achieved through intergovernmental agreements.

3.20.3 THE CONVENTION ON WETLANDS OF INTERNATIONAL

IMPORTANCE, RAMSAR 1971

Pakistan is a signatory to the said Convention. The principal obligations of contracting parties

to the Convention are:

• To designate wetlands for the List of Wetlands of International Importance.

• To formulate and implement planning so as to promote wise use of wetlands, to carry out

an EIA before transformations of wetlands, and to make national wetland inventories.

Chapter 03 15 of 16


• To establish nature reserves on wetlands and provide adequately for their wardening and

through management to increase waterfowl populations on appropriate wetlands.

• To train personnel competent in wetland research, management and wardening.

• To promote conservation of wetlands by combining far-sighted national policies with

coordinated international action, to consult with other contracting parties about

implementing obligations arising from the Convention, especially about shared wetlands

and water system.

• To promote wetland conservation concerns with development aid agencies.

• To encourage research and exchange of data.

So far 19 sites in Pakistan have been declared as wetlands of International Importance or

Ramsar Sites. One Ramsar site named as Indus Delta is located within the In EIA project area.

3.20.4 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED

SPECIES OF WILD FAUNA AND FLORA (CITES)

This convention came into effect on 03 March 1973 in Washington. In all 130 countries are

signatory to this convention with Pakistan signing the convention in 1976. The convention

requires the signatories to impose strict regulation (including penalization, confiscation of the

specimen etc.) regarding trade of all species threatened with extinction or that may become so,

in order not to endanger further their survival.

The Convention contains three appendices. Appendix I include all species threatened with

extinction which are or may be affected by trade. The Convention requires that trade in these

species should be subject to strict regulation. Appendix II include species that are not

necessarily threatened presently but may become so unless trade in specimens of these species

is subject to strict regulation. Appendix III includes species which any contracting party

identifies as subject to regulations in trade and requires other parties to cooperate in this matter.

3.20.5 INTERNATIONAL UNION FOR CONSERVATION OF NATURE AND

NATURAL RESOURCES (IUCN) RED LIST

The red list is published by IUCN and includes those species that are under potential threat of

extinction. These species have been categorized as:

• Endangered: species that are sent to be facing a very high risk of extinction in the wild in

the near future, reduction of 50% or more either in the last 10 years or over the last three

generations, survive only in small numbers, or have very small populations.

• Vulnerable in Decline: species that are seen to be facing a risk of extinction in the wild,

having apparent reductions of 20% or more in the last 10 years or three generations.

• Vulnerable: species that are seen to be facing a high risk of extinction in the wild, but not

necessarily experiencing recent reductions in population size.

Chapter 03 16 of 16


• Lower Risk: species that are seen to be facing a risk of extinction that is lesser in extent that

for any of the above categories.

• Data Deficient: species that may be at risk of extinction in the wild but at the present time

there is insufficient information available to make a firm decision about its status.

3.21 INTERNATIONAL AND NATIONAL ENVIRONMENT AND

CONSERVATION ORGANIZATIONS

International and National NGOs

International environmental and conservation organisations such as IUCN and the World Wide

Fund for nature (WWF) have been active in Pakistan for some time. Both these organisations

have worked closely with government and act in an advisory role with regard to the

formulation of environmental and conservation Policies. Since the convening of the Rio

Summit, a number of national environmental NGO’s have also been formed, and have been

engaged in advocacy, and in some cases, research. Most prominent national environmental

NGO’s, such as the Sustainable Development Policy Institute (SDPI), Strengthening

Participatory Organization (SPO), Shehri, and Shirkatgah are the members of the Pakistan

National Committee (PNC) of IUCN.

As mentioned earlier, environmental NGO’s have been particularly active in advocacy, as

proponents of sustainable development approaches. Much of the government's environmental

and conservation policy has been formulated in consultation with leading NGO’s, who have

also been involved in drafting new legislation on conservation.

3.22 MPCL CORPORATE REQUIREMENTS

Corporate HSE (Health, Safety, Environment) Policy

MPCL undertakes that Health, Safety and Environment (HSE) is a management responsibility

and is committed to give priority to health and safety of all its employees and of other

personnel effected by and involved in its activities. The company HSE policy is built on a “No

Blame” culture. More emphasis is on the recognition and elimination of risk rather than looking

for someone to blame. MPCL also confers its overriding commitment towards minimizing

impact of its activities on the natural environment.

Chapter 04 1 of 21


4 PROJECT DESCRIPTION

4.1 INTRODUCTION

In this chapter salient features of the proposed project are discussed to the extent that they

relate to potential environmental, biological and social impacts. Details of proposed actions,

which include 2D/3D seismic survey, well construction and operational activities, are also

discussed in the subsequent sections.

4.2 PROJECT NEED

Pakistan spends billions of dollars to import the crude oil and other petroleum products and as

a result total import bill is rising for every consecutive fiscal year. To reduce this loss of foreign

exchange the government is committed to maximize replacement of imported furnace oil and

diesel oil with indigenous natural gas.

The share of natural gas in primary energy supplies of the country is about 47.6% (Pakistan

Energy Yearbook, 2011), and is the primary fuel used in the fertilizer industries, in addition to

its uses in the residential, commercial sectors and in power generation.

Pakistan Primary Energy Mix 2010-11 is given as Figure 4.1. The current situation: Energy

sources in Pakistan's current energy mix include hydel, thermal (coal, gas and furnace oil), and

nuclear for electricity generation, and gasoline, diesel, and Compressed Natural Gas (CNG) for

transport applications. Pakistan's primary energy mix-2011 as derived from Pakistan Energy

Yearbook 2011 is: Oil 32.0%; Gas 47.6%; LPG; 0.5%; Coal 6.7%; Hydro, Nuclear & Imported

Electricity 13.2%.

Figure 4.1: Pakistan Primary Energy Mix

The country has an estimated 824 billion cubic meter of recoverable reserves of natural gas

(Pakistan Energy Yearbook, 2010). Gas consumption is highest in the power generation sector

(27.2% of total gas consumed), domestic use (18.7%), Commercial (3.0%), Transport (9.1%), and

in fertilizer production (18.4% of total gas consumed) (Pakistan Energy Yearbook, 2011). In view

32%

48%

-1%7%

13%

Pakistan's Primary Energy Mix 2010-11

Oil Gas LPG Coal Hydro, Nuclear & Impoerted

Chapter 04 2 of 21


of Pakistan's current energy crisis, it has become imperative for the country to explore more

indigenous resources to meet the domestic & industrial demands. MPCL is playing a very

important role in order to explore oil and gas in the country so that dependence on import may

be reduced.

4.3 PROJECT OBJECTIVE

MPCL has two prime objectives coupled with proposed 2D/3D seismic and drilling activities.

These two prime objectives are structured as following:

�� Exploration of new hydrocarbon reserves through drilling of exploratory boreholes on the

basis of promising geological features which will be identified in seismic survey.

�� To enhance the production of fossil-fuels in order to reduce energy deficiencies of the

Pakistan.

Above mentioned objectives will further explore and develop hydrocarbon resources in the

Sujawal EL block (2467-11) of Sindh Province, and ultimately of Pakistan for the mutual benefit

of the Pakistani people and MPCL shareholders.

4.4 PROJECT AREA

The proposed 2D/3D seismic and drilling activities will be carried out in Sujawal EL block

(2467-11) occupying a total area of about 2,416 square kilometres. The block is located in

Sujawal and Thatta districts of Sindh Province Pakistan.

The EIA report covers 320 line Km of 2D and 900 sq. km for 3D seismic operation. Seismic lines

will be laid in order to acquire seismic data and drilling of well to be carried out by MPCL in

the eastern part of the project area. Location will be firmed once the G&G evaluations are

completed.

4.5 PROPOSED PROJECT

MPCL was granted exploration license of Sujawal EL block (2467-11) in June 2006 by the

Government of Pakistan. MPCL is willing to continue its exploration activities and enhance

production capacities. In this connection, MPCL is going to perform seismic (2D/3D) and

drilling activities in Sujawal EL block (2467-11) this will include seismic data acquisition within

the project area and drilling of exploratory well. All these proposed activities will be carried out

after approval of Sindh EPA.

Exploratory activities will involve three different phases both for seismic and drilling segments.

This will include Construction phase, Operational phase and Restoration phase. During

proposed exploration activities, initially seismic survey will be carried out followed by drilling

activity in the project area.

2D/3D seismic data collection occurs along a line of receivers and resulting image represents

section below the line. Seismic survey will take around five months for completion. Generally

two techniques will be used for data acquisition; vibroseis in terrain with gentle slopes and flat

Chapter 04 3 of 21


sandy areas; dynamite within agricultural lands, tidal flats/coastal areas, shallow waters (less

than 2m depth) and all other areas where access and working of the vibroseis will be difficult.

Up-holes may be drilled at selected locations within the area of seismic survey.

Seismic operation will involve housing about 450 people in a camp site and use of water for

domestic and operation purposes. Local labour will also be employed during the operation.

Description of activities involved in seismic activities is discussed in below section.

Drilling operation will be undertaken on a round-the-clock basis with two shifts. The total

estimated time for the drilling of a well is approximately 02-05 months, dependent on the well

type (exclusive of rig movement, rig up and down days). However, this largely depends upon a

number of factors and, therefore, may extend.

Drilling will be carried out using conventional equipment, techniques and practices for

hydrocarbon exploration. A Kelly or top-drive rotary drilling rig will be expected to use in this

operation. The derrick is mounted on a steel platform known as the rig floor. The rig floor

provides the working area for the drilling operations and personnel. A hoisting drum called

draw works is mounted on the rig floor at the base of the derrick. A wire rope called the drilling

line pass from the draw works to the top of the derrick through a system of pulleys called the

crown block and attached to a further system of pulleys known as the hook and block. The

whole system of wire rope and pulleys operates like a crane. A drill string made up of uniform

lengths of hollow steel pipes is suspended from the hooks.

During project activities, construction of campsite, well site; access tracks and other civil works

will be carried out which may also requires land clearing. If existing tracks will found,

improvement of existing tracks will also be carried out in order to utilize these track during

project life.

4.6 SEISMIC OPERATIONS

Information about subsurface geology is gathered by directing shock waves into the ground

and recording the time taken for them to reflect off subsurface rock layers. The shock waves are

generated either by detonating dynamite in holes drilled in the ground or by surface vibration.

The reflected shock waves are recorded using geophones (sensitive microphones), which are

laid out along the area where the detonation or vibration takes place.

Seismic surveys can be conducted using a number of methods, including deep holes, shallow

holes (also referred to as the pop-shot method), surface shots, and truck-mounted vibrators

(Vibroseis TM). For proposed project dynamite and vibroseis techniques for data acquisition

will be used and are discussed in Section 4.7.5 below.

4.7 METHODOLOGY FOR SEISMIC SURVEY

The following different activities that will be involved in conducting the seismic survey are:

• Campsite selection and access track development or improvement (if needed);

Chapter 04 4 of 21


• Camp establishment, mobilization and permitting

• Line survey & preparation

• Data acquisition (e.g. Dynamite, Vibroseis )

• Cabling

• Shooting and recording

• Restoration and rehabilitation

The typical seismic survey procedure is described below.

4.7.1 CAMP SITE SELECTION AND ACCESS TRACK

Seismic program will initiate with the selection of site for camp. Camp site selection will be

carried out taking into consideration the environmental and social aspects of the proposed site.

Usually, a flat tract of land with good access is chosen for camp establishment. Camp site will

be selected keeping in view the minimum clearing of vegetation; however it is likely that any

levelling and clearing will be conducted.

The existing track network will be relied upon to access the seismic lines. Improvement of

existing tracks will also be carried out, where required. Moreover, temporary tracks will also be

developed for seismic program, if necessary.

4.7.2 CAMP ESTABLISHMENT AND MOBILIZATION

Once the access track is completed, camp establishment and mobilization are started. Usually, a

flat tract of land is chosen for camp establishment and nominal levelling and clearing are

carried out, if necessary.

To mobilize the heavier loads, flat-bed trucks are used; for others, ordinary trucks (with a

carrying capacity of 10-15 tons). It takes about 15 days to complete the camp establishment and

mobilization. The seismic crew is mobilized once the camp is fully operational.

4.7.3 LAND PERMITTING:

Before commencement of work a permitting team headed by a chief permit man will arrive in

the area. The team early arrival will facilitate activities such as liaising with local landowners

and authorities to inform them of the operation and make necessary arrangements. The

permitting team will identify the ownership of the land areas over which the seismic operations

will be undertaken. In consultation with the district administration and following agreed rates,

compensation will be given to the land owners wherever applicable. During the seismic survey,

the chief permit man will be the focal point for communication between local inhabitants and

seismic survey personnel.

4.7.4 LINE SURVEY AND PREPARATION:

After obtaining permission from the permitting team, the locations of shot holes will be

surveyed. In this activity, the seismic lines will be marked on the ground by survey teams. Each

Chapter 04 5 of 21


team will comprise of 4 to 5 people. The survey teams will use a global positioning system to

mark shot points on the seismic lines at every 40-50m interval with whitewashed stones or

wooden pegs.

Clearing of trees and dense patches of vegetation will be avoided and seismic lines will be laid

on the plain area. This will be helpful, if vibroseis technology will be used and allow the

movement of vibroseis trucks over the cleared strip of land along the line. Dynamite will be

always used as energy source if seismic lines lying in agricultural fields and will not be cleared.

Geographical Coordinates of Seismic lines given in Table 4.1 and arrangement of seismic lines

is depicted in Figure 4.2.

Table 4.1. Geological Co-ordinates of Seismic Lines

Sr. No. Line No. Line (KM) Latitude Longitude

Deg. Min. Sec. Deg. Min. Sec.

1 SUJ14-01 23.121 24 29 14.4 67 26 5.92

24 41 37 67 28 36.1

2 SUJ14-02 15.683 24 37 27 67 25 0

24 41 37 67 33 9

3 SUJ14-03 23.121 24 30 0 67 31 4.75

24 41 37 67 36 10.9

4 SUJ14-04 27.683 24 34 12.1 67 25 0

24 41 37 67 39 20.2

5 SUJ14-05 23.121 24 30 0 67 37 28.25

24 41 37 67 42 35.1

6 SUJ14-06 39 24 31 13.4 67 25 0

24 41 37 67 45 6.1

7 SUJ14-08 46.163 24 29 18.75 67 25 0

24 41 37 67 48 48.9

8 SUJ13-10 54.923 24 27 0 67 25 0

24 41 37 67 53 21.4

9 SUJ14-12 25 24 30 0 67 35 20.7

24 36 40.6 67 48 14.8

10 SUJ14-14 27.185 24 30 0 67 38 43.45

24 37 12.45 67 52 39.1

11 SUJ14-16 15 24 30 0 67 42 32.65

24 34 0.9 67 30 17.75

TOTAL 320 L.KM

Chapter 04 6 of 21


Figure 4.2: Location of Seismic lines within Sujawal EL Block

Chapter 03 7 of 21


4.7.5 DATA ACQUISITION:

The typical procedure for data acquisition using the shot/deep whole technique is described

below.

Dynamite:

In this technique, shot holes (~24m), will be drilled after every 40-50m along sections of the

seismic lines passing through agricultural lands, mountainous region or any other area of

interest. These holes will be drilled using portable hand driven drills or potable jackrob drilling

units. Drill will be operated by a team of 4-5 drillers headed by a foreman.. If a shot point

cannot be drilled at a specified location because of any environmental restriction, a replacement

point will be located as close to the original shot point as possible.

After completion of drilling, each shot hole will be loaded with optimum amount (2 -6 kg) of

dynamite and 1 or 2 detonators. Explosives will be handled by a loading crew who will be

specially trained in the handling, storage, transportation, charging, firing and safety of

dynamite. Charges will be carefully inserted into each hole. Each hole will then be backfilled

with sand/mud. Shot Hole drilling operation is depicted in Figure 4.3.

Figure 4.3: Shot Hole Drilling Operation

Labours will be divided into six teams including front crew, back crew, shooting crew,

recording crew and green crew that will carry out shooting, recording and restoration along the

seismic lines. These teams will operate several days behind the drilling team. Front cable-crew

will lay down the cables and plant geophones along the seismic line. Cables and geophones will

be symmetrically laid down along the seismic line on either side of a shot point. Geophones

connected together in groups of 24 or more will be planted along the line at intervals of 1 to 4

meter. Each string of geophones will be connected to a cable which will be connected to a

station unit. Station units will be connected to a recording unit through the same cable. Points

along which cables and geophones will be laid are termed receiver array. Approximately 70

Chapter 03 8 of 21


labours will be employed for laying and retrieving of cables. A pictorial view of Geophones and

lying of Cables is depicted in Figure 4.4.

Figure 4.4: A pictorial view of Geophones and lying of Cables

After the cables and geophones have been laid out along the line or around the shot hole

containing the charge, the charge is detonated by a crew comprising of 4 men. The charge in one

shot hole will be detonated at a time. At the surface, the sound of the detonation is normally no

more than a muffled thud. The process will be successively repeated for each shot hole, with

cables and geophones being removed from the back of the line and placed at the front of the

line as the detonating team progresses.

The sound waves reflected off geological layers will be picked up by the geophones, amplified

and recorded electronically by mobile recording units. Subsequently, the data will be processed

by computer to produce a map of the underlying structure. This information will then be

processed and interpreted by geophysicists and geologists.

Vibroseis:

This technique will make use of vibrators as an energy source. Vibrator consists of a heavy mass

attached to a steel plate mounted on a truck. Truck will lower the steel plate to rest on the

ground by means of hydraulic jacks. Steel plate will be made to vibrate, creating energy waves

that will travel downwards into the earth surface. Reflected waves will be received on the

ground by cables and geophones laid along the seismic line. Arrangement of cables, geophones

and station units will be similar to the arrangement adopted for dynamite. A series of 4

vibrators will follow each other along the line. All 4 vibrators will stop at a point called

vibroseis point, and produce energy waves of between 2-80 Hz for a period of less than 20

seconds in the manner described above. With this technique approximately 4-8 km of line can

be recorded each day. Operation of Vibroseis is presented in Figure 4.5 below.

Chapter 03 9 of 21


Figure 4.5: Vibroseis Truck in Operation

4.7.6 RESTORATION AND REHABILITATION:

After completion of the seismic operation all affected areas (including access tracks, seismic

lines and camp sites) will be restored. A restoration and rehabilitation crew will be mobilized to

ensure that the affected areas are being brought back to their original condition as much as

possible.

Specific to campsites restoration, following activities will be carried out for site restoration.

Moreover, for reference purposes photographic record of the campsites prior to set-up will be

established.

• Demobilization of all equipment and machinery.

• Disposal of any waste material remaining at the time of completion of the operation.

• Backfilling of all soak pits and septic tanks.

• Backfilling of all holes and pits

• Dismantling and removal of fence or barriers surrounding the camp area.

• General restoration of the site area including landscaping and restoration of drainage where

required.

Restoration of seismic lines will include removal of all cables, geophones, station units, flags,

stakes and wastes from the lines and back filling of all mud pits. For reference purposes a

photographic record of selected sections of seismic lines could be taken before and after the

operation.

Chapter 03 10 of 21


4.7.7 ACCOMMODATION AND SUPPLIES:

One base camp and fly camps (if required) will be prepared to house a maximum of 450 crew

members. The approximate area for the base camp will be between 50,000 - 60,000 sqm and will

include accommodation area including tents and portacabins; senior and junior kitchens and

mess; laundry area; toilets; workshops; vehicle parking area; equipment storage areas; fuel and

oil storage area; generator area, septic tanks and soak pits; and a garbage pit. The camps will be

fenced for security reasons. The base camp will be prepared by an advance party. Survey work

will start only after satisfactory set up of the base camp. Most camp supplies will be transported

from Karachi, Gharo and Hyderabad. Water will be required during the operation for domestic

and drilling purposes. Water will be transported to the site from the suitable source. The

required quantity of water will be obtained either from existing local tube well or well drilled

for the project or can be supplied through water boozers. Quantity of water required during

various operations of the seismic survey is provided in Table 4.4.

A bulk stock of dynamite will be transported to the project area. This will be stored in a purpose

built explosive storage area located at a safe distance from communities and the seismic camps.

The explosives will be stored in an excavated pit lined with concrete blocks and covered with

tarpaulins. The area will be fenced and guarded for security reasons.

Power required during operation of the base camp will be met through installation of diesel

generators.

4.8 DRILLING OPERATION

MPCL will carry out drilling activities on the basis of data gathered from the seismic activities.

It is envisaged that based on the results of the seismic operation, a deep exploration well will be

drilled in the eastern part of project area. Activities associated with the drilling will include

construction of a well site, camp site, an access track; septic tank, platform, pits, drilling of the

exploration well; possible well testing in case of a discovery; abandonment, completion or

suspension of the well depending on the success or failure of the well and site restoration. A

detailed description of these activities has been provided in the following sections. The

exploratory well to be drilled will be finalized after assessment of the seismic data.

4.8.1 SUJAWAL BLOCK EL CONSTRUCTION PHASE

In this phase, civil work will be performed which includes construction of a well site, camp site,

an access track; septic tank, platform, pits etc. A detailed description of these activities has been

provided in the following sections.

4.8.2 CIVIL WORK ACTIVITIES

Before the commencement of drilling, each selected site for drilling will be developed according

to the requirements of the selected drilling rig and well drilling program. Existing tracks will be

used as much as possible to access the proposed drilling site but it is expected that about 2 to 4

km long katcha track will be constructed to access the well site.

Chapter 03 11 of 21


Well site and campsite cover an area of 15 acres and 5 acres respectively. The construction

contractor will develop its own camp for construction purposes. The camp will house a

maximum of 150-200 people. The contractor will also hire local people for unskilled jobs.

The construction works will take approximately 4 months. A typical drilling site layout is

presented in Figure 4.6.

Figure 4.6: Typical Drilling Site Layout (not to scale)

A campsite is needed to support drilling operations. For campsite construction, following

activities are involved.

• Clearing and Levelling of the area using bulldozers, tractors and graders;

Chapter 03 12 of 21


• Construction of auxiliary facilities such as barracks, guard room, watch towers, kitchen,

mosque, water pit, sewerage lines, septic tanks and soak pits.

• A rig camp consisting of portable cabins, kitchens, mess rooms, bathrooms, laundries etc for

which limited construction works including filling, compaction and construction of cabin

foundation are required.

• Installation of a fence around the area.

A single cement pad will be constructed near well location to support the drill rig, mud pumps

and ancillary equipment. At least five pits will be excavated around the periphery to store

water, drill cuttings, wastewater, and solid waste and flare pit where necessary. Following

activities are involved for construction of well site.

• Land Clearing and Levelling of the area;

• Construction of cellar, drilling rig pad and miscellaneous concrete pads to support heavy or

vibrating equipments;

• Filling and compaction to raise the site level;

• Construction of platform for fuel storage tank with sump and loading/un-loading pad,

storage yard, drilling waste mud pit, water pits and flare pit.

• Installation of a fence around the area.

4.9 WELL DRILLING OPERATION PHASE

Upon completion of construction work, mobilization of the rig and related machinery and

equipment commences. This is followed by the drilling operation and at the completion of

drilling, fracture stimulation may be performed in case the well is found to be productive.

Drilling operations are generally conducted round the clock. The time taken to drill a bore hole

depends on the depth of the hydrocarbon bearing formation and the geological conditions, but

it is commonly of the order of few months. Where a hydrocarbon formation is found, initial

well tests will be conducted to establish flow rates and formation pressure.

4.9.1 RIG MOBILIZATION

The drilling rig is transported to the site using trailers. The rig is assembled and erected over the

well location. Other ancillary equipment such as power generators, mud pumps, mud tanks,

shale shakers, cementing unit, drill pipe and collars will also be transported to the site.

4.9.2 DRILLING OPERATION

The well will be drilled using a rotating bit, suspended at the bottom of a drill string. The drill

bit drills through the formations by the combined effect of the weight of the drill collar and the

rotary action provided to the bit by a rotary table mounted on the rig floor. Rotation of the

drilling bit and string will be achieved by means of powerful electric motors on the surface.

Chapter 03 13 of 21


Steel casings will be run into completed sections of the well and cemented into place. The casing

will provide structural support to maintain the integrity of the well hole by sealing potentially

weak zones, and will protect aquifers from contamination that could occur due to drilling

fluids. A pictorial view of a rotary drilling rig is shown in the Figure 4.7.

Figure 4.7: Pictorial View of Rotary Drilling Rig

4.9.3 DRILLING MUD

The conventional process of drilling for oil and gas well uses a rotary drill bit that is lubricated

by drilling fluids known as “mud”. As the drill bit grinds downward through the rock layers,

producing fragments, which range in diameter from 10’s of microns to 1-2cm, depending

largely on the nature of the rock (McFarlane and Nguyen, 1991) and generates large amounts of

ground-up rock known as drill cuttings.

Chapter 03 14 of 21


Drilling mud is pumped through the drill string down to the drilling bit and is returned to the

drill rig in the space (or annulus) between the drill string and the casing as mention in

Figure 4.8.

Figure 4.8: Schematic Diagram of Mud Recycling System

Drilling mud will be used during the operation to serve the following functions.

• The hydrostatic pressure generated by the mud’s weight controls the downhole pressure

and prevents formation fluids from entering the well bore.

• It removes the rock cuttings from the bottom of the hole and carries them to the surface and

when circulation is interrupted it suspends the drill cuttings in the hole.

• It lubricates and cools the drill bit and string.

• It deposits a mud cake on the wall of the well bore effectively sealing and stabilising the

formations being drilled.

Chapter 03 15 of 21


The mud will be recycled and maintained in good condition throughout the operation. The

mud and suspended cuttings are processed on the surface through screens called “shale

shakers” to maximise recovery of the mud. The recovered mud is then generally passed

through a desander to remove sand particles and, if necessary, subsequent treatment is

provided by a centrifuge or desilter. This additional equipment removes the fine colloidal

solids, the particles too small to be removed by the conventional equipment, which if allowed to

build up can make the mud too viscous. If the viscosity is not controlled at source a proportion

of the mud would have to be discharged and the remainder diluted with oil and/or water. The

composition of the mud depends on the geology of the well and will change as the well

progresses

A water based drilling mud will be used during the operation. However, where necessary, oil

based mud can be used. A. waste management plan will be developed and implemented for

safe disposal of drilling mud. Variety of additives are also used in water based mud for specific

purposes, these additives serve the following functions:

Fluid loss control: The layer of mud on the wall of the well bore retards the passage of liquid

into the surrounding rock formation. Bentonite is the principal material for fluid loss control

although additional additives such as starch and cellulose, both naturally occurring substances,

are also used.

Lost circulation: Naturally occurring fibrous, filamentous, and granular or flake materials are

used to stop lost circulation when the drill bit enters a porous or fractured formation. Typical

materials include ground nut shells and mica.

Lubricity: Normally the drilling mud alone is sufficient to adequately lubricate and cool the bit.

However, under extreme loading, other lubricants are added to prevent the drill string from

becoming stuck.

pH Control: Caustic and lime increase the pH of the mud to between 9 and 10. This ensures the

optimum performance of the mud and controls bacterial activity.

Pressure Control: Barite is generally used as a weighting agent to control downhole pressure.

Typically a single well may lead to 1000 - 4000 m3 of cuttings and mud depending on the nature

of cuttings, well depths, hole diameter and rock types.

The drilling mud will consist of slurry of formation cuttings suspended in a liquid phase.

Certain additives such as bentonite, barite and salts will be used for initial mud formulation and

subsequent changes as required during the operation. The exact constituents and concentrations

will be finalized before the drilling operation. The quantity of drilling mud used and the

cuttings generated will depend upon the well geology, depth of the well, and other operating

factors.

Chapter 03 16 of 21


4.9.4 DISPOSAL OF DRILLING WASTES

Conventional drilling waste management involves discharging the mud and cuttings into a

lined waste pit. The waste management system is considered to be technologically and

environmentally the most preferred option. The drill cuttings and mud will be disposed off at

the well site within HDPE lined waste pits. These pits will be closed by providing a top-soil

cover at the time of site restoration.

4.9.5 WELL COMPLETION

When the well has reached total depth and final logging has taken place, the well will be sealed

by running a final string of casing into the ground in the form of a liner. This will then be

cemented. Following this a completion string will be run made-up of down hole seals and

valves which will be sealed at the surface and the well capped with a Christmas tree.

The well is expected to be imperforated awaiting testing at a later date, at which point the well

will be perforated and allowed to produce gas.

The drilling rig will be moved to the next location after the well has been completed and a Well

Intervention unit and associated equipment will be mobilised to the well to undertake well

bracing and testing operations.

4.9.6 WELL EVALUATION AND TESTING

After the completion of the drilling operation, well testing may be carried out to establish a

number of parameters such as gas composition and pressure. During well testing hydrocarbons

from the testing zone will be flowed to the surface. In order to control the operation, and to

avoid the risk of accident, formation gases or any other gases produced during well testing will

be flared under controlled conditions. These gases will be flared from the end of a flare line laid

horizontally on the ground, and extending to the flare pit. Any formation water will be

separated and discharged into the mud pit.

Farcing operations may be carried out in order to improve the production from the well. This

entails pumping large quantities, approximately 1500 cu metres, of special water based fluid

into the well to open up flow paths in the reservoir rock and allow the well to produce more

efficiently.

4.9.7 WELL CONTROL AND BLOW OUT PREVENTION

Besides careful monitoring and control of the mud system and the installation of casing in each

section of the well, a surface wellhead consisting of a series of Blow out Prevention (BOP)

valves will be installed at the top of the casing. The function of BOP is to prevent uncontrolled

flow from the well by positively closing in the well bore as and when required. The BOP is

made up of a series of hydraulically operated rams, and is designed to withstand pressures well

in excess of those expected to be encountered.

Chapter 03 17 of 21


4.9.8 ACCOMMODATION AND SUPPLIES:

During the drilling and completion operation, accommodation for an average of about 150 rig

crew and 50 local labours will be arranged in a campsite. The camp area in addition to

workforce accommodation will include facilities for catering, washing and laundry, storage of

water and fuel, and power generation.

During the drilling program, the supplies, with the exception of casing, will be transported to

the rig in smaller trucks. Casing will be carried to the rig in 40ft flatbed trucks. General supplies

transported will include camp supplies (food, etc), fuels, oils and chemicals, and equipment

maintenance parts. Project personnel will travel to and from the rig in smaller vehicles, mostly

four-wheel drive pickups.

Water for rig and camp operation will be transported to the site from the suitable source. A

maximum of 150,000 litres of water will be required per day for this purpose. Water required

during construction of well site and all drilling activities is provided in Table 4.2.

Again the power requirement for drilling and domestic purposes will be met through

installation of diesel generators.

4.10 DECOMMISSIONING/ RESTORATION PHASE

The primary objective of this activity will be to ensure responsible waste management occurs on

site so as not to present any undue risk to the physical, biological or human environment. At the

conclusion of the drilling programmed a demobilization plan will be implemented. This will

provide for the orderly withdrawal of all personnel, and the removal of all unfixed drilling

equipment.

4.10.1 DEMOBILIZATION

After completion of the drilling and testing operation, the rig will be dismantled and

demobilized off the site. The well head will remain in situ, but all other equipment and

materials will be removed from the well site.

4.10.2 RESTORATION

Restoration will involve the removal of equipment that was not originally at the site and which

had been bought into conduct operation.

Standard Operating Procedure of site restoration for seismic and drilling operations;

• Demobilisation of all equipment and machinery

• Disposal of any waste material remaining at the time of completion of the operation

• Backfilling of all soak pits and septic tanks

• Dismantling and removal of fence or barriers

Chapter 03 18 of 21


• General restoration of the site area including landscaping and restoration of drainage where

required

• Restoration of seismic lines will include removal of all cables, geophones, station units,

flags, stakes and wastes from the lines and back filling of all mud pits

• Liner from the water and waste pits at the well site may be taken out and re-used or

disposed off

• The areas covered by the portion of the access track that will be of no use for other wells

will be restored, in that all gravel topping will be removed.

Restoration plan checklist for seismic and drilling operation is given in Annexure VI.

4.11 PROJECT SCHEDULE

The project duration for seismic, construction and operation phases may increase if any

operational problems occur. The seismic survey is expected to take 6-8 months. The

construction and operation of the well is expected to take eight months. The proposed project

schedule for well Operation is expected to be as follows:

4.12 RESOURCE USAGE AND REQUIREMENT

4.12.1 RECRUITMENT

It is expected that overall project activities generates around 300 vacancies for technical, security

and unskilled worker. Local people will be given preference for unskilled job. Details of the

staff requirement for major phases of the project are as under:

Table 4.2: Project Schedule

Sr. No. Activity Duration (Week)

1 Seismic Activities 24

2 Construction Work 12 - 16

3 Mobilization 3 - 4

4 Drilling and Testing 12 - 16

5 Demobilization 2 - 3

Table 4.3: Workforce Required for Proposed Seismic & Drilling Activity

Type of Workforce Seismic Phase Construction Phase Drilling Phase

MPCL Employees 10 05 15

Contractor 400 30-40 120

Security Guards 40 40 40

Chapter 03 19 of 21


4.12.2 WATER REQUIREMENT

During seismic data acquisition, establishment of campsite and operational/drilling activities

either water will be procured through water tankers or obtained from tube well or appropriate

source. The estimated water consumption is mentioned below;

Table 4.4: Water Requirements during Project Activities

Phases Water Requirement (Gallons/day)

Domestic usage during seismic survey Approximate 160 Litres per capita/day

Construction of well site 1691 Gallons/day

Drilling Operations Approximate 50,000 to 60,000

4.12.3 ELECTRICITY REQUIREMENT

Electricity requirements will be fulfilled by diesel generators. Total numbers of generators with

their capacities utilized at different phases are as under:

4.12.4 FUEL REQUIREMENTS

Fuel requirement for the generation of electricity shall be obtained through local market. The

estimated fuel consumption is mentioned below;

4.12.5 VEHICLE REQUIREMENTS

Project personnel will travel to and from camp site and rig site mostly through small cars and

through single and double cabin pick up. Vehicles are used for following purpose;

• Fuel transport vehicles;

• Water transport vehicles;

Table 4.5: Electricity Requirements for Camp & Rig Sites During Operations

Phases Quantity Capacity (KVA)

Camp Site 02 400-500

Rig Site 04-05 1,000-1,300

Table 4.6: Fuel Requirements during Proposed Activities

Phases Fuel Requirement (litres /day)

Seismic 2,500

Operation 8,000-12,000

Chapter 03 20 of 21


• Heavy trucks for mobilisation/demobilisation;

• Vehicles for staff mobilisation;

• Earth moving and construction machinery/equipments

Table 4.7: Vehicle Requirements during Proposed Activities

Phases Quantity Vehicle Type

Seismic 4-5 Vehicles e.g. double cabin and single cabin pick up

Construction 3-4 Earth moving & construction equipments

Drilling 10-15 4x4 DD IMV, cranes, lifter, loader, cars and mobile

welding Plants

4.13 WASTE GENERATION AND DISPOSAL

4.13.1 SOLID WASTE

Solid waste generated at campsites will consist of both

hazardous and non hazardous waste. It is expected that 400-

500 kg/ month solid waste (hazardous / non-hazardous) will be

generated. Recyclable solid waste will be recycled through waste

contractor where applicable and hazardous waste will be disposed

off through approved waste contractor.

4.13.2 WASTEWATER

Wastewater produced during project activities mainly consist of grey and black water. Black

water will be directed towards septic tank & soak pit whereas grey water will be stored in soak

pits.

Seismic Phase

It is estimated that during seismic activities approximately 150 litres per capita per day

wastewater will be discharged.

Operation/Drilling Phase

It is estimated that 7000 -8000 Gallons / day effluent will be generated.

4.13.3 DRILL CUTTING AND MUD WASTE

Water based mud will be used during drilling. However HDPE lined, mud waste collection pit

will be constructed for the collection of drill cutting and waste mud. After water evaporation pit

will be backfilled by MPCL. Nature of waste material generation and integrated waste

management plan given in Annexure V

Chapter 03 21 of 21


4.14 FIRE AND EMERGENCY PREPAREDNESS PLAN

MPCL have a clearly defined, well structured and dynamic Emergency Response Plan. This

plan is prepared to handle level 1 and level 2 emergencies defined by MPCL.

4.15 HEALTH, SAFETY AND ENVIRONMENTAL MANAGEMENT

The seismic, construction and drilling

contractors will have to meet the

requirements of Health, Safety and

Environmental (HSE) management

standards of MPCL. HSE monitoring

consultant will be deployed at project site on

the call out basis to monitor HSE

compliance executed by the consultant.

Health, Safety and Environment Policy of

MPCL, underscores commitment on

prioritizing health and safety of all its employees, contractors and visitors involved in its

activities and confer overriding commitment towards minimizing impact of its activities on the

natural environment.

Chapter 05 1 of 4


5 PROJECT ALTERNATIVES

5.1 PROJECT ALTERNATIVES

Three types of alternatives are considered for the proposed seismic and drilling activity in

Sujawal EL block:

• No Project Option

• Drilling Based (Coiled, Conventional Rotary, Slim hole)

• Mud Based (Water Based, Oil based)

In order to undertake exploration, a drilling program must be designed and executed. Various

drilling techniques exist and are applied dependant on the geological, reservoir and

environmental conditions of the site. The techniques evaluated include conventional rotary

drilling, coiled tubing and slim hole drilling. The chosen technique for this project is

conventional rotary drilling and the advantages and disadvantages of these are discussed

below.

5.1.1 NO PROJECT OPTION

The energy sector of any country plays a very important role in the growth and development.

Pakistan spends billions of dollars to import the crude oil and other petroleum products and as

a result total import bill is rising for every consecutive fiscal year. To reduce this loss of foreign

exchange the government is committed to maximum replacement of imported furnace oil and

diesel oil with indigenous natural gas.

The share of natural gas in primary energy supplies of the country is about 47.6% (Pakistan

Energy Yearbook, 2011), and is the primary fuel used in the fertilizer industries, in addition to

its uses in the residential, commercial sectors and in power generation.

In view of Pakistan's current energy crisis, it has become imperative for the country to explore

more indigenous resources to meet the domestic & industrial demands. MPCL is playing a very

important role in order to explore oil and gas in the country so that dependence on import may

be reduced.

An oil and gas discovery in the Sujawal EL Block (2467-11) will augment the present oil and gas

supplies of the country and reduce Pakistan’s reliance on imported fuel. With respect to above

realities the No Project Option seems to be highly unfavourable.

5.1.2 DRILLING TECHNOLOGIES

Coiled Tubing

A relatively modern drilling technique involves using coiled tubing instead of conventional

drill pipe. The technology uses conventional drilling assembly with a down hole motor (ICOTA,

Chapter 05 2 of 4


2005).This has the advantage of requiring less effort to trip in and out of the well (the coil can

simply be run in and pulled out while drill string must be assembled and dismantled joint by

joint while tripping in and out). Additionally, the coiled tubing is stripped into and out of hole,

providing a hermetic seal around the coil and, if desired, allowing the well to flow during

drilling operations. Instead of rotating the drill bit by using a rotary table or top drive at the

surface, it is turned by a down whole motor, powered by the motion of drilling fluid pumped

from surface.

However, there are some disadvantages of coiled tubing technology as follows:

• The whole diameter required to be drilled across the gas bearing formations in order to

effectively evaluate the productive capacity of these formations cannot be achieved with

current coil tubing technology.

• Coiled tubing cannot rotate so it is not a good option if there is a risk of differential

sticking.

• The tubing is prone to fatigue.

• Control and safety concerns in high-pressure wells with large volumes of pressurized gases

at surface in the exposed.

• Also of concern is depth control and reach limitations for horizontal drilling applications.

• Tighter controls on operating conditions and handling methods are required in coiled

tubing applications than are normally applied when using conventional drill strings.

Slim hole Drilling

The oil and gas well drilling method "Slim Hole Drilling" (micro whole or small hole) is one of

the most cost effective methods of oil and gas reserve development. It involves drilling smaller

diameter holes and using small diameter production casing and tubing. The use of small

diameter well bore reduces the overall cost of exploration drilling and reserve

development. According to DOE (1999), slim hole wells are defined as wells in which at least

90% of the hole has been drilled with a bit six inches or less in diameter. Although slim whole

technology has been available since the 1950s, it was not commonly used because the small-

diameter well bore restricted stimulation, production, and other down whole manipulations.

Slim whole drilling technology can cut the drilling and completing costs significantly. However,

the cost savings achieved from slim whole drilling can be offset by increased mechanical

failures, reduced lateral whole length and lack of directional control. Factors that affect

operations and economics in slim whole drilling are as following:

• The whole diameter required to be drilled across the gas bearing formations in order to

effectively evaluate the productive capacity of these formations cannot be achieved with

slim whole drilling technology.

Chapter 05 3 of 4


• One of the disadvantages for slim whole drilling is drill string failures associated with use

of small diameter tubular. The reduced weight of slim whole drill pipe makes the drill

string mechanically weaker than its conventional equivalent.

• Tool joint failure is another problem for slim whole drilling. Because of small and thin

tubular and joints, they are-inherently weaker and have a tendency to bellying and twist-

offs, particularly in deeper holes.

• Kick detection is a difficult issue for slim whole drilling because a unit of reservoir gas

entering a slim whole annulus will occupy a much greater height than in conventional

wells. This can result in maximum allowable pressure in the casing being approached

faster than in a conventional well.

• Another disadvantage for slim whole drilling is decreasing in penetration rates, especially

for roller cone bits.

• Depth is a key limiting factor when considering slim whole well design.

• Borehole integrity and instability are other concerns for slim whole drilling. Because of

small annul space between drill strings and wellbore, the pressure loss is larger than

conventional drilling.

• One major limit of slim whole horizontal drilling has been the inability to effectively

transmit weight to the bit.

Conventional Rotary Drilling

The conventional process of drilling oil and gas wells uses a rotary drill bit that is lubricated by

drilling fluids or mud. As the drill bit grinds downward through the rock layers, it generates

large amounts of ground-up rock known as drill cuttings. This technology is discussed in detail

in previous sections of this chapter. Its advantages include:

• Most rock formations can be drilled.

• Water and mud supports unstable formations.

• Fast operation is possible above and below the water-table.

• Possible to drill to depths of over 4000 meters.

• Possible to use compressed air flush.

Disadvantages of rotary drilling are:

• Requires capital expenditure in equipment.

• Greater volume of water is required for pumping.

• Greater volume of drill cuttings generated

• Rig requires careful operation and maintenance.

Chapter 05 4 of 4


Selection

Conventional rotary drilling proposed by MPCL has been historically used for the drilling of oil

and gas wells. Other drilling techniques discussed above include coiled tubing and slim holes.

Despite some environmental gains in the use of coiled tubing and slim holes (reduced well site

area, reduced waste volumes etc), both techniques have significant technical disadvantages and

operational limitations. Moreover, there is a finite supply and quantity of suitable drilling rigs

and in the case of breakdowns, required back-up and service facilities, specialized replacement

equipment or technical vendor support this may not be as readily available as for conventional

rigs. Advantages of the two techniques therefore do not outweigh their disadvantages.

Conventional drilling technique proposed by MPCL is therefore considered to be the best

available technology.

5.1.3 DRILLING MUD SYSTEM

Drilling mud (also termed fluids) are used during the drilling process to transport rock chips

(cuttings) from the bottom of the well, up and out of the well bore, where the cuttings are

screened and removed, and the separated mud is reused. Drilling mud also act to cool the drill

bit, to stabilize the well walls during drilling, and to control formation fluids that may flow into

the well.

Generally two broad categories of mud are used for drilling of oil or gas wells;

� Oil Based Mud and

� Water Based Mud

Oil based mud is formulated by mixing chemicals with diesel. This mud is not considered to be

environment friendly due to the risk of contamination of subsurface formations during drilling

and the generation of oily drilled cuttings which require specialized handling and treatment. A

water based mud (WBM) system will be used which due to the above-mentioned reasons has

environmental preference over oil based mud and is therefore considered to be the preferred

alternative.

Chapter 06 1 of 54


6. ENVIRONEMNTAL AND SOCIAL BASELINE

This chapter defines the prevailing physical, biological and socioeconomic environment of the

project area and surrounding. The project area in this document is defined as the area where the

project related activities are to be carried out which include the project site, its surrounding and

the area that can interact with the project’s positive and negative externalities in the long run.

The environmental impact of any activity or process will be assessed on the basis of a deviation

from the baseline or normal situation.

The information presented in this section has been derived by a combination of desk study and

field survey. Field survey was conducted to collate primary data for water, flora, fauna, noise

and socio-economic features. A team consisting of an Environmentalist, Sociologist, Ecologist

and Wildlife experts visited the project area.

Followings are the main components of the baseline discussed in this section.

• Physical Environment

• Biological Environment

• Socio-economic Environment

The description provided in this section is based on followings:

• Desktop study and literature review

• Meetings and data collection form MPCL

• Baseline data gathered from field activities

• Baseline data from relevant departments

• Government released publications such as Provincial and Federal census reports

6.1 PHYSICAL ENVIRONMENT

6.1.1 GEOGRAPHY

Sujawal block falls in districts Thatta and Sujawal of Sindh province. These districts are

bounded on the North by Dadu district, on the East by Hyderabad and Badin districts, on the

South by Runn Cutch area and Arabian Sea and on the West by Karachi division.

The historical city of Thatta, which was once the capital of Sindh, was carved out from Karachi

as a separate city in August 1948. It is the second largest district in Sindh. This district, divided

by River Indus, remained unified for over 65 years. According to the notification October 2013

issued by the Sindh Revenue Department, the right side of River Indus will comprise old Thatta

district and the left side will come under the jurisdiction of newly created Sujawal.

Total area of both districts is 17,355 Km2 and comprises of 9 talukas, out of which six are coastal

and three are non coastal talukas; and 53 Union Councils. District Sujawal consist of Taluka

Chapter 06 2 of 54


Mirpur Bathoro, Shah Bander, Kharochan, Jati and Sujawal while District Thatta consists of

Taluka Mirpur Sakhro, Ghorabari, Keti Bandar and Thatta.

Among these talukas, EIA study area is spread over in Mirpur Sakhro, Mirpur Bathoro, Jati

Sujawal, Thatta and Ghorabari talukas of the districts.

6.1.2 TOPOGRAPHY

The macroenvironment of the project area i.e. district

Thatta and Sujawal has varied features in its physical

aspects, which range from coastal swamps to fresh

water marshes and lakes and from river islands to

coastal deltas. The terrain of these districts consists of

the Makli Hills close by the Thatta town. These hills

are 32 kilometers in length and are well known on

account of the ancient tombs which are located here.

The north western part of the district consists of hilly

tracts known as Kohistan. Between Sir and Khori Creeks lie the great Sirganda salt deposits

which consist of many square kilometers of solid salt.

River Indus flows downstream the Kotri Barrage through numerous creeks till its delta in

Arabian Sea near chach deh wali Mohammad at Keti Bunder. The south-western part of the

district is saline and sea-affected due to long coastline of about 107 kilometres as well as

shortage of river Indus water, while the southern portion adjoining “Great Run of Kachh” on

the border of India is desert like sandy area.

The microenvironment of the study area encompasses a flat terrestrial land consist of

agriculture and reverine forest area of River Indus.

The project area is rich in natural resources having diverse and productive habitats, and

ecosystems. These include forests (riverine and irrigated), variety of biodiversity, water logged

and wetlands. The riverine forests have rapidly converted into agriculture land for economic

development in project area. While agriculture activities are major part of livelihoods, livestock

(cattle poultry and fish farming) was also a key component of earning money. Wood cutting

and forest products enable households to meet timber and fuel needs as well as supplement

their incomes. Infrastructure of metallic paved/ unpaved roads Bachao Band near Indus River is

also exist in the project area.

The area had a rich history and economic opulence in the past. Since last three decades, after the

upstream construction of Tarbella Dam in 1977, the coastal ecosystem of Indus delta is under

stress from seawater intrusion and an increase in salinity and water- logging. Consequently, the

cultivation of field and historical crops like red rice and commercial fish farming has declined

drastically. Potable water has become scarce in the project area.

The project area is quite prone to natural hazards and has experienced six natural disasters in

recent years; a cyclone in 1999, drought in 2000, earthquake in 2001, drought followed by

Topography of Project Area

Chapter 06 3 of 54


floods in 2003, Super Flood of 2010 and the flash- floods of 2011. Disaster affected families have

never been appropriately assisted through affective recovery and rehabilitation programs. The

other limiting factor in the area is increasing sea intrusion, caused by the diurnal and cyclic

fluctuation of the sea level, apparently it is a climate change effect augmented by the degrading

ecology of the area.

6.1.3 GEOLOGY

The Lower Indus Platform Basin is bounded on the North by Central Indus Basin, to the

Northwest by the Sulaiman Foldbelt Basin and the Kirthar Fold Belt Basin in the South West.

The main tectonic events which have controlled the structures and sedimentology of the Lower

Indus Basin are rifting off the Indian Plate from Gondwanaland (Jurassic or Early Cretaceous)

which probably created NE-SW to N-S rift systems, isostatic uplift or ridge-push at the margins

of the newly developed ocean probably caused uplift and eastwards tilting at the start of the

Cretaceous. Separation of the Madagascan and Indian plates in the mid to late Cretaceous

which may have caused some sinistral strike-slip faulting in the region, hotspot activity and

thermal doming at the Cretaceous-Tertiary boundary. This in turn caused uplift, erosion,

extrusion of the Deccan flood basalts and probably the NNW-striking normal faults.

Palaeocene-Eocene emplacement of the Bela Ophiolites may have caused gentle folding, Eocene

passive margin conditions caused structural quiescence and carbonate deposition, Oligocene to

present-day Himalayan collision caused sinistral transpression in the west of the Lower Indus

Basin, with fold-thrust structures overprinted by sinistral flower structures.

a) Stratigraphy

This tectonic province is underlain by infra-

cambrian to recent clastics and carbonates. It

remained passive margin until the Late Cretaceous,

and then became part of the complex suture

between the Indian Plate and the Afghan Block.

The sratigraphic succession changes from east to

west. Precambrian basement is exposed in the

south-eastern corner of the basin. The thickness of

the sediments increases westward. Important

unconformities occur at base Permian and base

tertiary. In the eastern part of the basin, tertiary has direct contact with the Jurassic sequence.

b) Soils

Project area is located in the lower part of Indus Plain. Its productive soils in central plains have

been formed by actions of the Indus River which deposits silt cover along both sides of river

banks during Abkalani every year since time immemorial. These alluvium soils are largely

medium to fine textured and generally with high ratio of silt, loam, clay and contain equitable

lime-magnesium ratio and low amounts of sodium carbonate (Almubarak, 1975) The soils of

Chapter 06 4 of 54


riverine tract are sand, slit loam and silty clay in

general are very fertile and the topography of the

riverine belt is flat but uneven due to annual silt

deposition.

In the project area, two types of soil

characteristics can easily be observed i.e.

camborthids and salorthids. Camorthids soil has

more than 15 percent calcium carbonate mostly as

silt size fraction. As there is no strong zone of

lime accumulation, the root zone is quite deep.

Such soils have either no profile development or

only a weak structural B horizon. Many parts of

these soils are strongly saline or saline-alkali. Salorthids soil characteristic found in

indogengatic plain largely are manmade as a result of the application of excessive amount of

irrigation water on a plain which is nearly flat and ground water drainage is slow. The salinity

of river water is low but ground water is quite saline.

The microenvironment of the study area encompasses a flat terrestrial land consist of

agriculture holdings, natural vegetation, River Indus and Southern deltaic region of River Indus

containing number of creeks. Indus delta is assessed to be the seventh largest delta in the world.

The coastal talukas of Sindh is rich in natural resources having diverse and productive habitats,

ecosystems and natural resources. These include forests (riverine and irrigated), variety of fish,

wildlife, agriculture and livestock and a wetlands complex. The area was covered with

agriculture land and some thick patches of riverine forest in north south portion of the project

area. While fruit/crops farming and fishing formed a major part of coastal livelihoods. Wood

cutting and forest products enabled households to meet timber & fuel needs as well as

supplement their incomes. Livestock ownership was an additional resource for supplementing

household consumption and as a key coping mechanism during economic crises and disasters.

Soil samples were collected at different locations of project site. 26 parameters were analyzed to

determine soil quality of the project area. Soil analysis results are given in below Table.6.1

Table.6.1. Soil Analysis Results

S.No Parameters Method Unit LDl

Test Results

S2

(Thatta)

S1

(Sujawal)

01 pH Based on ASTM D

4972-B - - 07.65 08.31

02 Electrical Conductivity 1S0-11265:1994 µS/cm - 12630.00 36100.00

03 Total soluble Salts Calculated (Based

on1S0-11265:1994) mg/kg - 41679.00 118965.00

Chapter 06 5 of 54


04 Sodium adsorption Ratio

(SAR) calculated - - 04.90 25.11

05 Sulfate In house

Gravimetric mg/kg 50.00 576.10 25492.43

06 Chloride (Cl) (Water

soluble)

Based On APHA

4500Cl-B mg/kg 01.00 12695.56 32526.89

07 Calcium (Ca) Based on USEPA

3050 B mg/kg 00.50

275000.0

0 32000.00

08 Magnesium(Mg) Based on USEPA

3050 B mg/kg 00.50 5500.00 16200.00

09 Phosphorous, Total Based on USEPA

3050 B mg/kg 01.00 114.25 518.90

10 Potassium Total Based on USEPA

3050 B mg/kg 00.50 2550.00 5400.00

11 Nitrogen, Nitrite(Water

soluble)

In house

colorimetric mg/kg 01.00 02.48 56.80

12 Nitrogen, Ammonia APHA 4500 NH3

B&C mg/kg 01.00 736.84 902.63

13 Nitrogen, Total

Kjeldahl(TKN)

Based on APHA-

4500Norg B mg/kg 01.00 921.05 994.74

14 Boron USEPA 3050B mg/kg 00.50 56.05 82.40

15 Manganese USEPA 3050B mg/kg 00.50 179.60 339.80

16 Molybdenum (Mo) USEPA 3050 B mg/kg 00.50 <00.50 08.40

17 Zinc(Zn) USEPA 3050B mg/kg 00.50 01.75 38.00

18 Arsenic (As) USEPA 3050B mg/kg 00.50 <00.50 <00.50

19 Cadmium(Cd) USEPA 3050B mg/kg 00.50 <00.50 <00.50

20 Chromium(Cr) USEPA 3050B mg/kg 00.50 11.45 19.20

21 Lead USEPA 3050B mg/kg 00.50 07.85 08.00

22 Mercury (Hg) USEPA 7471B mg/kg 0.050 30.08 44.44

23 Selenium (Se) USEPA 3050B mg/kg 00.50 <00.50 <00.50

24 Oil & Grease In house

Gravimetric mg/kg 10.00 <10.00 <10.00

25 Phenols, Total In house

colorimetric mg/kg 01.00 <01.00 <01.00

26 Nitrogen, Nitrate (Water

soluble)

In house Uv

spectrophotometri

c

mg/kg 01.00 45.52 438.89

Soil quality monitoring of MPCL project area was conducted in accordance with standard

procedures and protocols at 2 sites of the project to determine the extent of its naturally derived

Chapter 06 6 of 54


essential components and assess any suspected pollution caused by anthropogenic activities.

Details of these samples are depicted below:

• Fertile land ( Thatta S-2)

• Barren Land (Sujawal S-1)

Soil constitutes a vital environmental matrix and it is a significant part of baseline

environmental studies. Physically soil is composed of fundamental mineral induced particles

referred to as Clay, Silt, Silica and Gravel; whereas chemically it is composed essentially of air,

water, mineral matter and some organic matter. Diverse distributions of fundamental particles

in soil determine the soil character. Soil is highly amenable to contamination of various types

and degrees caused primarily by anthropogenic activities; whereas natural contaminations are

from rare to none.

Soil invariably consisting of diversity layers or Horizons in which the topmost layer also

referred to as “A Horizon” is significantly affected. Soil pollution is occurred when the

productive layer of soil is contaminated by the human induced chemicals which results in

altering the natural properties and productivity of the soil. This can severely affect the flora and

fauna on the earth cover, groundwater regimes and including the human health.

Criteria monitoring parameters including pH, electrical conductivity, sodium adsorption ratio

(SAR) ,total soluble salts, Phosphorous, Nitrogen Compounds, Potassium, Calcium (Ca),

Magnesium (Mg), Chloride, Sulphate and pollutant parameters including Oil & Grease,

Phenols, heavy metals including Boron , Chromium (Cr), Manganese (Mn), Molybdenum (Mo),

Zinc(Zn), Arsenic (As), Cadmium (Cd), Mercury (Hg), Lead (Pb) and Selenium (Se) were

monitored to determine the magnitude of these components at project sites.

Analysis pattern of these samples indicates its pH was lowest recorded 7.65 at Thatta (S2) and it

was highest recorded at 8.31 at Sujawal (S1) site of the project. pH primarily determines acidic

or caustic behaviour of soil on which all terrestrial life including human, aquatic biota soil

productivity & fertility depends on. It is found within reasonable limits that range from 6 to 7.5

as a productive soil character guideline. The diverse pH ranges and its general characters are

depicted below:

• pH of: 5.5 and less = Strongly Acidic

• pH of 5.5 - 5.9 = Medium Acidic

• pH of 6.0 – 6.4 = Slightly Acidic

• pH of 6.5 – 6.9 = Very Slightly Acidic

• pH of 7.0 = Neutral

• pH of 7.1 – 7.5 = Very Slightly Alkaline

• pH of 7.6 – 8.0 = Slightly Alkaline

• pH more than 8.0 = Very Alkaline

Chapter 06 7 of 54


Elevated pH figures from neutrality of pH=7.00 do not support general plant growth and life;

although, there are some classes of vegetation which even grow and propagate at extremes of

pH.

Physical tests on E. Conductivity indicate that all the samples consisting viable amount of

soluble salts that are mainly derived from widespread distribution of alkali and alkaline earth

materials include Na, K, Ca, Mg, Chlorides and Sulfates etc. These are regarded as vital and

major nutrients for soil...The total soluble salt contents were found increasingly high at both the

locations of the project with recorded value of 118965mg/kg at Thatta (S2) and 41679mg/kg at

Sujawal (S1).

Soil invariably is heterogeneous mixture of air, water, mineral matter and some organic matter

in which air is penetrated deep to a considerable depth and constituting about 35% of the total

chemical mixture. Above earth cover, dead and waste vegetation and animals remains

contribute substantial part of organic matter to the soil ecosystem which later on converted to

soluble nitrate through series of chemical and bio-chemical reactions; and hence increase the

soil fertility.

Amounts of Phosphorous, Nitrogen Compounds and Potassium were determined to assess its

fertility character. Analyses figures of these components depicted as under:

• Total Phosphorous Min 114 ppm, Max 518 ppm

• Nitrogen, TKN Min 921 ppm, Max 994 ppm

• Nitrogen Ammonia Min 736 ppm, Max 902 ppm

• Nitrogen Nitrite Min 2.48 ppm, Max 56 ppm

• Nitrogen Nitrate Min 45 ppm, Max 438 ppm

• Potassium Min 2550 ppm, Max 5400 ppm

Minimum nutrient figures were found in fertile land of Thatta district; whereas highest figures

were recorded in Barren land of Sujawal District.

Organic derived pollutants including Oil & Grease and Phenols were found below reporting

limit of 10 & 1.0 mg/kg respectively, posturing no alarm to soil environment.

Oil and greases are regarded significant pollutants in soil ecosystem; that only originates from

anthropogenic activities.

Heavy metals including B, Mn, Mo, and Zn were determined to assess its respective magnitude

because at trace level they contribute micronutrients for soil through biological induced activity;

but at large concentration they behave as obligate contaminants for soil environment.

Respective concentrations of each of these metals are depicted in the above Table 6.1 which

indicates that these metals are recorded at sufficiently low level. Strictly defined toxic heavy

metals including As, Cd, Cr, Hg, Pb and Se were also analyzed to assess its significant impacts

on soil ecosystem. Analyses trend of 3 heavy metals As, Cd, and Se indicates that they were

Chapter 06 8 of 54


found below reporting limit; whereas Hg, Cd were found at some elevated figures and might

cause disregard to the soil ecology of the project site; Chromium was also noticed at lower level

of 11mg/kg and 19mg/kg at Thatta (S2) & Sujawal(S1) respectively.

c) Conclusion:

Both soil samples S1 and S2 indicates the soil of project site is eco-friendly and is found free

from noxious pollutants that can cause any damage to soil cover of the project corridor. Organic

pollutants including Oil & Grease and Phenolic compounds were mostly found at levels below

reporting limit; whereas inorganic pollutants were also registered at such low levels to cause

any sort of environmental disturbance to soil environment of the project site.

6.1.4 CLIMATOLOGY AND METEOROLOGY

Climatically Sindh lies between two monsoons; the Southwest monsoon from the Indian Ocean

and the Northeast or retreating monsoon deflected towards it by the Himalayan Mountains,

and thus escapes the influence of both. The strong Southwest monsoon period prevails from

May to September while the weak northeast monsoon period is restricted to the period between

Decembers to January. The period between the two monsoons is considered to be transitional or

calm period with winds of variable speed and direction. Weather during the inter-monsoon

periods is uncertain and short spells of dust storms, dry weather, or a humid cool breeze may

prevail for short durations.

The average rainfall in Sindh is only 6-7 inch (15-18 cm) per year. The regions scarcity of rainfall

is compensated by the inundation of the Indus twice a year, caused by the spring and summer

melting of Himalayan snow and by rainfall in the monsoon season. These natural patterns have

recently changed somewhat with the construction of dams and barrages on the Indus River.

The climatic conditions of Sindh differ in the upper, middle and lower regions. The project area

falls in lower coastal region. The winding coastline in lower Sindh affects the climate of the area

to some extent. The coastal and deltaic regions are naturally damper, with smaller ranges of

temperature and pressure. The prevailing air currents are the southwest winds in summer and

northeast winds in winter. Rainfall at times is a little lower here than in middle Sindh.

Humidity is the greatest and temperatures are moderate throughout the year. High humidity

causes muggy or oppressive weather in summer and the climate is classified as maritime.

(Sindh State of Environment and Development, IUCN, 2004)

The climate of Thatta and Sujawal district is moderate. The mean maximum and minimum

temperature recorded about 40°C and 25°C respectively. The sea breeze blows for eight months

of the year, from March to October, making the hot weather comparatively cool. As a result

there is an immediate fall in temperature. January is the coldest month. The annual average

rainfall of the district is about 200 mm.

The project area has a tropical climate, in winter there is much more rainfall than summer. The

average annual temperature in project area is 26.4 °C and about 221 mm of precipitation falls

annually. Metrological data of Thatta has been obtained from Pakistan Meteorological

Chapter 06 9 of 54


Department and has been used as a data source of the project area for the following

metrological parameter.

• Mean Monthly Precipitation

• Mean Monthly Maximum Temperature

• Mean Monthly Minimum Temperature

• Mean Monthly Wind Velocity

• Mean Monthly Relative Humidity

a) Rainfall

The annual rain fall in the macro-environment area varies from minimum 0.65 mm in 2013 till

maximum of 415.7 mm rainfall experienced during the year 2010. The monthly amount of rain

fall data recorded at Thatta Metrological Station of Pakistan Metrological Department is

summarized in Table 6.2 whereas annual rainfall data of last six year is presented in Figure 6.1.

The recorded heavy rainfall in the project corridor is during the monsoon season from July to

September.

Table 6.2: Monthly Amount of Precipitation (mm)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual

2008 1.6 11.6 0 0 0 0 58.2 40.2 0 0 0 17.4 129

2009 0 0 0 0 0 10.8 142.4 83.6 41.2 0 0 0 278

2010 0 0 0 0 0 54.4 181.1 130.5 32.1 14.6 3 0 415.7

2011 0 11.8 0 0 0 0 0 170.9 116.4 0 0 0 299.1

2012 2.2 3 0 0 0 0 0 34.2 159.4 0 0 6.8 205.6

2013 0.1 0.1 0.1 0.1 0.2 0.9 2.8 1.13 1 0.1 0 1.3 0.65

Figure 6.1: Annual Rain Fall in Thatta

Chapter 06 10 of 54


b) Temperature

Meteorological data on mean monthly minimum temperature indicates that it was minimum

registered 10.5 °C in the month of January, 2008 whereas it was highest recorded 28.3 °C during

the month of Jun, 2008. In addition mean of monthly minimum temperature was found 23 °C in

January, 2008 while it was recorded maximum at 39.2 °C during the month of May, 2013. Last

six years mean monthly minimum and maximum temperature data is presented in Table 6.3 &

Table 6.4.

The maximum annual temperature was found 34.8 °C in 2013; and it was minimum registered

20.8 °C during the year 2011. Figure 6.2 present the graphical summary of mean annual

minimum & maximum temperature.

Table 6.3: Mean Monthly Minimum Temperature (ºC)


2008 10.5 12.3 20.4 23.6 26.7 28.3 27.4 26.3 26.3 24.3 18.7 15.6 21.7

2009 14.6 16.9 21.2 23.4 26.9 28.1 27.8 27.2 26.2 23.7 18.9 14.7 22.5

2010 12.6 14.5 20.9 23.5 26.6 27.2 27.2 26.6 25.3 23.7 18.5 11.9 21.5

2011 10.7 14.5 19 22.2 26 27.2 26.5 25.2 24.5 21.5 20 12.7 20.8

2012 10.4 11.3 22.5 23.3 26 27 26.9 25.5 24.8 22.5 18.4 12.7 20.9

2013 13 14.3 19 23.6 27 27.6 26.3 43.3 24.3 19.3 12 9.3 21.5

Table 6.4: Mean Monthly Maximum Temperature (ºC)


2008 23 27 35.1 35.6 34.5 36.1 33.7 32.1 34.4 35.5 31.9 25.5 32

2009 25.2 29.5 33.7 36.9 38.1 36.8 34.5 33.5 32.5 35.7 31.4 27.3 32.9

2010 26.1 28.8 35.3 37.1 37.5 35.4 35.2 33.1 34.1 36 31 26.6 33

2011 25 27.6 33 36.3 35.4 35.8 34.7 33.2 32.1 34.3 32.1 26.8 32.2

2012 24.6 26.1 32.7 36 36 35 33.9 32.9 33.1 34.7 32.5 26.9 32

2013 29.2 29.6 35.6 39 39.2 37 34.3 53.3 34.3 34.3 28.6 24.3 34.8

Figure 6.2: Annual Maximum & Minimum Temperature in Thatta

Chapter 06 11 of 54


c) Wind Speed

Mean monthly wind speed trend in the macro environment of project corridor was lowest

recorded at 0.3 knots during the month of November & December; 2009 and it was highest

recorded 15.9 knots during the month of May, 2008. Five years mean monthly wind speed data

is presented in Table 6.5 while Figure 6.3 shows mean annual wind speed.

Table 6.5: Mean Monthly Wind Speed


2008 8 6.3 9.5 13.1 15.9 11.4 13 13.5 11.4 9.2 6.1 7.5 10.4

2009 8.5 0.7 1 1.1 1.1 9.3 1 0.8 0.6 0.4 0.3 0.3 2.1

2010 4.6 5.4 7.5 8.9 12.9 11.1 9 6 4.3 4.3 4.8 3.2 6.8

2011 4.2 4.1 8 8.1 1.5 13.1 10.2 8 2.8 2.8 2.1 2.3 5.6

2012 3.1 3.2 5.1 7 10 10.5 11 7.7 3.9 2.3 1.9 2.6 5.7

2013 9 4.3 8.3 8.3 7.3 6.3 7 5.3 6.6 5.3 2.6 1.3 5.9

Figure 6.3: Mean Annual Wind Speed in Thatta

d) Humidity

The relative humidity in project region varies from 23 to 91 % in morning and afternoon hours

respectively. Relative humidity was lowest registered 40.6% in the month of March, 2013; and it

was highest recorded 91 % during the month of May, July and September 2012. Six years (2008-

2013) mean monthly relative humidity is presented in Tables 6.6.

The maximum annual relative humidity was found 83.4 % in 2012; and it was minimum

registered 58.8 % during the year 2013. Figure 6.4 present the graphical summary of mean

annual relative humidity.

Chapter 06 12 of 54


Table 6.6: Mean Monthly Relative Humidity (%)


2008 67 69 74 80 85 82 80 85 81 82 65 79 77.4

2009 69 75 79 72 84 84 86 88 89 85 70 63 78.7

2010 75 75 83 84 87 87 88 90 86 86 71 75 82.3

2011 74 77 77 78 87 85 84 88 91 81 84 72 81.5

2012 72 63 80 85 91 90 91 89 91 89 86 74 83.4

2013 72 56.3 40.6 47.3 59.6 57.3 62.6 71.7 63.3 60.6 60.6 54.6 58.8

Figure 6.4: Mean Annual Relative Humidity in Thatta during 2008- 2013

6.1.5 WATER RESOURCES

a) Surface Water

Indus is the only river passing through the macroenvironment and microenvironment of the

project site. The total available freshwater flow in the Indus is about 180 billion m3, carrying

with it some 400 million tonnes of silt (Mendel and Qureshi 1993). Over the last 60 years a series

of dams, barrages and irrigation schemes have been built in upstream parts of the River Indus.

It is estimated that up to 60% of the Indus water is used to feed Pakistan’s irrigation networks,

and that the Indus watershed irrigates up to 80% of Pakistan’s farmland (Iftikhar 2002).

Besides Indus, the district Thatta/ Sujawal has numerous water courses which drain from the

hills and are known as Nais. The important Nais in the district is Gagar and Ranpathani.

There are many lakes in the district. The famous are Kalri and Haleji. Kalri is a picturesque lake,

situated about 19 km south of Thatta. It was formed by the combination of two lakes Kinjhar

and Sonehri, and takes its present name from the main canal Kair-Bagha feeder, from which it is

feed at present. This lake acts as a great reservoir for feeding canals of Thatta sub-division.

In the microenvironment, there is a canal coming from river Indus used by local community

residing nearby project area. This sweet water is available about 3-4 km away from the

Chapter 06 13 of 54


community and the dwellers have to travel there in order to procure water as it is the only

available source of water.

In addition to Indus River, the project north eastern & western boundaries have numerous

water courses (channels) which drain the northern hills during monsoon season and are

referred to as Nais .There exists violent water inflow torrents following monsoon precipitation

but it quickly dries up when the rainy season ceases. Most important among them is Nai-Baran

which originates from Kirthar range of heights.

b) Irrigation/Canal System

The Irrigation System of Pakistan is the largest integrated network in the world, serving 42

million acres of cultivated land. In the Sindh province, fertile lands are in the Indus basin,

irrigated through canal system. The system is fed by the waters of Indus River and its

tributaries. Diversion of river waters into off taking canals is made through barrages, which are

gated diversion weirs. The main canals in turn deliver water to branch canals, distributaries and

minors. The watercourses get their share of water through outlets in the irrigated channels.

Proposed project area lies in left and right bank of Indus River in which different canals,

branches and minors were observed during field visit. Major canals in the project area are Darro

Branch, Pinyari. In both branches different water courses distributed water in project area i.e.

Mir Khan Mori, Baygannah Mori, Pir Patho Mori 103, Budho Talpur Minor,Khizar Minor, Mirzo

Mori and Bhagar Mori etc.

c) Wetlands

In project area natural and manmade wetlands exist where rain or flood and irrigated waste

water are stored. These wetlands are commonly called Dhands. Wetlands have different

mechanism to provide shelter to different animals, reptiles, and fish and birds species. During

interview with local community, people said natural wetlands are destroyed due to floods,

mixing of agriculture runoff and manmade fish farm system and storage of water for

agriculture purpose. During field visit different dhands were visited to collect baseline data of

the project area i.e. Kari, Bhabra, Machol, Chach Sakhro, Sumar, Mol, Sovan Waro, Saitari

Dhand.

d) Ground Water

Ground water is available in the project area for domestic and drinking purpose. Ground water

quality varies from one place to another. In villages ground water is mostly saline in nature.

Main sources of recharging ground water are Indus River and irrigation system while ground

water table in the project area varies from 20 ft to 60 ft in depth.

In order to assess the water quality of the project surrounding area, water samples were

collected during site visit. Total of 09 criteria chemical tests were performed to characterize

water quality in terms of its initial baseline. Table 6.7 shows the summary of the water results.

Chapter 06 14 of 54


Table 6.7: Raw Water Analysis

Parameters Methods Units Ldl Test Results

G.W1 G.W2 G.W3 S.W4 S.W5

pH at 25 ° APHA 4500 H+ - - 7.71 7.43 07.37 8.00 7.73

Conductivity,

Electrical APHA 2510 B µS/cm 0.01 2680.00 1640.00 2003.00 1953.00 1010.00

Total Suspended

Solid (TSS) APHA 2540 D mg/L 5.00 7.50 < 5.00 < 5.00 14.00 16.50

Total Dissolved

Solid (TDS) APHA 2540 C mg/L 5.00 1892.0 1124.0 1424.0 1352.0 712.0

Hardness, Total

as CaCo3 APHA 2340 B mg/L 0.05 656.98 431.38 593.35 377.69 173.56

Chloride (Cl) APHA 4500 Cl- B mg/L 5.00 646.16 232.03 301.19 350.22 143.59

Sulphate (So4) APHA 4500 So4 C mg/L 5.00 182.30 157.20 208.22 250.20 5173.23

Iron (Fe) APHA 3120 B mg/L 0.005 0.815 0.376 0.489 8.066 2.824

Manganese (Mn) APHA 3120 B mg/L 0.005 0.171 0.235 0.286 0.170 <0.005

Zinc(Zn) APHA 3120 B mg/L 0.005 0.015 <0.005 <0.005 <0.005 <0.005

GW: Ground Water. SW. Surface Water

Five water samples of varying matrix were collected under standard procedures and protocols

to determine and assess the extent of its natural essential components and any suspected

pollution caused by biological and non-biological contaminants. Details of these samples are

depicted bellow;

• Ground Water: 3 samples

• Surface Water: 2 Samples

Total 12 physiochemical parameters including 3 heavy metal tests were conducted to assess the

sanitary quality of these water resources.

Physical analyses trend on these water resources indicates its pH is lingering minimum at 7.37

and it was highest recorded 8.00 in stagnant water of sample 3; and has shown suspension

interference in sample 1, 3 and 5 respectively; and is found to possess brackish character except

sample 5 of canal water. Its TDS was recorded lowest at 712 in canal water and it was highest

found 1892 mg/l in ground water of sample 1 respectively.

Its total hardness figures were registered lowest at 173 mg/l in canal water of sample 5 and were

highest recorded 656 mg/l in ground water of sample 1 respectively. The recorded figures of

major anions Sulphate & Chloride were found lowest at 143 & 157 mg/l and were highest

Chapter 06 15 of 54


recorded 250 & 646 mg/l respectively in stagnant water & ground waters of sample 3 & 1

respectively; the recorded figures of oil & grease remained below reporting limit of 0.01mg/l in

all 5 samples.

Among heavy metal contaminants, Iron was lowest recorded 0.376mg/l in ground water sample

2 and was highest found at 8.05mg/l in stagnant water sample 3; Manganese was lowest

recorded 0˂.005mg/l in ground water sample 2 and was highest found at 0.286mg/l in ground

water sample 4; and Zinc was lowest recorded 0˂.005mg/l in 4 samples and was highest

registered at 0.015mg/l in ground water sample 1.

e) Conclusion:

Physical and chemical analyses trend on these samples indicate that 4 samples (Samples 1

through 4) possessing mild to mild brackish character, can viably be utilised for drinking

application after mild desalination process including RO or Thermal treatment; whereas canal

water of sample 5 can be inexpensively treated by simple physical treatment including

sedimentation and finally by disinfection, can yield water for drinking applications.

6.1.6 AIR QUALITY

In the absence of acute industrial units and mobile vehicular traffic there is no pollution in the

project corridor. The air quality in the area is generally good, with negligible sources of

pollution like emissions from vehicular traffic which cause smoke and dust emissions with

localized effect.

Ambient air quality monitored at three locations result is given in Table 6.8.

Table. 6.8. Ambient Air Quality Monitoring (8 hour) of Project Area

Parameter CO NO NO2 SOX TSP PM2.5 PM10

NEQS Limit 120 40 80 120 500 35 150

Sujawal City 3.2 7.1 7.4 7.4 345 30 80.5

Mirpur Sakhro 7.9 13.5 13.8 7.9 354 24 125

GhulamUllah 3.4 8.8 9.2 3.4 299 23.7 123

Jati Chowk 2.9 9.6 9.7 3.4 265 22 133

Mir Khan Mori 1.8 9.3 9.6 1.3 480 118 441

6.1.7 NOISE

Elevated noise is viably absent in the project proximities due to acute absence of noise causing

equipments in the project corridors. Generally, significant sources of noise emanation are

triggered by vehicular movement at road side and noise induced by human population which is

assumed falling extremely short. Noise Level monitoring results given in Table.6.9. Figure 6.5

Environmental Monitoring Location Map.

Chapter 06 16 of 54


Table.6.9 Average Noise Monitoring Result Of Project Area

Sample location Noise Level NEQS Limits

dB (Residential Area)

Day time 55. Night time 45

(Silence Area)

Day time 50. Night time 45

Sujawal City 58

Mirpur Sakhro 57

GhulamUllah 61.5

Mir Khan Mori 61

Jati Chowk 59

Chapter 06 17 of 54


Pictorial Presentation of Environmental Monitoring of Project Area

A view of Surface water sampling at Project

Water

A view of ground water sampling at Project

Water

A view of noise monitoring at Study Area A view of ambient monitoring at Study Area

View of ambient air monitoring at `Project Area A view of soil sampling at Study Area

Chapter 06 18 of 54


Figure 6.5. Environmental Monitoring Location Map

Chapter 06 19 of 54


6.2 VULNERABILITY TO NATURAL DISASTER/ CYCLONES & FLOODS

The macroenvironment of the project site i.e. district Thatta and Sujawal is vulnerable to a

number of natural disasters such as frequent cyclones, floods, and droughts. A chronology of

disasters over the last five decades reveals that the area has remained in the grip of an

uninterrupted cycle of disasters in one form or the other. Cyclones, heavy rainfall, droughts

and floods follow each other with short-lived intervals. However, earthquake seems to be a rare

phenomenon proving to be less disastrous in its effects in comparison to other hazards

experienced by the communities at risk. Major disaster history is given in Table 6.10.

There are two hydro-climatic factors which cause occurrences of floods in the Indus River

Basin. The first factor is the melting of snow which accumulates in the mountainous north of

Pakistan during winter. This snow cover starts melting in March-April, and reaches its

maximum in July. Since 1868 the annual maximum snowmelt flows in the Indus River ranges

between 150,000 cusecs and 500,000 cusecs. The second most important factor is the occurrence

of southwest monsoon rain during the summer season, which falls over the whole Indus River

Basin. The two factors are coincident on each other.

The Meteorological Department of Pakistan classifies floods intensity on the basis of water

discharge in rivers. Discharge of water below 200,000 cusecs is categorized as low level flood,

between 200,000 and 400,000 cusec is categorized as medium level flood and between 400,000

and 600,000 cusec is considered as high level flood. Discharges of water over 600,000 cusec is

categorized as exceptional flood. The maximum discharge in the Indus River had been ever

recorded during 100 years of flood history is about 1,100,000 cusecs.

The coastal belt of Thatta district is 107 km in which, Tehsils Jati, Kharochhan, Keti bander,

Shahbander, Ghorabari and Sakro were affected during the Cyclone of 1999. The cyclone which

was travelling at about 120 miles per hour was very severe and caused huge losses to life and

property. The worst affected tehsils of district Thatta were Tehsil Jati, Shah Bunder, Keti

Bunder and Kharochan.

Due to its geographical position, the district Thatta Indus has been subjected to sea intrusion,

cyclones, worst rain and river floods. Being in the tail and having large (Kohistan) areas, it has

also gone through painful sufferings of drought due to meagre rainfalls and shortage of water.

Cyclones in the Arabian Sea are mostly from May till June and then from September till

October, monsoon season plays a vital role for the formation of cyclone in this basin. Tropical

storms that hit Pakistan are mostly remnants by the time reach Pakistan or make landfall in

south eastern Sindh which constitute the deltaic region and is not very much populated and

rarely move towards the Balochistan coast.

Each year before the onset of monsoon that is 15 April to 15 July and also after its withdrawal

that is 15 September to 15 December, there is always a distinct possibility of the cyclonic storm

to develop in the north Arabian Sea. There is a 98 per cent chance of cyclones to turn towards

the Indian state of Gujarat, one per cent chance of moving towards the Gulf and one per cent

Chapter 06 20 of 54


chance of moving towards the Pakistani coast (Pakistan Weather Portal). List of wettest

cyclones/ depressions in the coastal areas of Pakistan is presented in Table 6.11. Cyclones that

effect Sindh and Pakistan lose much of their intensity by the time they reach country’s coastline.

Following are the deadliest cyclones in Pakistan’s history; these cyclones caused fatalities

greater than 100.

a) Indus Valley Cyclone 1964

It made landfall in Tharparkar and Hyderabad district in Sindh province on 12 June. However

it caused a great loss of life and property in the province. It killed 450 people and left some

400,000 people homeless.

b) Karachi Cyclone 1965

Not much is known about this cyclone but it was the deadliest tropical storm in the history of

Pakistan as it caused 10,000 casualties in Karachi on 15 December.

c) Pak-Indo Cyclone 1993

In 1993, a category 1 hurricane weakened over the sea near Sindh-Gujarat border due to high

wind shear. However it caused massive rainfall and flooding in Karachi but Thatta and Badin

districts of Sindh were the worst affected where the cyclone killed 609 people and displaced

some 200,000 others.

d) Cyclone 2A 1999

This cyclone was the strongest and most intense cyclone in the history of Pakistan. It was a

category 3 hurricane and killed 6200 people in the country and made landfall in Shah Bandar

(district Thatta) at peak intensity on 20 May near Karachi city in Sindh province.

e) Cyclone Yemyin

It killed 200 people alone in Karachi city on 23 June due to heavy rainfall and intense

windstorms of 70 mph. It made landfall near the towns of Ormara and Pasni in the Balochistan

province on 26 June where it killed 300 people. Overall it killed 730 people and affected the

lives of 2 million people in Pakistan making it the third deadliest cyclone in the history of the

country.

Table 6.10: Major Disaster History

Type of Disaster Year Severity Areas Most Effected (Tehsils)

Cyclone 1964 Medium Keti Bandar, Shah Bandar, Karochan

Heavy Rainfall 1973 High Whole district

Flood 1976 Medium Thatta, Sujawal, Karochan, Shah Bandar, Jati

Heavy Rainfall 1994 High Whole district

Cyclone A2 1999 High Keti Bandar, Shah Bandar, Karochan, Jati

Chapter 06 21 of 54


Earth Quake 2001 Low Thatta, Sakro, Keti Bandar, Karochan,

Flood 2003 Medium Whole district

Tsunami 2005 High Keti Bandar, Shah Bandar, Karochan, Jati

Drought 20015 Low Thatta

Table 6.11: List of Wettest Cyclones/ Depressions in the Coastal Areas of Pakistan

Precipitation

Storm Name Measurement Station Rank (mm) (in)

1 370 14.57 Cyclone Phet 2010 Gwadar

2 285 11.22 Cyclone 2A 1999 Shah Bandar

3 245 9.64 Depression 2009 Karachi

4 191 7.51 Deep depression 2007 Karachi

5 145 5.71 Cyclone Onil 2004 Thatta

6 110 3.94 Cyclone Yemyin 2007 Karachi

7 43 1.69 Deep depression(2007) Karachi

8 18 0.70 Depression(2009) Karachi

Chapter 06 22 of 54


Pictorial Presentation of Physical Environment of the Project Area

A view of soil characteristic of Project Area

A view of dhand (stagnant water) at Project Area

A view of metallic road at Study Area View of Bacho Band near Dum Dama Stop

Canal within `Project Area Agriculture Field within `Project Area

Chapter 06 23 of 54


6.3 BIOLOGICAL ENVIRONMENT

The project area (PA) falls in Thatta and Sujawal Districts. A number of reserve forests and

wildlife protected areas are located in the PA.

6.3.1 METHODOLOGY

The field surveys were undertaken in October, 2014 and data were collected on project area’s

biodiversity (fauna and flora) from both primary and secondary sources. The sampling was

done in the entire area ensuring that the representative locations were sampled from each

habitat and the maximum possible number of species belonging to each habitat was recorded.

Secondary data were collected through information obtained from the local communities. Some

information was also available about the fauna of the area collected during various faunal

studies conducted previously in the area.

The vegetation surveys were carried out by laying 20’ x 20’ quadrates within the study area to

determine the plant communities of various habitats. .

Standard direct and indirect methods were applied to record the occurrence, distribution, and

status of the species in the area which included Line Transect Method, Point Count Method,

roadside counts and track/sign counts.

6.3.2 ECOLOGY OF MICROENVIRONMENT OF the PROJECT AREA

The project area was visited with a team of

experts in collaboration with the technical

team of Sindh Wildlife and Sindh Forest

department. The team witnessed a number of

species of avifauna, animal foot print,

dropping and other associated flora growing

in different portion of Sujawal Block. The

block has been occupied by agricultural

settlements comprising of sugarcane, cotton,

wheat, tomato, banana plantations, poultry

farms and also growing seasonal vegetables.

Main habitats of above mentioned floral and

faunal species are discussed as under.

a) Habitats

Main habitats within the project area include:

• Agricultural fields and settlements.

• Waterlogged marshy area and fish farms.

• Barren /Fallow land/ Waste land.

Chapter 06 24 of 54


Description of these habitats along with the flora and fauna attributes is as follows:

b) Agricultural fields and Settlements

This habitat is occupied by those species which have adapted to survive in altered habitats, i.e.

farmlands and human settlements.

The macroenvironment along the North East and North West part of the project area is

occupied, mainly by agricultural fields and human settlements. The agricultural grounds are

spread over both sides of the road leading to major and minor settlements in the area. Mirpur

Sakhro Game Reserve area has been degraded and now it does not support Grey Partridges or

water birds habitat.

Canal system is well developed in the project area for irrigation purposes. These canals are

important in being host to freshwater turtles, lessymys punctate or commonly known as soft

shelled turtle is common in the area and is often seen crossing the roads. They are an important

component of the food chain of the ecosystem and are categorized as indicator species.

In reptiles’ species, turtles have been observed on road side. Although the habitat is least

favourable for wildlife but species associated with human settlement can be seen in the area.

Grey partridges, long tailed grass warbler, little are seen or heard very close to agricultural

fields and villages and often can be sighted at roadside in the evening. Bank myna and

Common myna were seen in abundance in addition to house crow and sparrows. Indian roller,

Black Drongo, Collared dove and little brown dove were commonly seen roosting on power

lines and trees close to human habitations. In areas where there were bees, the little bee eater

was also present.

Asiatic jackal and foxes live a nocturnal life and comes out from their habitat during night for

predation on domestic fowl. Wild boar is considered an agricultural pest and visits the

agriculture areas during night while diurnal activities are limited to being hidden in thickets

like Typha or sugarcane crops during the day.

Rodents are also common in these areas as they get shelter in warehouses and other

unoccupied structures. The commonly found rodent in the households, warehouses is the

musculas, commonly known as domestic mouse. Rodent activity varies with the habitat type

e.g. in agricultural area. Indian Gerbil or Indian Desert Gerbil dominate and often observed at

night in the project area as well, however their populations usually dislocate and relocate with

the ongoing cultivation in the agricultural fields. In addition to natural flora , which were

noticed in un-disturbed area like graveyards etc. anthropocor plant species (trees) introduced

by the farmers for their use in daily life were also observed along irrigation channels and

agricultural fields. Common species of this habitat include Calotropis procera, Capparis

decidua, Prosopis juliflora and Tamarix Indica.

Chapter 06 25 of 54


c) Waterlogged marshy Areas (dhands) And Fish Farms

The project site is waterlogged and

flood plain area with different small

and large stagnant water pond

(dhands). Fish farms were also seen

during field visit. These wetland and

marshy areas have ecological

importance to provide shelter to birds

and reptiles species. Rain water and

agriculture waste water are the major

source to maintain the wetland

ecosystem. Artificial fish farm business

is also rapidly increasing in the project

area for alternate income source as a

result of natural wetlands degraded in

the project area.

The macroenvironment of the study area encompasses of a flat terrestrial land consist of

agriculture holdings; natural vegetation, River Indus and southern deltaic region of River Indus

containing number of creeks. Indus delta is assessed to be the seventh largest delta in the

world. Indus delta presently comprises of 18 major creeks, namely Korangi, Phitti, Waddi -

khuddi, Khai, Paitiani, Dabbo, Chann, Hajamro, Turshian, Khobar / Jhangi River (present

mouth of Indus), Qalandri, Gahbbar, Khar, Kharak, Pakhar, Kajhar, Sir / Seer and Kori; and

numerous minor creeks, mudflats, sandy areas and tidal zones that are lined with dense to

sparse mangroves. In microenvironment Mirpur Sakhro comes under delta region in which

Paitiani and Gharo creek exist. But due to sea direction change or low fresh water flow and

drought, Delta was arged to maintain healthy natural ecosystem. Reduction in fresh water flow

has had tangible impacts on mangrove ecology on fish population that rely on them for

breeding and habitat. A large population of fish and crustaceans spend at least part of their life

cycle in mangrove or depend on food web originating there (Mendel and Qureshi 1993). In

project area deltic region is used for agriculture and shrimp farming by Sindh Fisheries

Department.

d) Barren/ Fallow land/ Waste Land

In Sindh fresh water resources are used both for domestic and agriculture purposes. Water

resources are constantly depleting and crops yield suffer a lot due to steady increase in soil

salinity. Most of the area falls in this category due to lack of water. Such areas are overgrown

with mesquites, prosopis juliflora.

View of Dhand at Mirpur Sakhro

Chapter 06 26 of 54


6.3.3 PROTECTED AREAS

The protected areas in the PA include: Gullel Khori (WS), Marho Kotri (WS), and Deh Khalifa

(GR) in Ghorabari Tehsil, Mirpur Sakro (GR), and Khadi Forest (WS) in Mirpur Bathoro Tehsil.

Table 6.12 shows protected area covered by the proposed project.

Table: 6.12 Protected Area covered by the proposed project

Protected Area Area (km2) IUCN Category

Marho Kotri 810 IV

Cut Munarki Chach 3 UA

Mirpur Sakro 10 IV

Total 823

The project area is located on the eastern and western

side of the River Indus. There are a number of Reserve

Forests in the area including Gharko, Ali Bahar, Chhach,

Kathor, Hazari, Panhwar, Hayat, Cut Munarki and

Sadnani. The Central Asian Flyway (CAF) passes over the

Indus to the Rann of Kutch which has now become the

principal wintering ground for a significant number of

water birds.

Current Status

Although this biodiversity has been heavily degraded, and more than 85 percent of the habitat

has been destroyed, there are still several patches of ecological habitat where the natural

environment is undisturbed. The area has three protected zones that cover about 820 square

kilometres (km2), or sixteen percent of the ecoregion (table 6.12), but even these protected zones

are degraded.

6.3.4 FLORA

The area is characterized by low rainfall, high summer temperatures, high velocity winds, poor

soil and low diversity of plant species. This type of climatic conditions hardly supports any

appreciable vegetation. Hence, the vegetation is sparse and mainly consists of stunted or thorny

shrubs and perennial herbs capable to sustain harsh climatic conditions in both summer and

winter seasons. Ephemeral vegetation appears during rainy season, completing their life cycle

before summer approaches. Plant communities in the project area are also faced the threats of

livestock grazing and wood cutting for fuel.

View of riverine forest

Chapter 06 27 of 54


The vegetation of this area is greatly influenced

by monsoon rains (during July-September).

Most of the ephemerals grow in this period and

complete their life cycle in short time.

However, the vegetation close to seasonal

water bodies persist for longer period and

some survive throughout the year.

In general the native vegetation of the project

area is xerophytic, sparse and of low economic

value. The primary natural influence on the

vegetation is the low rainfall. Mostly the

rainfall is confined to the summer monsoon

period and is also scanty and meagre. Due to

climatic factors most species complete their life

cycle during the rainy season. Most species of

shrubs also flower and set seeds during the

same period. Plants shed their leaves in winter

and remain leafless during most of the year.

Most shrubs are in dome shaped structures to

reduce water losses and maintain a relatively

low temperature inside the domes.

The project area is located on the eastern and

western side of the Indus River. There are a

number of reserve forests and one major forest

type that falls within the study area is riverine forest along the river Indus banks. Total reserve

forest area falls in the project area is approximately 570.23 km2. Major species of riverine forest

are Babul or Kiker (Acacia nilotica), Kandi (Prosopis cineraria) Bahun (Prosopis euphartica) and

Lai (Tamarix Spp.) Acacia nilotica is the most common specie in the project area. The decline of

outback flows capable of flooding significant area of forest, following the construction of

various major storage and water diversion structures on the river is significant. Before the

regulation of river, outback flow could be expected on an average of 8 in 10 years, whereas now

it only occurs on an average of 4 in 10 years. The young Acacia seeding are now less able to

develop their substantial taproots that enable them to exploit the sub surface moisture and

survive the prolonged periods of no inundation. Acacia nilotica is now being replaced by the

deeper rooted and faster growing Prosopis Spp. However these species do not produce good

quality of timber as compared to A. nilotica but are mainly exploited as a source of firewood

since they coppice well.

The degradation of riverine forests has accelerated mainly due to ever increasing population.

Although all the components of riverine ecosystem have been affected due to population

View of exotic plant species of the

project area

View of Populated and Agriculture

land at Project Area

Chapter 06 28 of 54


pressure, the trees are badly affected. Since the requirement of domestic fuel wood as well as

livelihood needs is met from indiscriminate tree cutting, the entire ecosystem has been

disturbed. People have also encroached upon forestland for agriculture purposes. The study

reveals that more than 40,000 ha of riverine forests of Sindh have been encroached. The impact

of this action has emerged in the form of overall degradation of the riverine ecosystem by

destruction of wildlife habitat, disappearance of associated fauna and flora, reduction in gene

pool, degradation of soil; change of micro climate and over all environment of the region. This

has resulted in reducing the vertical and horizontal structures of riverine ecosystem.

Riverine forests were used to be the major source of livestock grazing. The Babul pods and

leaves are nutritious and favourable fodder particularly for goat and sheep. Besides, abundant

grasses, wild herbs, shrubs, etc. growing after floods and rainfall are source of fodder for the

livestock and wild animals.

Another setback received by the forestry resource, was that of changing polices regarding

leases for agricultural purposes in the forest areas. There has been pressure from influential

people for cultivation of agricultural crops on much relaxed terms during the last two decades.

There have been many changes in the government policies on forest leases for cultivation

dictated by the influential persons. Riverine forest areas and List of floral species of project area

are given in Table. 6.13 Forest maps provided by Sindh Forest Department given in

Figure 6.6A to 6.6E

Table: 6.13 List of Forests in Project Area

S/No Name of Riverine Forest Project Area

1 Cut Munarki /Sadnani Thatta

2 Hayat Gaho/ Gullel/ Kathore Ghora Bari

3 Mahro Kotri Ghora Bari

4 Ali baber Sujawal

5 Chach Keti/ Munarki Sujawal

6 Khanani Ghora Bari

7 Marli Ghora Bari

8 Bijura Thatta

9 Phawar Sujawal

10 Khirsar Sujawal

11 Sujrani Sujawal

12 Hazari Sujawal

Chapter 06 29 of 54


Figure 6.6A Khirsar Forest Map

Figure 6.6B Ali Bahar Forest Map

Chapter 06 30 of 54


Figure 6.6C Munarki & Chach Keti Forest Map

Figure 6.6D Surjani Forest Map

Chapter 06 31 of 54


Figure 6.6E Panhwar Forest Map

Table: 6.13 List of floral Species of Project Area

S.# Plant Species Name Local Name Family Name Life Form Life Span

01 Aerva javanica Booh Amaranthaceae Shrub Perennial

02 Xanthium indicum Bhurt Asteraceae Shrub Annual

03 Pluchea lanceolata Phaar Buti Asteraceae Shrub Perennial

04 Launaea procumbens Bhattar Asteraceae Herb Perennial

05 Calotropis procera Ak Asclepiadaceae Shrub Annual

06 Leptadenia pyrotechnica Khip Asclepiadaceae Shrub Perennial

07 Oxystlema esculentum Phuli Asclepiadaceae Climbing shrub Perennial

08 Capparis deciduas Kirar Capparidaceae Shrub Perennial

09 DDipterygium glaucum Phair Capparidaceae Bushy subshrub Perennial

10 Cressa cretica Oin Convolvulaceae Herb Perennial

11 Cusuta chinensis Bepari Cuscutaceae Stem parasite Annual

12 Cyperus arenarius Moniah Gaah Cyperaceae Sedge Perennial

13 Cyperus rotundus Kabah Cyperaceae Sedge Perennial

14 Suaeda fruticosa Lani Chenopodiaceae Sub-shrub Semi-perennial

Chapter 06 32 of 54


15 Albaji maurorum Kandero Fabaceae Sub-Shrub Perennial

16 Crotolaria burbia Chag Fabaceae Sub-shrub Semi-perennial

17 Indigofera argentae Lathio Fabaceae Herb Annual

18 TTephrosia falciformis - Fabaceae Herb Annual

19 Acacia jacquemontii Banwar Mimosaceae Shrub Perennial

20 Acacia nilotica Sindhi babur Mimosaceae Tree Perennial

21 Prosopis juliflora Devi Mimosaceae Shrub Perennial

22 Eucalyptus spp. - Myrtaceae Tree Perennial

23 Boerbavia procumbens Dakhri/Sana

wari Nyctaginaceae Herb Annual

24 Cynodon dactylon Chhabar Poaceae Grass Perennial

25 Cymbopogon

jawarancusa Kattan Poaceae Grass Annual

26 Desmostachya

bipinnata Drabh Poaceae Grass Perennial

27 Panicum turgidum Sewan Poaceae Grass Perennial

28 Pbragmites karka Nar/Naro Poaceae Grass Perennial

29 Saccharum bengalense Booro Poaceae Grass Perennial

30 Lasiurus sindicus Booro Poaceae Grass Perennial

31 Aristida Funiculata Lumb Gah Poaceae Grass Annual

32 Calligonum

polygonoides Phog Plogonaceae Shrub Perennial

33 Zizyphus nummularia Jhangoori Ber Rhamnaceae Shrub Perennial

34 Salvadora oleoides Khabbar Saolvadoraceae Tree Perennial

35 Datura metel Charyo

Dhatooro Solanaceae Herb Perennial

36 Solanum nigrum Kanwal Buti Solanaceae Herb Annual

37 Solanum surattense Kanderi Wal Solanaceae Sub-shrub Annual

38 Withania somnifera Akri Solanaceae Shrub Perennial

39 Tamarix aphylla Lao Tamaricaceae Tree Perennial

40 Tamarix indica Lai Tamaricaceae Shrub Perennial

41 Typha elehantina Pan Typhacea Shrub Perennial

Chapter 06 33 of 54


6.3.5 FAUNA

a) Mammals

Status of large mammals especially ungulates

and carnivores has declined over the past three

decades during which the area had to face

sub-critical situations resulting from increase in

human and livestock population, habitat

deterioration, hunting and man-made

interventions in the name of development. The

population of small mammals has, however,

remained abundant in the area.

The field survey was undertaken at the onset of

the migratory season, hence majority of the

species of birds recorded comprised of resident

species. Most of the birds were localized near to

the well-watered areas and agriculture fields.

The common and widespread species of birds

included:

Common Myna, Bank Myna, Common Kite,

House Crow, House Sparrow, White-cheeked

Bulbul, Ring Dove and Little Brown Dove.

Reptiles are quite few in the project area. Only

Common Tree Lizard, Brilliant Agama, Blue tail

Sand Lizard and House Gecko are common.

Indian Spiny-tailed Lizard and Monitors are less

common. Black Cobra and Saw-scaled Viper are

frequent.

During field visit, 18 mammals, 41 birds and 14

reptile’s species were reported/ observed in

project area. Most of the mammals observed in

the macroenvironment are common in nature and have survived despite being close to human

presence. The number of Indian desert cat recorded is comparatively rare. The list of mammal

species reported/ observed during site visit of project area is presented in Table 6.14. A brief

description of few mammal species observed in the project area is given below.

Jungle Cat

Indian Bush Rat

Indian Jackal

Chapter 06 34 of 54


Table: 6.14: List of Mammals

a) A

s

i

a

t

i

c

J

a

c

k

a

l

b) The Asiatic Jackal

Asiatic Jackal (Canis aureus) is a common species distributed throughout Pakistan (Roberts,

1997). It is listed as Low Risk on the IUCN Red List and is included in Appendix III of CITES. It

is well adapted to dry, open country and particularly frequents rural villages and smaller

towns where food wastes and garbage are attractants to them (Roberts, 1997). Bulk of their food

comprises rodents (principally gerbils and jirds) and reptiles supplemented by insects and

refuse (Schaller, 1977). They normally hunt singly, but are social in habits and invariably call to

each other as they emerge in the evening.

The Jackals are hunted for their fur; they are trapped and killed for game by local hunters. The

Jackals are not welcome in settlements and are met with violence. The red list data shows that

S.# Order Family Scientific name Common Name

01 Insectivora Erinaceidae Hemiechinus collaris Longeared or Desert

Hedgehog

02 Carnivora Canidae Canis aureus Indian Jackal

03 Carnivora Canidae Vulpes vulpes Desert Fox

04 Carnivora Canidae Vulpes bengalensis Indian Fox

05 Carnivora Herpestidae Herpestes edwardsi Common Mongoose

06 Carnivora Herpestidae Herpestes javanicus Small Indian Mongoose

07 Carnivora Felidae Felis silvestris Desert Cat

08 Artiodactyla Suidae Sus scrofa Indian Wild Boar

09 Lagomorpha Leporidae Lepus nigricollis Indian Hare

10 Rodentia Sciuridae Funambulus pennant Five Striped Palm Squirrel

11 Rodentia Hystricidae Hystrix indica Indian Crested Porcupine

12 Rodentia Muridae Rattus rattus Roof Rat

13 Rodentia Muridae Mus musculus House Mouse

14 Rodentia Muridae Mus booduga Little Indian Filed Mouse

15 Rodentia Muridae Golunda ellioti Indian Bush Rat

16 Rodentia Muridae Nesokia indica Short-Tailed Mole Rat

17 Rodentia Muridae Tatera indica Indian Gerbil

18 Rodentia Muridae Meriones hurrianae Indian Desert Gerbil

Chapter 06 35 of 54


the status is least concerned. Foot prints and scats were observed during the survey while

direct sightings were also recorded.

c) Common Red Fox

The Common red fox (Vulpes vulpes) widely distributed throughout Pakistan is found in any

type of open country (Schaller, 1977; Roberts, 1997). This specie lives singly and is not social in

its hunting habits (Roberts, 1997). They are largely nocturnal and feed on hares, rodents,

reptiles and occasionally on small birds, insects and fruits (Schaller, 1977; Roberts, 1997). They

breed only once in a year (Roberts, 1997). They are hunted for their skin and are considered as

Data Deficient in the IUCN Red List and are included in Appendix III of the CITES. The red fox

is a predator and stands at the top of the food chain in this particular habitat and food chain. Its

presence in the area helps to keep the population of rodents in check.

d) Indian desert cat

The Indian desert cat (Felis silvestris) is comparatively rare and local in distribution in Pakistan.

It is however, relatively common in Thatta, Tharparkar, Dadu and Larkana districts of Sindh. It

is adapted to semi-desert regions and areas of barren low hills. It shelters by burrowing and

feeds on rodents, reptiles and insects. Dens are often excavated under bushes growing on

mounds and commonly have three openings. It also takes refuge in Euphorbia when in danger

it hides in this plant. The desert cat is an extremely fast runner and runs up and down the

dunes in seconds. It is smaller than a jungle and fishing cat, almost equivalent to a domestic cat.

It is also on top of the food chain and remains an integral part of the ecosystem for balance

check of populations on which it predates.

The Indian desert cat is included in Appendix II of CITES. During field visit for this Project,

footprints and scats of Indian desert cat were observed from a number of locations.

e) Black napped hare

The Black napped/Indian hare (Lepus nigricollis) is found mostly in croplands, sandy hilly

deserts ascending into low rocky hills and uncultivated tracts of riverine zones with grassy

habitats mostly Sacchrum sp. The black napped hare are hunted by man and they falls prey to

the Jackal and the Fox. The hare is an herbivorous animal and is often found in agricultural

areas where grass species are in abundance. The hare is an important part of the ecosystem as it

feeds on grass and weeds of the area.

f) Indian crested porcupine

The Indian crested porcupine (Hystrix indica) is remarkably adaptable ecologically, and is

found in most parts of Pakistan. It is a serious pest of forests and agricultural crops and is

nocturnal in habit and a very cautious and shy rodent. Its status is least concerned in the IUCN

red list as its population is stable, however it holds significance in the food chain and acts as a

cleaning agent.

Chapter 06 36 of 54


Footprints, droppings and dens of this species were recorded from many locations within the

project area.

g) Small Indian Mongoose

The small Indian Mongoose is very closely related with the Grey Indian Mongoose but can

easily be distinguished by its size. The mongoose has biological importance in the ecosystem as

it predates on snakes and keeps its population under control; however these animals rarely

feed on rats they are still found near agricultural areas and water canals.

h) Birds

The riverine forest and coastal areas are mainly marshy

areas present within the project area. They are famous

for their richness in bird species during winter season.

A number of resident and migratory birds can be found

in the area during the winter migration.

Total of 42 bird species were reported and many of

them were observed during Field visit conducted for

this project. The observations were also recorded and

issues and threats were identified. Most of the resident

and migratory bird’s species are visible during the field

visits.

The microenvironment of the study area includes e

riverine forest, agriculture land, marshy land, canal,

wetlands (dhand) and fish farm. These areas however

have different potentials for staging migratory birds.

Most of the birds in this particular area are found to be

in roosting positions whereas some parts of the lake

birds are utilizing the lagoon for feeding purposes.

Similarly, in areas with dense termite population, Grey

partridges were recorded in greater numbers than in

any other area. Furthermore, the agriculture area

provides food and refuge to species of birds which have

adapted to the human settlements. These include

common and bank myna, doves, black drongo, Indian

roller, and cattle egret.

The common/forest birds of the area are black drongo,

blue rock pigeon, cattle egret, common babbler, jungle

babbler, striated babbler, common moorhen, common

and bank myna, crested lark, desert lark, desert warbler,

great grey shrike, hoopoe, house crow, house sparrow,

Little Egret

Black winged Stilt

Green Bee-eater

Chapter 06 37 of 54


Indian roller, common egret, and pond heron. Resident birds of the area are black and grey

partridges, tawny Eagle, common sandpiper and white breasted kingfisher, Indian robin and

cattle egret, collard and little brown dove, white cheeked and red vented bulbul.

A small number of migrant species of birds was recorded from the area. The following 08

species were recorded: Common Kestrel, Common Sandpiper, Pale Crag Martin, Common

Swallow, Common Chiffchaff, Black Redstart, White Wagtail and Yellow Wagtail. The bird

species observed/reported during site visit in summer are given in Table 6.15.

Table-6.15: List of Birds

S.# Order Family Scientific Name Common Name Status

01 Pelecaniformes Phalacrocoracidae Phalacrocorax niger Little Cormorant R

02 Ciconiiformes Ardeidae Egretta garzetta R

03 Falconiformes Accipitridae Milvus migrans Black Kite R

04 Falconiformes Accipitridae Haliastur Indus Brahminy Kite R

05 Falconiformes Accipitridae Aquila rapax Tawny Eagle R

06 Falconiformes Accipitridae Circus aeruginosus Marsh Harrier WV

07 Falconiformes Falconidae Falco tinnunculus Kestrel R/WV

08 Charadriiformes Charadriidae Vanellus indicus Red Wattled

Lapwing R

09 Charadriiformes Scolopacidae Tringa hypoleucos Common Sandpiper WV

10 Charadriiformes Recurvirostridae Himantopus himantopus R

11 Columbiformes Columbidae Columba livia Blue Rock Pigeon R

12 Columbiformes Columbidae Streptopelia decaocto Ring Dove R

13 Columbiformes Columbidae Streptopelia senegalensis Little Brown or

Senegal Dove R

14 Strigiformes Strigidae Athene brama Northern Spotted

Owlet R

15 Galliformes Phasianidae Francolinus

pondicerianus Grey Partridge R

16 Coraciiformes Alcedinidae Halcyon smyrensis White breasted

Kingfisher R

17 Coraciiformes Meropidae Merops orientalis R

18 Passeriformes Alaudidae Eremopterix nigriceps Blackcrowked

Finch-Lark R

19 Passeriformes Alaudidae Ammomanes deserti Indian Desert Finch-

Lark R

20 Passeriformes Hirundinidae Riparia paludicola Grey throated R

Chapter 06 38 of 54


Indian Sand Martin

21 Passeriformes Hirundinidae Ptyonoprogne fuligula Pale Crag Martin R

22 Passeriformes Hirundinidae Hirundo rustica Common Swallow WV

23 Passeriformes Lanidae Lanius isabellinus Rufous-tailed or

lsabelline Shrike PM

24 Passeriformes Lanidae Lanius vittatus Baybacked Shrike R

25 Passeriformes Dicruridae Dicrurus adsimilis Black Drongo or

King Crow R

26 Passeriformes Sturnidae Acridotheres

ginginianus Bank Myna R

27 Passeriformes Corvidae Corvus splendens Sind House Crow R

28 Passeriformes Pyconotidae Pycnonotus leucogenys White-eared Bulbul R

29 Passeriformes Timaliidae Turdoides caudatus Common Babbler R

30 Passeriformes Timaliidae Turdoides striatus Sind Jungle Babbler R

31 Passeriformes Sylviidae Prinia gracilis

Indian Streaked

Wren-Warbler /

Long tailed Warbler

R

32 Passeriformes Sylviidae Prinia burnesii Long tailed Grass

Warbler R

33 Passeriformes Sylviidae Sylvia communis Commom White

throat M

34 Passeriformes Sylviidae Phylloscopus collybita Chiffchaff WV

35 Passeriformes Turdidae Phoenicurus ochruros Black Redstart WV

36 Passeriformes Turdidae Saxicoloides fulicata Indian Robin R

37 Passeriformes Motacilliidae Motacilla flava Yellow Wagtail PM

38 Passeriformes Motacilliidae Motacilla alba White or Pied

Wagtail WV

39 Passeriformes Nectariniidae Nectarinia asiatica Purple Sunbird R

40 Passeriformes Passeridae Passer domesticus House Sparrow R

41 Passeriformes Passeridae Passer pyrrhonotus Sind Jungle

Sparrow R

42 Passeriformes Estrildidae Lonchura malabarica Common Silverbill R

Chapter 06 39 of 54


i) Threats

All the migratory birds face the problem of security in the area. The habitats have been

degraded to the extreme as forests are converted into agriculture land. The decreased or no

freshwater flow in Indus River leaves the delta, the dhands and the coastline dry when the

birds start to arrive. The ecosystem thrives only during the monsoon rains.

The sugar mills situated in the microenvironment remained closed in the last two years i.e. 2010

and 2011; therefore effluents from industries were low in volume. Industrial pollution is one of

the main reasons that cause degradation of ecosystem for migratory birds. The migratory birds

therefore could not stay on and had to leave much earlier than scheduled.

Mainly due to increased hunting pressure with the advent of birds in the area, coupled with

problems of pollution, their population has declined and soon the wetlands will become

wastelands.

j) Reptiles

Total of 14 reptile species were reported and few of

them were observed in the area during field visit for

the EIA study. The desert area in the

microenvironment provides a favourable habitat for

many reptile species especially the common tree

lizard; common field agama, yellow sand gecko. The

desert monitor inhabits mostly the desert areas

while the Indian monitor was found in areas close to

the irrigation system and water bodies. Riverine

forest provides a habitat for snake, viper and other

reptile species and also noted during field visit. The

important snake species in the project area are

Saw-scaled viper, Indian cobra, these all are highly

poisonous snakes. The non-poisonous snakes

include Eastern diadem snake, and Pakistan ribbon

snake.

Fresh water ponds and canals of project area are

important in being host to freshwater turtles.

Lessymys punctate known as soft shelled turtle is

common in the area and is often seen crossing the

roads. They are an important component of the food

chain of the ecosystem and are categorized as

indicator species. List of reptiles observed/ reported

during the field visit is given in Table 6.16.

Monitor Lizard

Turtle crossing road at Project Area

Chapter 06 40 of 54


Table 6.16 List of Reptiles

S.# Order Family Scientific Name Common Name Status

01 Squamata Agamidae Calotes versicolor C

02 Squamata Agamidae Trapelus agilis Common Field Agama

/ Brilliant Agama L.C

03 Squamata Gekkonidae Crossobamon

orientalis

Yellow-tailed Sand

Gecko L.C

04 Squamata Gekkonidae Hemidactylus

brookii Spotted Barn Gecko C

05 Squamata Gekkonidae Hemidactylus

flaviviridis

Yellow-belly Common

House Gecko

06 Squamata Lacertidae Acanthodactylus

cantoris Blue-tail Sand Lizard C

07 Squamata Scincidae Ophiomorus

tridactylus 3-toed Sand Swimmer C

08 Squamata Uromastycidae Saara hardwickii Spiny-tail Ground

Lizard

09 Squamata Varanidae Varanus

bengalensis Bengal Monitor L.C

10 Squamata Varanidae Varanus griseus C

11 Squamata Colurbridae Ptyas mucosus Rope Snake/ Dhaman

12 Squamata Colurbridae Spalerosophis

arenarius

Red-spotted Diadem

Snake

13 Squamata Elapidae Naja naja Black Cobra L.C

14 Squamata Viperidae Echis carinatus Saw-scaled Viper C

15 Testudines Geoemydidae Geoclemys

hamiltoni) Black spotted turtle VU

16 Testudines Trionychidae Lessymys

punctate soft shelled turtle VU

k) Fish / shrimp Fauna

Fresh water fish’s fauna of Pakistan is represented by a

minimum of 193 fish species. These species belong to

class Actinopterygii Sub class Teleostei, 3 cohorts 6

super orders. 14 orders, 30 families and 86 genera

(Rafique, 2007; Rafqiue and Mian, 2013). The diversity

also includes the exotic species introduced in wild or

fish farming system of Pakistan, 86 species (8 exotic

and 78 indigenous) have been identified as “Species of

special importance” (Table.) on the basis of endemism. Catla Catla

Chapter 06 41 of 54


Among the indigenous species of special importance 43

species have been identified as endemic to Pakistan. Among

the species of special importance in Pakistan at least 31

species are economically important .Major component of

the economically important species belong to warm water

fish fauna are found in the Indus Plain. In project Area most

common species of fresh water fishes are Labeo rohita,

cyprinus Caprio, Ctenopharyngodon idella, Silver crap,

Tilapia nilotica, Catla Catla. Sindh fisheries department has

introduced shrimp farming of P.merguiensis (Banana shrimp) P.indicus, P.vannamei and

P.monodon for economical growth of the area. List of fish and shrimps are given in Table 6.17.

Table: 6.17 List of Fish and Shrimps

Shrimps

S.No Scientific Name Common Name

1 Penaeus indicus Indian white prawn

2 Penaeus merguiensis Banana shrimp

3 Penaeus vannamei Whiteleg shrimp

4 Penaeus monodon Tiger shrimp

Fishes

S.No Seicentific Name Common name

1 Salmophasia punjabensis Punjab razorbelly minnow

2 Barilius Pakistanicus Pakistani baril

3 Labeo caeruleus Blue rahu

4 Labeo nigripinnis Days'labeo

5 Puntius punjabensis Punjab barb

6 Ompok Sindhensis Sindh catfish

7 Tor putitora (Hamilton, 1822) Golden mahasheer

8 Ompok bimaculatus (Bloch, Butter catfish

9 Ompok pabda (Hamilton, Pabdah catfish

10 Wallago attu Freshwater shark

11 Ailia coila (Hamilton Gangetic allia

12 Chitala chitala (Hamilton, Humped featherback

Penaeus indicus

Chapter 06 42 of 54


13 Bagarius bagarius Gangetic goonch

14 Oreochromis mossambicus (Peters, 1852) Mozambique tilapia

15 Cyprinus carpio (Linnaeus, Common carp

16 Tenualosa ilisha (Hamilton, 1822) Hilsa Shad

17 Cirrhinus mrigala (Hamilton, Mrigal

18 Gibelion catla (Hamilton, Calla

19 Labeo dyocheilus pakistanicus Thicklip labeo

20 Labeo calbasu (Hamilton, 1822) Orangefin labeo

21 Labeo gonius Kuria labeo

22 Labeo rohita Rahu

23 Carassius auratus Goldfish

24 Ctenopharyngodon idellus Grass carp

25 Aristichthys nobilis Bighead carp

26 Hypophthalmichthys molitrix Silver carp

27 Rita rita (Hamilton Rita catfish

28 Clupisoma qerue Garua bachcha

29 Channa merulius Great snakehead

30 Mastacembelus armatus Zig-zag eel

31 Danio rerio Zebra fish

32 Megarasbora elonga Bengala barb

33 Schizopygopsis stoliczkai Ladakh snowtrout

34 Triplophysa stoliczkai Stoliczka triplophysaloach

35 Sisor rabdophorus Whiptail Catfish

36 Nandus nandus Gangetic leaf fish

37 8adis badis Chameleon fish

38 Monopterus cuchia Gangetic mud eel

39 Macrognathus aral One-stripe spiny eel

Indus River is known to be second largest delta in the World. It has historic background and

source for the high production of the Arabian Sea due to discharge of sediments brought by

river currents from Tibet, the ultimate origin of Indus. In the historical days the delta was a hub

of fishing, navigation and other activities for major countries along the Arabian Gulf. With the

Chapter 06 43 of 54


establishment and modernization of several dams considerably reduced the size of delta and

simultaneously low sediment discharge in the sea. As reported by NIO scientists zero

discharged is observed during the most part of the year while from June to September fresh

water reached deltaic region quite infrequently. The river thus contributing hardly into the

delta and almost no sediments are brought to the sea and sea water ascends the vast area. The

impact of such conditions (no freshwater and intrusion of sea) are understandable by the loss of

ecological features, loss of agriculture, loss of fisheries economic destruction resulting mass

migration of population.

The matter is difficult to find solution however efforts should be focused towards efficient

development of the water system so that proper fresh water flow is maintained. The biggest

city close to the Keti Bunder is Karachi where growing population is causing extension and

establishment of new ventures that hamper the environment and cause ecological disorder.

Fishing is the major source of livelihood in the region and has been under great pressure which

becomes more devastating by the use of illegal nets that render losses for fish population. These

illegal nets are installed at fixed selected areas of the delta creating ecological imbalance

eventually producing permanent loss of resources.

To control over fishing, there is a need to implement the rules and laws with close surveillance

and monitoring practices. The more effective means would be to develop close coordination

among fishermen, their societies and fisheries managers. Use of illegal nets in any part of creek

should be prohibited by developing strategies relating to awareness among stakeholders.

There is scarcity of knowledge on the biological and ecological status of such significant

ecosystem. Available data is either old or based on inadequate short term sampling efforts

made by agencies. Compliance of environmental standards while conducting any

developmental work is envisage and a close monitoring mechanism is proposed during the

activity period to assess the level of damage and to propose immediate remedy to address the

damage. Biological survey map given in Figure 6.7.

Chapter 06 44 of 54


Figure 6.7. Biological Survey Map

Chapter 06 45 of 54


6.4 SOCIO-ECONOMIC ENVIRONMENT

This chapter provides baseline information and

description of the socio-economic and cultural

environment of the proposed exploration activities

carried out by MPCL in Sujawal block (EL-2467-11).

The Government of Pakistan has granted petroleum

exploration license to MPCL for Sujawal block

covering an area of approximately 2,416 square

kilometer (sq. km). The block lies in Thatta and

Sujawal districts of the Sindh Province.

This section presents information on the project

area’s location, population distribution, socio-economic conditions, and livelihood activities,

state of education and health facilities.

Both primary and secondary data sources were used to develop the socioeconomic baseline of

the area. A detailed socioeconomic survey was also carried out in the project area. The purpose

of this socio-economic survey was to gather first hand information about the generic

characteristics of the nearby communities, their socio-economic status, cultural conditions,

social issues and religious affiliations. It also presents the public consultation outcomes during

the field survey. A detailed description of the socio-economic environment and some major

findings is presented below in this section.

6.4.1 DATA COLLECTION STRATEGY

SGS team along with sociologist carried out the

study of socio-economic and cultural

environment. The approach and methodologies

used during data gathering were interviews, focus

group discussions and participatory rural

appraisal techniques to qualitative data collection.

Socio-economic and cultural data were collected

through semi structured questionnaire and focus

group interviews with all the major stakeholders

including local community members (male and

female) and key informants including district

government officers, village heads, landowners, NGOs and teachers in the project area.

6.5 DESCRIPTION OF THE PROJECT AREA

The project area lies in two districts i.e., Thatta and Sujawal of Sindh province, Pakistan.

Thatta district is situated from 23' 43' to 25' 26' north latitude and 67' 50' to 68' 45' east longitude

with a total geographical area of 10,020 square kilometers. It is located in the southern area,

A Potter at Work

Public Consultation with Locals

Chapter 06 46 of 54


locally called Laar, of province of Sindh,

Pakistan, which is about 98 km (61 mi)

east of Karachi. According to the 1998

census of Pakistan, it had a population of

1,113,194. It is home to a large necropolis

of Makli. Once Thatta served as capital

of Sindh and as a center for Islamic arts.

Since the 14th century four Muslim

dynasties ruled Sindh from Thatta, but in

1739 the capital was moved elsewhere

and Thatta declined. It was believed that

this was the place where Alexander the

Great rested his legions after their long march.

Sujawal district is located at 24°36'23" of North and 68°4'19" of East and is bordered in the

northwest by the Indus River which separates it from Thatta District. The district has an area of

7335 km².

The districts are rich in natural resources having diverse and productive habitats, ecosystems

and natural resources. These include forests (mangroves, riverine and irrigated), variety of fish

and wildlife species, agriculture and livestock and a wetlands complex, having Jabbo lagoon

which is internationally recognised Ramsar site.

The area has enjoyed a rich history and economic opulence in the past but after the upstream

construction of Tarbella Dam in 1977, the coastal ecosystem of Indus delta is under stress from

seawater intrusion and an increase in salinity and water- logging consequently, the cultivation

of field and historical crops like red rice and commercial fish farming has declined drastically.

Potable water has become scarce.

It is also the hazard prone area. It has experienced six natural disasters in recent years; namely ,

a cyclone in 1999, drought in 2000, earthquake in 2001, drought followed by floods in 2003,

Super Flood of 2010 and the flash- floods of 2011. Disaster affected families have never been

appropriately assisted through affective recovery and rehabilitation programs.

6.6 SOCIO-CULTURAL ASPECTS

Administrative Setup: Sujawal block falls in six talukas of district Thatta and newly established

(on 13 October 2013) district Sujawal, namely: Sujawal, Sakro, Jati, Ghorabari, Thatta and

Mirpur Bathoro.

The capital of Thatta district is Thatta and Sujawal of Sujawal district.

Sujawal District is subdivided into four talukas Jaati, Bathoro, Shah Bandar and Sujawal and 30

Union Councils, out of which three talukas are included in our project area. There are two

Provincial Assembly seats Constituency PS-86 and Constituency PS-87 and one National

Assembly seat Constituency NA-238 in newly formed district Sujawal; whereas Thatta district

District Boundary Map

Chapter 06 47 of 54


now have one National Assembly NA-237 seat and three provincial assembly seats PS-84, PS-

85 and PS- 88.

6.6.1 DEMOGRAPHY/COMMUNITY STRUCTURE

The population of Thatta district according to the 1998 Census was 1.113 million i.e., 1113,194

persons, with Urban population of 11 percent (i.e., 124,739 persons) and rural population 89

percent (i.e., 988,455). Current population (2014) of the both the districts is estimated to be 1.6

million (i.e., 1593887 persons). The estimated population density is 92 per sq. km.

The economically active population is 25 percent. A high unemployment rate of 18 percent was

recorded in 1998. Two third of the total employed persons is engaged in primary occupation

namely agriculture, forestry, fishing and hunting.

Minimum household size is four members and the maximum size about 10 members whereas

the average household size in project area is 7 members.

According to the 1998 census of Pakistan, the population of the newly formed districts Sujawal

was 80,000 of which 8.93% lived in urban environments.

6.6.2 ETHNICITY/TRIBES

Sindhi is the most spoken language of the district. People of different castes dwell in the project

area. It includes Shora, Khaskheli, Panhwar, Khuwaja, Baloch, Chandia, Alwani, Otha, Awan,

Lashari, Kalmati, Jokhia, Dul, Sayyed, Jat, Samo, Mallah, Mirbahar, Soho, Rind, Khalifa, Lothya,

Halayo, Burfat, Memon, Shaikh, Nahiyo, Zangiani, Gaho, Sheedi, Palari and Solangi. Majority

are Muslims and Sindhi speaking; while a few non- Muslims specially scheduled castes of

Hindus are also found.

6.6.3 ENERGY SUPPLIES

Most of the visited project villages had electricity for

lighting purposes in households. Solar energy has

been provided mainly through Sindh Coastal

Community Development Project (SCCDP) by

National Rural Support Program (NRSP) to the

selected coastal villages of the area. Wind energy has

also been harnessed in a few villages of the project

area. For cooking purpose, fuel wood is used in most

of the houses.

6.6.4 INFRASTRUCTURE

It was recorded that some villages were connected with blacktop roads while most of the roads

and streets in the villages were katcha. A few streets were brick paved.

Wood use as a fuel in project area

Chapter 06 48 of 54


Most of the housing units are one or two room

houses and are made up of katcha structure. People

of same caste or two castes live together in the

shape of hamlets.

Relatively bigger villages have mosques followed

by graveyards. Eid Gah (for Eid congregation /

prayers) was also found in a few big villages, where

people from other nearby villages were also

reported to be coming for the Eid prayers.

Most of the villages have kiryana or grocery stores. Some of the villages have cabins with beetle

nut, cigarettes and other general supplies. A few villages have small hotels serving tea.

6.6.5 TRANSPORTATION & COMMUNICATION

A higher proportion of households had motor cycle

indicating that the use of motorcycle is increasing as a

fast mode of transport.

There is negligible public transport system. People face

severe issues like unavailability of proper transport

and high cost to access the health faculties in

emergencies. Males and females wait for longer hours

for the transport at main roads or city centers to reach

at their destiny. The taxi motorbikes under government

Rozgar scheme seem overwhelming as a cheap source of transport.

Now- a -days, the mobile network has been increased tremendously. It has improved the

communication.

6.7 COMMUNITY WELL BEING

The most common notion of well being focuses on a desirable mental and physical state for

individual and community.

The primary data on well being parameters were collected through qualitative and quantitative

survey methods. These elements of community well being is described as follows:

• Livelihood;

• Health and education;

• Water (drinking as well as for other uses);

• Gender Equity.

All these parameters have been discussed in subsequent paragraphs individually.

House Infrastructure in project area

View of Market

Chapter 06 49 of 54


6.7.1 LIVELIHOOD

Almost all male members of a household in the project area are involved in full time, part time

and/or casual work in one or the other agricultural activities including livestock for their

livelihood. Although agriculture and livestock still remains the main occupation but it is

insufficient to provide for the livelihood of families, thus necessitating for the village men to

engage in fishing, poultry, wage labor and wood cutting etc. Women are mainly involved in

agriculture, livestock rearing, agricultural wage labor and handicraft.

6.7.2 AGRICULTURE & LIVESTOCK

The main crops produced in Thatta and

Sujawal districts during Rabi are wheat,

barley, gram and oil seeds (mainly

sunflower) and during Kharif are rice,

sugarcane, maize, millet and jowar. The

project area also produces high value

vegetables and some fruits like papaya and

watermelon etc.

Thatta Sugar Mill, Laar Sugar Mill and

Dewan Sugar Mill are the big mills where a

considerable local people are employed as

wage labors. Besides, a few small mills like

rice mills, flour mills, and cotton factory are

also observed in the project area.

The key constraints in coastal agriculture

include shortage of irrigation water, water

logging and salinity, lack of marketing and

storage facilities, lack of tractors and other

farm facilities, lack of improved seed and

chemical fertilizers and of course

unsupportive price policy of the

government.

Along with agriculture, livestock is also the main source of livelihood. The various types of

livestock found in the area including buffaloes, cows, goats, sheep, donkey and camel. Some

villages have the modern poultry and fish farms, owned by landlords or wealthy outsider

people but look after by locals.

6.7.3 FISHING

Marine (coastal) fisheries accounts for about 79 percent of the country's total fish catch. Out of

overall coastal fisheries the contribution of Sindh coast/ Indus Delta is higher than Baluchistan,

despite Sindh coast being smaller (350 kms). The products being caught from this region are

Locals Working in Agriculture Field

Cattles Grassing in Project Area

Chapter 06 50 of 54


sent to Karachi for onwards distribution and consumption. Few of the items are also exported

and are an important source of Pakistan economy. Most of the people who live on agricultural

land in coastal villages cannot be considered to be the full time fishers. Some people in the

project area are also involved in fishing. The fish is the favourite food of the people of project

area.

The production of fisheries has depicted a decreasing trend during the last decade, mainly due

to the sea intrusion and lack of fresh water flow.

There is a great potential of brackish water aquaculture in the project area and surroundings. A

good number of fish farms found in the area.

6.7.4 OTHER OCCUPATIONS:

A vast majority is engaged in agriculture and livestock rearing. Due to increasing level of

unemployment and poverty, the people are also engaged in labor on daily wages. The

industrial base of the area needs to be improved. Some people are working in existing mills and

factories. A few are the government servants. The bazaars of Thatta and Sujawal are known for

hand-printed fabrics, glass bangles and Sindhi embroidery work in laid with tinny mirrors, one

of the more world known handicrafts of Pakistan.

6.7.5 HEALTH

Water borne diseases, fever, Malaria, skin diseases and allergies are the commonly reported

diseases in the project area. According to Health Facility Assessment, District Thatta and

Sujawal 2012, total health facilities in both the districts are 85. These health facilities are

sufficient for only 27% of the estimated 2014 population of the districts. Table 1.5.1 shows the

details of health facilities in the area. Table 6.18 shows list of heath facility in the project area.

Table: 6.18 List of Health Facility

S# Health Facility Number

1 District Head Quarter Hospital ( In Thatta only) 01

2 Taluka Head Quarter Hospital 04

3 Rural Health Centre (RHC) 08

4 Basic Health Centre (BHU) 49

5 Govt. Rural Dispensary/ Clinic 23

6 Maternity Home -

7 MCH Centre -

Source: Situational Analysis report of Thatta- USAID

Chapter 06 51 of 54


There is a dearth of qualified doctors with almost unavailability of lady doctors. It is estimated

that most of the health facilities in rural areas or disaster prone areas are destroyed by last

floods or extreme weather conditions. A particular problem of access to health services is the

unavailability of health facilities with qualified doctors and other medical facilities. Thus,

people rush to the city centers or big cities from villages in case of emergencies which cost very

high. Most of the poor people are indebted due to health emergencies and utilize all their

credits or loans taken by NGOs under microcredit schemes for livelihood for health

emergencies.

6.7.6 EDUCATION

Literacy rate in Thatta district was reported to be

22.14 percent in 1998. There is wider gap not

only in males and females but also in urban and

rural areas. The recent (2013-14) literacy rate for

both the districts is 36 percent, having 48 percent

for males and 23 percent for females. The total

number of schools in both districts is 3217, out of

which most are Government Boys Primary

Schools. Besides, a few private schools run by

Roopali Foundation or TCF schools or one in

Sathiani Shareef by a lady philanthropist or

school of Dewan Sugar Mill are found to be the quality education schools.

The following table shows taluka - wise number of schools in the project area, including GBPS,

GGPS & GBLSS, out of which almost 50 percent are closed due to the absence of teachers:

Table 6.19 shows list of education facility in the project area.

Table 6.19 Show list of education facility

Taluka Schools (Number)

Thatta 642

MirPur Sakro 504

GhoraBari 298

Sujawal 419

Mirpur Bathoro 582

Jati 431

Total 2876

Source: Education Department

View of School in Project Area

Chapter 06 52 of 54


6.7.7 WATER

Each village in the project area uses more than one source of drinking water. Hand pumps,

whether sweet or brackish, are the predominant source of drinking water. Water ponds are also

available in some villages. During Kharif season the nearby canals/ distributaries become the

main source of drinking water for most of the villages. It is generally not available in non-

perennial canals in Rabi season.

Most of the communities buy water tankers for drinking water. It was reported that an amount

of Rs.4000 to Rs.7000 monthly is spent by each household to purchase the drinking water.

6.8 WOMEN STATUS & GENDER EQUITY

Marriages and Gender Based Violence (GBV): The

ratio of early child marriages, unmatched

marriages (having big age difference) and divorce

ratio is negligible in the area. Mostly the females

get married in accordance with the prevailing

tradition whereby their parents made the choice of

pairs. The preference is given to the exchange

marriages.

Occasional domestic violence is faced by women,

mostly the married women by husbands.

Health: There are poor mother and child health care conditions in the area. Mostly the delivery

cases are handled by untrained Traditional Birth Attendants (TBAs) or Dais. Family planning

facilities are missing in the villages of coastal area of the districts. The high infant and maternal

mortalities have been recorded in the project areas i.e., infant mortality rate is 81/1,000 live

births, under 5 mortality rate is 101/1,000 live births and mother mortality ratio 314/100,000 live

births.

Decision Making: Exclusive decision making role of women in matrimonial matters, property

ownership, health issues and out- of - village employment is negligible. For livestock

management, they are free to make suitable decisions at some extent. Social survey map given

in Figure 6.8.

6.9 LOCAL COMMUNITY INSTITUTIONS

There is a considerable number of NGOs working in the area. These organizations have all kind

of interventions ranging from relief and rehabilitation, welfare, social sector, livelihoods

improvement, development of economic infrastructure, provision of microfinance, advocacy

and awareness raising and mobilization. Two main government sponsored NGOs include

National Rural Support Program (NRSP) and the Pakistan Poverty Alleviation Fund (PPAF) are

obvious in the project area. Besides, SCOPE, SPO, SAFWCO, Roopali Foundation (Education),

Local Community of Project Area

Chapter 06 53 of 54


Pakistan Fisherfolk Forum (PFF) for advocacy and a few communities based organizations

found in the area. Socioeconomic matrix is given in Annexure VII.

6.10 ARCHEOLOGICAL SITES

Thatta is famous for its necropolis, which covers

10 km2 (3.9 sq mi) on the Makli Hill, which

assumed its quasi-sacred character during Jam

Nizamu-d Din's rule. The site became closely

interlinked with the lives of the people. Every

year thousands perform pilgrimage to this site to

commemorate the saints buried here. The graves

testify to a period of four centuries when Thatta

was a thriving center of trade, religion and

scholarly pursuits and the capital of Sindh. Many

of the mausoleums and graves are dilapidated;

many are still exquisite architectural examples with fine stone carving and glazed tile

decoration. The town is dominated by the Great Mosque built by the Moghul Emperor

Shahjahan which has been carefully restored to its original condition. Besides, the project area

covers the main architectural site of Pir Patho. Syed Sakhi Jamil Gurnari (died 1244 AD) and the

other one of Shah Hussain Aplani (died 1268 AD) also known as Pir Patho Debali or just Pir

Patho. The latter is considered the patron saint of boatmen, who invoked his blessings as they

set out in the crocodile-infested Indus delta. Interestingly, Hindus too revered him for the same

reasons, but as an incarnation of ‘Raja Gopichand’ - a somebody in their man-god pantheon.

Seventeenth century’s Muhammad bin Qasim’s Mosque and Tower complex is also found

nearby.

There are several other cultural, historic and scenic sites in the project area. Selected list of such

sites is presented under here:

• Pir Ghulam Ali Shah Surkh ( Girnar)

• Dargah of Hazrat Nawaz Shah Jilani

• Hazrat Ibrahim Shah Ghot ( Qudosani Dargah)

• Dargah Hazrat Baba Shah Karim

• Sathiani Sharif

View of Pir Patho Tomb

Chapter 06 54 of 54


Figure 6.8. Social Survey Map

Chapter 07 1 of 17


7. STAKEHOLDER CONSULTATION

Stakeholders are peoples or group of people who are somehow get affected by a project, as well

as those who may have interests in a project and/or the ability to influence its outcome, either

positively or negatively. Stakeholders may include locally affected communities or individuals

and their formal and informal representatives, national or local government authorities,

politicians, religious leaders, civil society organizations and groups with special interest, the

academic community, or other businesses.

The participation of project stakeholders in project planning, designing and implementation is

now universally recognized as an integral part of environmental impact assessment. The Sindh

Environmental Protection Act 2014 (Section 17 (3)) highlights that: “Every review of an

environmental impact assessment shall be carried out with public participation”.

United Nations Conference on Environment and Development (UNCED) in 1992 endorsed the

process of stakeholder participation and consultation as one of the key documents of the

conference-Agenda 21. Agenda 21 is a comprehensive strategy for global action on sustainable

development and deals with issues regarding human interaction with the environment. It

emphasizes the role of public participation in environmental decision-making for the

achievement of sustainable development.

Stakeholder consultation is a continuous process that does not stop with the submission or

approval of the EIA but continues into the project execution stage by involving communities

and all other stakeholders’ values, recognizing the stakeholder’s right to inform about the

project, as well as their right to voice their views and concerns. In keeping with this belief,

consultations were conducted in the project area not only to satisfy the legal requirements of the

EIA process in Pakistan but also to improve and enhance the social and environmental design

of the project.

This section of the report outlines the stakeholder consultation approach adopted for this EIA

study, identifies the concerned groups of stakeholders, and describes the consultation process

carried out as part of this study.

7.1 OBJECTIVE OF STAKEHOLDER CONSULTATION

The overall objectives of the consultation process were as follows:

• To provide information related to proposed project activities to stakeholders;

• To facilitate and maintain dialogue and gain the consent of all stakeholders on carrying out

project activities in the area;

• To seek participation of all interested parties and identify stakeholder interests and issues;

Chapter 07 2 of 17


• To create solutions for addressing these concerns and integrating them into project design,

operations, and management;

• To enhance the project by learning from, and incorporating, the expertise of individuals,

professionals, communities and organizations; and to encourage transparency and

inculcate trust among various stakeholders to promote cooperation and partnership with

the communities, local leadership, and NGOs.

Various steps involved in the consultation process are presented in following sections.

7.2 IDENTIFICATION OF STAKEHOLDERS

The identification of stakeholder is important for the sustainability of a development project.

Stakeholder will be identified as the people who may directly or indirectly affected by the

project activities. This will be helpful in predication and assessment of project impacts at an

early stage; and accordingly appropriate mitigation measures can be suggested. The

stakeholders that are likely to be influenced by the project activities or would like to participate

in the project will include the following:

• Communities in the project or surrounding area;

• Government Departments;

• Non-Governmental Organizations (NGO) and community Based Organizations;

7.3 CLASSIFICATION OF STAKEHOLDERS

Stakeholders can be classified as primary and secondary stakeholders depending on the

influence of the project activities on them. The individuals and organizations that may be

directly affected by project activities have been termed as Primary Stakeholders. The term

secondary stakeholders refer to individuals and organizations that will not be directly affected

by project implementation, but that do have an influence on, or an interest in, the area. Primary

stakeholders were limited to affected persons, local communities and local government

functionaries. The Secondary stakeholders mainly included national as well as international

Non Governmental Organizations (NGOs), government representatives and regulators, and

other such organizations. The public consultation process and the outcomes presented in this

section cover both the primary and secondary stakeholders.

List of stakeholders being identified and consulted is given in Table 7.1.

Table 7.1: List of Stakeholders

S. No. Stakeholder Name Organization Designation

1. Local communities

2. Arif Khatak Government of Sindh Asst. Commissioner Sujawal

3. Manzoor Ahmad Taluka Municipal office

Thatta Accountant

Chapter 07 3 of 17


4. Mr. Zafar Wasan Sindh Forest Department Chief Conservator

5. Mr. Arif Khokar Sindh Forest Department Division Forest Officer

6. Suleman Khaskhaili Sindh Forest Department Forest Officer

7. Raja Peraim Sindh Forest Department Forest Officer

8. Sharjeel Memon Sindh Forest Department Forest Officer

9. Mr. Ghulam

Muhammad Mahar

Sindh Fisheries

Department Director General

10. Mr. Athar Mian

Ishaqi

Sindh Fisheries

Department Director

11. Mr. Saleem Akhtar Sindh Fisheries

Department Deputy Director Fisheries

12. Mr. Javed Mahar Sindh Wildlife

Department Conservator Wildlife Sindh

13. Dara Munir Qazi Sindh Wildlife

Department Asst. Conservator

14. Mr. Imran Sabir Sindh Environmental

Protection Agency EIA Expert

15. Mr. Ahga

Shahnawaz Babar Provincial Government

Deputy Commissioner,

Thatta

16. Mr. Muhammad

Moazzam Khan WWF-Pakistan Technical Advisor

17. Dr. Dr. Muhammad

Dawood Halayo

Health Department,

Thatta

Deputy Taluka Health

Officer, Thatta

18. Dr. Dureshahwar Provincial Coordinator

Provincial Coordinator EPI

program of Government of

Sindh

19. Dr. Nabeela Chief of Party John Snow Institute (JSI)

20. Zahir Ud Din Shar Curator, Department of

Archaeology Director (Makli)

21. Mr. Ghulam Asghar

Memon

Education Department,

Thatta

District Education Officer

(EDO), Thatta

22. Mr. Asif Qureshi Education Department,

Thatta

DO HQ, Education

department, Thatta

23. Mr. Haroon Loohar Education Department,

Thatta

Admin Officer, Education

department, Thatta

24. Mr. Khada Bux

Bahrani

Social Welfare

Department Thatta Social Welfare Officer

25. Mr. Basher Anjum Social sector specialist Rural Support Program

Chapter 07 4 of 17


Network (RSPN)

26. Mr. Ayaz Kaka District Program Officer,

Thatta

National Rural Support

Program (NRSP)

27. Dr. Akash Abbasi Project Manager NRSP

28. Ms. Noureen

Memon

District Coordinator,

Sujawal NRSP

29. Mr. Ameer Bux Jat President Coastal Community

Development Organization

30. Mr. Muhammad

Hassan Rind Project Manager

Sindh Agriculture and

Forestry Workers

Coordinating Organization

(SAFWCO)

31. Mr. Muhammad

Usman Shaikh Caretakers Pir Patho dargah

32. Mr. Huzoor Bux

Khaskheli District Officer

Sindh Education

Management Information

System

7.4 METHODOLOGY FOR STAKEHOLDER CONSULTATION

Stakeholder consultation is a two-way flow of information and dialogue between the project

proponent and stakeholders, specifically aimed at developing ideas that can help shape project

design, resolve conflicts at an early stage assist in implementing solutions and monitor ongoing

activities. Various techniques are used worldwide to carry out the stakeholder consultation that

includes discussions, meetings and field visits. Both primary and secondary stakeholders were

extensively consulted during the consultation process.

Primary Stakeholders

Concerns of the primary stakeholders of the proposed project were solicited and collected in the

following manner:

• A field visit was arranged to contact the communities in and around the project area.

• A meeting(s) was arranged with those government functionaries who were directly

influenced by project activities; and the physical area of the project falls directly under their

jurisdiction. The EIA study area falls in Riverine reserve forest and wildlife sanctuaries;

therefore, Sindh Forest Department (SFD) and Sindh Wildlife Department (SWD) has been

identified as government functionary and consulted.

• A brief description of the project was provided verbally to the stakeholders. Map was also

shown in detail for better understanding of the project area. They were asked to express

their concerns regarding the proposed project.

• Concerns, complaints and suggestions were recorded in the written form.

Chapter 07 5 of 17


• Field visits were also arranged accompanied by the representative of SFD and SWD for

field data collection.

Secondary Stakeholders

Concerns of the secondary stakeholders of the proposed project were solicited and collected in

the following manner:

• Meetings were arranged with the secondary stakeholders e.g. district administration and

other government departments, in order to obtain their concerns.

• NGOs/community based organizations were also contacted.

• A brief description of the proposed project was provided verbally. Map was also shown in

detail for better understanding of the project area. They were asked to express their

concerns regarding the proposed project.

• Concerns, complaints and suggestions were recorded in the written form.

7.5 CONSULTATION WITH COMMUNITIES

Communities were consulted during informal and formal meetings held in the project area. The

consultation process was carried out in the Sindhi language. The socioeconomic team, assisted

by sociologist initiated the sessions. During these meetings a simple, non-technical and pictorial

description of the project was given, with an overview of the project’s likely positive and

negative impacts. This was followed by an open discussion allowing participants to voice their

concerns and opinions. The feedback and immediate needs were also identified and

documented during the consultation. This process enable consultant to reach out to a wider

segment of the population of the area.

About 30 villages and two small towns were approached, as mentioned earlier, and discussions

were arranged in order to cover the identified study area and consulted with men and women

from all relevant tribes. List of consulted villages is provided in Table 7.2. Meetings with men

are generally informal while female of the project area were formally consulted with Sindhi

speaking woman sociologist. Meetings were organized separately for the groups of men and

women representing these villages. The responses from male and female were carefully

screened and separately recorded.

Participants were given a brief introduction to the project and the objectives of the meeting.

After listening to a description of various elements of the project—the campsite, construction of

access tracks, and the installation of a rig for the oil & gas exploration from the area—aided by

picture and maps, participants were asked to voice their perceptions of the company and

provide feedback on past project activities, if any had been conducted in the area. Their

feedback regarding specific issues was particularly solicited and suggestions for potential

mitigation measures discussed and documented. A list of selected questions was used to guide

these discussions.

Chapter 07 6 of 17


The women did not foresee any negative impact if they start any work. In fact, they hoped for

increased of prosperity in their village. As their employment rate is drastically low so they

expect some chance of employment for their young children.

Table 7.2: List of Consulted Villages

S. No. Name of Consulted Villages/Town

1. Village Ramazan Puhawar

2. Village Rasool Solungi

3. Village Darya Khan Dairi

4. Village Yaqub Munara

5. Village Haji MirMuhammad Hinjorju

6. Village Haji Lakha Dino Hinjorju

7. Village Ladha Mallah

8. Village Nabi Buxh Puhawar

9. Sher Muhammad Jut

10. Bacho Jutt

11. Haju Sumar Jut

12. Sathyani Shareef

13. Village Muhammad Dablo

14. Village Siddique Karo Dablo

15. Village Ahmad Nawaz

16. Village Ali Soho

17. Village Ahmad Soho

18. Khalifa Ahmad

19. Mirzo Lagari

20. Haji Buxh Lagari

21. Haji Muhammad Ali Soho

22. Haji Mullah Buxh

23. Goth Suati Mori

24. Sakhi Sultan Shah Pir Patho

25. Ghulam Ullah City

26. Allah Dino Molvi

Chapter 07 7 of 17


27. Haji Ali Muhammad Kiryu

28. Ali Muhammad Dars

29. Ahmad Nahyo

7.5.1 COMMUNITY ISSUES AND EXPECTATIONS

The main concerns and expectations which were identified during consultation with local

community are as follows:

• The community is expected that preference will be given to locals by implanting an

appropriate mechanism for local workforce to take part in the activity;

• Unavailability of drinking water, educational and health facilities are also identified by the

locals;

• During consultation community identified the potential of installation of Hand pumps and

Tube wells to resolve the water issue;

• Waste management should be proper to avoid any mishandling and open

dumping/burning of solid waste in the project area;

• In case of any damage to land or agriculture field compensation should be paid;

• Privacy of working women should not be compromised because a large number of

outsiders will come to the area;

• There should not be any interference/disturbance to women for fetching water from wells,

collecting firewood, grazing livestock and working in the fields;

• Existing metalled roads of the project area damaged due to movement of machinery and

heavy equipments should be repaired by the company;

• All project activities should be done with safe distance from communities;

• Route alignment should be selected in such a way that no or a minimum number of

structures, trees, tomb, graveyard and other assets will be affected;

• The noise level should be kept to the minimal so that the local livestock do not get

frightened and run away.

7.6 CONSULTATION WITH OTHER STAKEHOLDER

In addition to consultation meetings with communities, other stakeholders were also consulted

includes Assistant Commission Sujawal, Taluka Municpal Officer Thatta, Sindh Forest

department, Sindh Wildlife Department, Sindh Fisheries Department, Sindh Environmental

Protection Agency, , District Health Officer Thatta, Deputy Taluka Health Officer Thatta,

Admin Officer Education department, Archaeological Department District Education Officer,

District Program Officer National Rural Support Program (NRSP) Thatta, Project manager

NRSP, M&E Officer NRSP, WWF Pakistan ,and a Social Activist.

Chapter 07 8 of 17


All the stakeholders were given maximum project information verbally and were shown map of

the area in detail. Their concerns and suggestions were heard which are reproduced below.

7.6.1 CHIEF CONSERVATOR SINDH FOREST DEPARTMENT

As stated earlier, the project area falls in riverine reserved forest area, a designated protected

forest governed by the regulations laid out in the Sindh Forest act, 1927, and managed by the

SFD. The SFD is, therefore, a key stakeholder and was included in the consultation process. SGS

team met with Chief Conservator Forest Sindh Mr. Zafar Wasan. The project and the activities

involved were explained to him with the help of map. He appreciated the efforts of SGS team

for conducting stakeholder consultation meeting. Their views and recommendations were

sought in the analysis of impacts and development of mitigation measures. He expressed some

concerns and suggested following actions, which are discussed below;

• He recommended MPCL should inform forest department during project activities to

maintain the habitat of the project area.

• Efficient technology should be used for seismic operations to avoid any land disturbance in

the project area

• Vegetation loss/ forest cutting in the project area should be compensated through re-

vegetation plan and re-vegetation plan should also be shared with forest department.

• Invasive species should be preferred for re-plantation in the project area.

• He supported development activities, however he emphasized that development projects

should follow the principle of sustainable development with true spirit.

• As the data pertaining to the area is limited, therefore physical, biological and

socioeconomic aspects of the project area should be appropriately covered in detail in the

report.

• Independent Monitoring Consultants (IMC) should monitor the activities during the

execution of the project and report EMP non-conformances to SEPA.

7.6.2 DIRECTOR SINDH FISHERIES DEPARTMENT

As mentioned in the earlier sections of the report that the project area comprised of significant

sizeable riverine area of Indus River having fishing activities within Thatta, Sujawal and Mirpur

Sakhro areas, governed by the regulations laid out in the Sindh fisheries act, 1972, and managed

by the Sindh Fisheries Department. The Sindh Fisheries Department is therefore identified a key

stakeholder and was included in the consultation process. SGS team met with Director General

Sindh Fisheries Department Mr. Ghulam Muhammad Mahar, Director Athar Mian Ishaqi and

Deputy Director Saleem Akhtar. The project and the activities involved were explained to him

with the help of map. He appreciated the efforts of SGS team for conducting stakeholder

consultation meetings. Their views and recommendations were sought in the analysis of

Chapter 07 9 of 17


impacts and development of mitigation measures. He expressed few concerns and suggested

following actions, which are rephrased below;

• He recommended MPCL should designed integrated waste management plan including

spill contingency plan to avoid any surface water contamination in the project area. SGS

team briefed him that project activities will be carried out with all safety and

environmental measures to avoid any worst case scenario. it was also informed that

proponent has a comprehensive spill response and emergency response plan to handle any

emergency situation on time.

• The need of a practical mechanism of coordination is strongly recommended to avoid

inconvenience or loss of livelihoods to the fisherman community.

• He appreciated proposed project will be fruitful to minimized the energy crises in Pakistan.

• He appreciated the appointment of IMC in order to ensure the compliance of

recommendations of EIA.

7.6.3 CONSERVATOR SINDH WILDLIFE DEPARTMENT

As stated earlier, the project area falls within Keti Bandar North and Keti Bandar South wildlife

sanctuaries, a designated wildlife sanctuary governed by the regulations laid out in the Sindh

Wildlife Protection Ordinance, 1972, and managed by the SWD. The SWD is, therefore, a key

stakeholder and was included in the consultation process. SGS team met with Conservator

Wildlife Sindh Mr. Javed Mehar, Asst. Conservator Dara Sahab and Game officer Mr. Rasheed

Sahab. The project and the activities involved were explained to him with the help of map. He

appreciated the efforts of SGS team for conducting stakeholder consultation meetings. Their

views and recommendations were sought in the analysis of impacts and development of

mitigation measures. He expressed some concerns and suggested following actions, which are

discussed below;

• Representative of the wildlife department should accompany the EIA team during the field

survey to identify any protected habitat(s) and/or species.

• Seismic activities should be carried out carefully to avoid any disturbance during migration

season of water birds.

• As the data pertaining to the area is limited, therefore physical, biological and

socioeconomic aspects of the project area should be covered in detail in the EIA report.

• Independent Monitoring Consultants (IMC) should monitor the activities during the

execution of the project and report EMP non-conformances to SEPA.

7.6.4 SINDH ENVIRONMENTAL PROTECTION AGENCY

Sindh Environmental Protection Agency (SEPA) was contacted through formal letter for

consultation. Director General SEPA nominated Mr. Imran Sabir for consultation meeting to

discuss the environmental issues related to the proposed project.

Chapter 07 10 of 17


During the meeting, the SGS team briefed them regarding the proposed operation, its location

and the environmental issues pertaining to the proposed exploration activities.

He showed great interest in the briefings and discussions and provided very valuable

suggestions mentioned below.

• The EIA report should cover the detailed methodology adopted to collect baseline data on

floral and faunal attributes.

• Wildlife of the project area should be documented with great care.

• Care should be taken during project activities to minimize the impacts on wildlife and

floral species.

• Independent Monitoring Consultants should be hired in order to monitor the project

activities and compliance of EMP.

• Consultation should be conducted with concerned stakeholders.

• Specific drilling technique should be given in EIA report.

7.6.5 ASSISTANT COMMISSIONER (AC) SUJAWAL

SGS team met with Mr. Arif Raheem Khtatak, AC Sujawal. He was informed about the project

activities proposed by MPCL. AC Sujawal though appreciated the move and said that by the

intervention of such large companies, the undeveloped areas will be developed and of course

the communities will get the benefit of it. He appreciated the participatory approach of the

consultant (SGS) for the betterment of the poor people and the back ward areas of one of the

largest districts of Sindh. He showed great interest in the briefings and discussions and

provided very valuable suggestions mentioned below.

• Best engineering practices should be adopted to avoid any disturbance in the project area.

• Aesthetic look should be maintained by planting trees at road side of the project area

• Waste management should be properly handle to avoid any land and soil contamination

• As per CRS policy in Kareja Primary School furniture should be provided.

7.6.6 MUNICIPAL COMMITTEE THATTA, DISTRICT THATTA

A meeting was held with Mr. Manzoor Ahmad Accountant. Mr. Manzoor hinted at a few

important issues that needed special attention during the project execution. All these issues

(listed below) have been incorporated in impact mitigation plan.

He appreciated the efforts made by the MPCL in terms of creation of a number of direct and

indirect employments leading to economic growth in the area and he also appreciated the

MPCL efforts towards the environment and social well being of the area.

• MPCL should prepare water conservation strategy for the proposed project because water

scarcity is common in the project area

Chapter 07 11 of 17


• Improper disposal of solid waste can deteriorate the aesthetic look of area and would be

the outbreak for malaria and other diseases in the project area.

• Waste disposal contractor should be hired to collect solid waste on daily bases.

• Employment opportunities will be provided to local community of the project area.

• MPCL should consider welfare work as per CSR policy for local community especially

water supply and drainage system in the project area

7.6.7 TECHNICAL ADVISOR -WWF PAKISTAN

A meeting was conducted with Mr. Moazzam khan, Technical Advisor WWF Pakistan. He was

also accompanied by Mr. Umair Shahid, representing WWF Marine program. They were

informed about the project activities. He showed their satisfaction on the process of stakeholder

consultation and put forwarded couple of findings presented as under.

• They mentioned the importance of biodiversity and its role in the livelihood of the

surrounding area. They place a word of caution while documenting the biological baseline

of the project area, so that any important factor could not be missed out; they also shared

couple of references of the database which were appropriately incorporated in the relevant

sections of this report.

• Mr. Moazzam also suggested that keeping in view the presence of sensitive wildlife

especially birds species in and around the project area, stringent mitigation measures

should be adhered during project activities.

• He stressed taking special care, while gathering information on flora and fauna of the area

and keeping in view of the livelihood aspect of the communities living in the surroundings.

7.6.8 HEALTH DEPARTMENT

The consultation was done with Mr. Dr. Muhammad Dawood Halayo, District Health Officer

(DHO) Thatta and focal person of Sindh Government’s Program of EPI of Thatta District and an

NGO John Snow Institute (working for health) to:

• Know the major health issues of the project area.

• Know the major concerns regarding health in case of seismic and drilling activities.

• Get the set of recommendations.

Following are the key points of the discussion:

The major health issues of the project area of Thatta and Sujawal districts are:

• Water borne diseases due to shortage of water, lack of potable drinking water and use of

saline water.

• Malnutrition due to poverty and un-awareness about balanced diet.

• High MMR and IMR due to the accessibility and lack of medical facilities.

Chapter 07 12 of 17


• Skin diseases due to rough weather and use of saline water.

• Snake bites.

• Excessive use of pan, ghutka and chalia.

They show the following concerns regarding the seismic and drilling activities:

We are appreciated the efforts made by the MPCL to exploration activities in Thatta Sujawal

districts which will be play important role to minimize the energy crisis in country by utilizing

own natural resource;

• MPCL should properly develop and implement waste management plan as improper

waste disposal can multiply the population of nuisance scavengers & predators in the

project area.

They give the following recommendations:

• By coming such companies in backward areas will generate the employment to the locals

and hence enhance their skills.

• Most of the Rural Health Centre (RHCs) and other health facilities in the project area have

no lady doctors, medicines and the medical equipments. If the company will support the

RHCs to overcome these shortfalls, then it will help to control the high rates of MMR and

IMR.

7.6.9 EDUCATION DEPARTMENT

Consultation was made with Mr. Ghulam Asghar Memon, District Education Officer along with

its team including admin officer. They shared their view point on the proposed development

activities.

• Literacy rate is drastically low in the project area due to low income resources of people in

project area as well as lack of department funds, improper infrastructure condition of

schools and unavailability of teachers are major crises faced by education Department.

They made the following recommendations:

• MPCL through its CSR activities help the local community for the improvement of

educational infrastructure in the project area.

• MPCL through its CSR activities help the local community to conduct vocational training

programs, so they can generate new income resources and improve their livelihood.

• Environmental laws and regulation and other national and other applicable law, regulation

and guidelines should be implemented during all project activities;

• Environmental quality of project area should be strictly monitored to avoid any damage to

environmental, and community’s disturbance in project area.

Chapter 07 13 of 17


7.6.10 SOCIAL WELFARE DEPARTMENT

• A detailed discussion was made with the social welfare officer of the social welfare

department Thatta. He has the additional charge of District Disaster Management

Coordinator. According to him cyclones, floods and other disasters are the major issues of

the coastal area.

• Poor people are committing suicides due to unemployment, which is the major issue of this

area. Locals must be given the priority for jobs.

• The land is degraded due to the sea intrusion and hence the agricultural and livestock

rearing activities of the area are badly affected. Thus there is need to introduce the

livelihood alternates for males as well as for females.

7.6.11 ARCHAEOLOGY DEPARTMENT

The consultation was made with the Curator of Archaeology Department based at Makli

Graveyard. The curator suggested to take extra care whiles the seismic and drilling activities in

order to avoid any damage to them. In case, if any such heritage will be found by the company

during the activities, they should report to the concern department immediately.

7.6.12 NATIONAL RURAL SUPPORT PROGRAM

National Rural Support Program is worth mentioning NGO working in the area. They are

involved in several projects of infrastructure development, education and health. They raised

some concerns on communities' behalf and give some recommendations as well:

• Most of the companies don't believe in community participation approach and work in

isolation. By such approach, the community's needs never addressed and hence the

interventions may result into failure. Thus, any community development initiative must

ensure the community participation at each and every level.

• To ensure the community ownership for any project there is need to launch social

mobilization program.

• The companies should take care of the local norms and cultural values and must be gender

sensitized.

• Neither district HQ nor talukas have the facilities of library. If the company will take such

initiative then it may help in developing the literary environment and enhance the quality

education.

7.6.13 COASTAL COMMUNITY DEVELOPMENT DEPARTMENT

Coastal Community Development Organization is a lobbying and advocacy based fisher-folk

community organization, working in the project area. A detailed consultation was carried out

with the president, who is a senior social worker of the area as well.

The concerns and suggestion expressed and response provided is as follows.

Chapter 07 14 of 17


• MPCL should develop a mechanism with the involvement of local communities under

their CSR to take some initiatives for the development of local community.

• MPCL should give preferences to locals for unskilled jobs.

7.6.14 SAFWCO

A detailed meeting was organized with Project Manager of SAFWCO, who is focusing on

education in the project area. The concerns and suggestion expressed and response provided is

as follows.

• As per the latest education survey, the overall literacy ratio of the area is about 36%, which

is not enough. .

• There is need to organize public awareness workshops and focus on village leaders to

enhance the education ratio of the area.

• There is need to develop the long term Community Development Program with the

integrated participatory approach with communities in order to avoid the conflicts.

7.6.15 CARE TAKERS OF PIR PATHO DARGAH

The detailed consultation was made with the care takers of Pir Patho dargah. The concerns and

suggestion expressed by the representatives are as follows.

• They appreciated MPCL interventions which may benefit the project area and ensured full

cooperation for the project.

• Their main concern was the proper compensation of land to the land owners and the

priority to the locals in the employment.

• Accordingly to them the major issue of the area is no gas availability for household

consumption and they showed the concern as MPCL is working in the area, benefit should

be given to local community in terms of gas supply. .

• MPCL should help the local community for safe drinking water through their CSR

activities. .

Chapter 07 15 of 17


Photographs of Consultation with Government Officials and NGO’s

Consultation with Conservator Sindh

Wildlife Department - Mr. Javed Mehar

Consultation with Sindh Environmental

Protection Agency - Mr. Imran Sabir

Consultation with Director General Sindh

Fisheries-Mr. Ghulam Muhammad Mahar

Consultation with Director WWF General

Sindh Fisheries - Mr. Athar Mian Ishaqi

Consultation with Director Archaeological

Department WWF Sindh - Mr. Zaheer Ud Din

Consultation with Education Department -

Mr. Aghar Memon and Mr. Nazar

Chapter 07 16 of 17


Photographs of Consultation with Government Officials and NGO’s

Consultation with District Health Officer

Thatta - Mr. Dr. Muhammad Dawood Halayo

Consultation with Technical Advisor WWF

Pak – Mr. Moazzam Ali Khan

Consultation with TMO Thatta SGS Team in Consultation with Local NGO

Representative Ms. Noureen Memon

Consultation with Conservator forest

department

Consultation with Assistant Commissioner

Chapter 07 17 of 17


Photographs of Consultation with Local Communities

Chapter 08 1 of 32


8 IMPACT PREDICTION, EVALUATION AND

MITIGATION MEASURES

This chapter discusses the potential environmental and social impacts of the proposed activities,

predicts the magnitude of the impacts and assesses its significance. The proposed mitigation

measures to minimize adverse impacts are also discussed in subsequent sections of this chapter.

Screening of the project activities in different phases of project cycle have been carried out for

identification of adverse environmental impacts. Project phases which can pose environmental

and social impacts are divided into three broad categories:

1) Design phase

2) Construction phase

3) Drilling/operation phase

The environmental issues associated with above mentioned project phases are identified and

their impacts are examined. These impacts are broadly examined under following categories;

• Impacts on physical environment including soil, water, noise and air;

• Impacts on biological environment including flora, fauna, and aquatic fauna; and

• Impacts on socioeconomic and cultural environment.

A detailed assessment of the environmental issues for each impact has been carried out. In

order to minimize or avoid impacts identified during the study, mitigation measures have been

recommended to reduce the consequence or likelihood of occurrence of an impact.

8.1 IDENTIFICATION OF POTENTIAL IMPACTS

In the first step, potential impacts of the project are identified by desktop screening exercise,

using checklist during field visits for collection of baseline data, professional judgment,

published literature on environmental impact of similar projects and standard environmental

guidelines. A critical step in identifying potential impacts was in discussion with project

proponent, consultation with stakeholders and community to identify their concern. Public

consultation was carried out to identify the concerns of primary and secondary stakeholders.

The following aspects may be potentially impacted due to project activities and needs to be

addressed:

• Topography and soil

• Water resources

• Ambient air quality

Chapter 08 2 of 32


• Waste Generation

• Noise

• Vehicular movement

• Biological receptors (flora, fauna and aquatic fauna)

• Socio-economic receptors and

• Archaeology

8.2 IMPACT ASSESSMENT CRITERIA

Identified potential impacts are evaluated on the basis of following criteria:

• The present baseline conditions, the change in environmental parameters likely to be

effected by proposed project related activities;

• To check whether there is an impact that could possibly breach the environmental

standards applicable to the project such as the National Environmental Quality Standards

(NEQS);

• To check whether there is a high risk of a permanent, irreversible, and significant change to

environmental conditions due to the particular project activity. Some impacts are

transitory; they last until the activity lasts. Others are persistent and may last much longer

than the activity. After a long period the environmental parameter may or may not revert

back to its natural state;

• To determine if the community expresses any concern about the project;

Identification of the monitoring requirements:

The last step in the assessment process is the identification of the minimum monitoring

requirements. The scope and frequency of the monitoring depends upon the legal requirements.

The purpose of monitoring is to confirm that the impact is within the predicted limits and to

provide timely information if an unacceptable impact takes place. An environmental

management plan (EMP) will be developed with identification of monitoring requirements.

This is discussed in the subsequent chapter.

8.3 IMPACT ASSESSMENT METHODOLOGY

The impacts have been assessed following standard international guidelines and best available

practices. The method defines three levels of consequence (or severity) and likelihood (or

probability of occurrence) - High, Medium or Low - of an impact. A standard risk based

approach has been used in which;

the significance of an impact is determined on the basis of the level of consequence and

likelihood of the impact e.g. an impact of medium severity is assigned a low significance if the

Chapter 08 3 of 32


likelihood of occurrence of the impact is low and high significance if the likelihood of

occurrence is high or almost certain. The definition of consequence and likelihood is illustrated

in Table 8.1 and impact significant matrix is provided in Table 8.2.

Table 8.1: Definitions for Consequence and Likelihood of Impacts

Level Consequence (Severity of Impact) Likelihood

High

• Serious/catastrophic damage to

environment

• Direct legislative requirement

• Corporate requirement

• Serious threat to corporate

reputation/profitability/ability to do

business

• High likelihood of

occurrence during lifetime of

operation

• Regular/continuous part of

operations

Medium

• Measurable damage to the

environment

• Subject to potential future legislation

• Potential to affect reputation/cost

• Implication/reduced efficiency

• Moderate possibility of

occurrence during lifetime of

operation

• Periodic/occasional part of

operations

Low

• Negligible damage to the

environment

• No risk to business

• Unlikely to occur during

lifetime of operation

Table 8.2: Impact Significant Matrix

Likelihood

Consequence High Medium Low

High High High Medium

Medium High Medium Low

Low Medium Low Low

• The prediction of impacts also include the duration of impacts (in terms of long-medium

and short-term), nature of impact, geographical location of the impact and reversibility of

Chapter 08 4 of 32


the impact. Impact assessment criteria for the above mention parameters are illustrated in

Table 8.3.

Table 8.3: Impact Assessment Criteria

Impact

Characteristics Categories

Nature of the Impact

Direct: The environmental parameter is directly changed by the

project.

Indirect: The environmental parameter changes as a result of change

in another parameter.

Duration of the

impact

Short term: Lasting only till the duration of the project such as noise

from the construction activities.

Medium term: Lasting for a period of few months to a year after the

project before naturally reverting to the original condition such as

contamination of soil or water by fuels or oil.

Long term: Lasting for a period much greater than medium term

impacts before naturally reverting to the original condition such as

loss of soil due to soil erosion.

Geographical

Location of the

impact

Local: Within the area of project i.e. operation site and access road.

Regional: Within the boundaries of the project area.

National: Within the boundaries of the country.

Reversibility of the

impact

Reversible: When a receptor resumes its pre-project condition.

Irreversible: When a receptor cannot resume its pre-project condition.

• Identification of the mitigation measures: Mitigation measures will be suggested after the

assessment of the impact. There is a range of mitigation measures depends on significance

of the impact that can be applied to reduce impacts.

• Identification of the monitoring requirements: The last step in the assessment process is

identification of the minimum monitoring requirements. The purpose of monitoring is to

confirm that the impact is within the predicted limits and to provide timely information if

unacceptable impact is taking place. An environmental management plan (EMP) will be

developed with identification of monitoring requirements. This is discussed in next

chapter.

• Table 8.4 below summarize the assessment of environmental and social impacts of

proposed project activities with their significance.

Chapter 08 5 of 32


Table 8.4: Impact Assessment Matrix

Environmental

Aspects Principal Impacts

Project

Phases

Severity of

Impacts

Likelihood

of Impacts

Significance

of Impact

Topography &

Soil

Soil erosion,

scaring of

landscape &

contamination

S,C, D Low Medium Low

Water Resources

Over usage/

exploitation of

water for locals

and contamination

S,C,D

Medium

Low

Low

Ambient Air

Quality

Stack emission,

dust & fugitive

emission

S,C,D Low Medium Low

Noise and

Vibration

Disturbance to

community,

migration of

wildlife

S,C,D Medium Medium Medium

Waste

Generation

Liquid Waste:

Surface, ground

water, soil

contaminating

C,D Medium Low Low

Solid Waste:

Odour, aesthetic

and health

hazards

S,C,D Medium Low Low

Vehicular

Movement

Disturbance to

community and

wildlife

S,C,D Low Medium Low

Biological

Receptors-

Vegetation

Vegetation

clearing S,C,D Medium Medium Medium

Biological Disturbance of S,C,D Low Medium Low

Chapter 08 6 of 32


8.4 IMPACTS ASSESSMENT FOR DESIGN PHASE

8.4.1 PROJECT DESIGNING

The design phase of the proposed project mainly comprises of selection of seismic data

acquisition technique as per geographical location, civil work design, well design, and other

technical and financial studies.

During this phase of the project, there will be no major physical activity other than desktop

studies. However, site visit may require soil investigation in order to examine the soil

characteristics for well drilling and other civil work activities.

Most part of this phase does not require an extensive physical interference in the project area.

Therefore no significant environmental and socio-economic impacts have been identified

during this phase of the project.

8.5 IMPACTS ASSESSMENT FOR SEISMIC AND DRILLING PHASE

In this section, environmental issues associated with seismic survey, construction and

operations/drilling phases of proposed project are identified and their impacts are examined.

These impacts are broadly examined under following categories;

• Impacts on physical environment including soil, water, noise, air etc.

• Impacts on biological environment including flora, fauna and aquatic; and

Receptors-

Wildlife and

Habitat

faunal community

and their habitat

Socioeconomic

Receptors

Land acquisition

and compensation S,C,D High High High

Occupational &

Communal Safety S,C,D Medium High High

Local Employment S,C,D

High

(Direct/Indirect

employment)

High High (Positive

impact)

Archaeological

Site S,C,D Low Medium Low

S Seismic

C Construction

D Drilling

Chapter 08 7 of 32


• Impacts on socioeconomic and cultural environment.

8.6 IMPACTS ON PHYSICAL ENVIRONMENT

8.6.1 TOPOGRAPHY & SOIL

a) Environmental Issues

Construction of well sites, camp sites, access roads, and other project facilities could cause

topographic changes, soil erosion and contamination. Environmental aspects of proposed

project activities related to landscape and soil are:

• Clearing and levelling during seismic data acquisition, campsite and well site construction

and access track improvement;

• Physical disturbance as a result of project activities;

• Storage of chemicals, oil, fuel or waste;

Likely impacts of these activities can include:

• Physical scarring of the landscape;

• Increased risk of land slippage;

• Accelerated soil erosion;

• Alteration of soil quality by loss of topsoil;

• Soil and water contamination resulting from spillage, leakage or improper waste disposal;

• Aquatic ecology may disturb due to soil erosion.

b) Assessment of Potential Impacts

Clearing and levelling during seismic data acquisition, well site and access road construction,

camp site (both for seismic and drilling operations), could lead physical scarring, may cause

alteration of soil quality by removal of topsoil, loss of plant cover and limited soil erosion

induced by disturbance to native soil.

Two techniques will be used for seismic data acquisition; vibroseis in terrain with gentle slopes

and flat sandy areas; dynamite within agricultural lands, tidal flats/coastal areas, shallow

waters (less than 2m depth) and all other areas where access and working of the vibroseis will

be difficult. Clearing of 4.5 m seismic line will be done at the time of vibroseis.

The project area lies in agricultural land, marshy areas (dhands) in project surrounding which

encompasses riverine forest. Within the project area, operation of dynamite and vibroseis will

be used during seismic activities as per physical condition of project site.

For dense forest patches (if found to lie within the area of operation) dynamite technique will be

alternatively used which will minimise/eliminate chances of vegetation clearing. Similarly for

Chapter 08 8 of 32


seismic lines in agricultural lands deep holes will be drilled for which no line clearing will be

required. At selected location upholes will be done in which also no significant land clearing

will be required. If clearing of forest vegetation required, it shall be done with prior

consultation with Forest department and be compensated as per rules and regulations of Forest

department.

The seismic and rig campsites should preferably be located outside the protected areas (if

possible), within levelled land and existing clearing to avoid any disturbance to soil or

vegetation. However, land clearing for access road, well and camp sites may also be required,

for seismic and drilling operations. It is expected that the project crew will use existing roads for

transportation of goods, wherever possible. Construction should follow good industry practices

to avoid unnecessary clearing outside of the work corridors and likelihood of soil erosion along

or across natural drainage paths.

Loss of topsoil may take place during seismic data acquisition and camp site and drilling site

establishment. Erosion is likely to occur, mainly during the rainy season, if excavated top soil is

not appropriately stockpiled and appropriate erosion measures are not put in place.

The removal of topsoil will potentially change the soil structure (i.e. the natural sequence of soil

horizons and a reduction in organic carbon content and fertility) and may degrade the soil

quality as a result of erosion by storm water or surface water run-off. Soil erosion may also

increase siltation of the nearby tributaries which may impact directly on the aquatic fauna and

flora relying on the water bodies or sources. However, initially disturbed soil will be sealed or

compacted by engineering means, therefore it can be assessed that soil erosion will not be a

significant issue.

Soil of the area may also be affected from project activities if proper management of waste will

not be carried out. Moreover, improper waste management practices can favour waste

accumulation in nearby environment and deteriorate the aesthetic look. Spillage and leakage of

fuels, oils, and other chemicals may also lead to soil contamination. Possible contaminant

sources include fuel, lubricant oil, and chemical storage areas at well sites, and all project

vehicles. Provision of secondary containment, spill response and waste management plan will

reduce the significance of this impact.

Considering the limited vegetation clearance and land area requirement for the development of

a well site, camp site and for other construction work, any topographical changes are very

limited and for short time period, hence insignificant.

We conclude that soil erosion and contamination is not expected to occur. For the purpose of

risk assessment the likelihood on the basis of assessment has been assessed as moderate with

negligible consequence. This impact is therefore assigned minor significance. Implementation of

suggested mitigation measures will ensure the impacts are remains acceptable.

Chapter 08 9 of 32


c) Mitigation Measures

The proposed mitigation measures to reduce the impacts on geology, topography, and soil

during the proposed construction and drilling activity are given below:

• The project area where seismic line cutting is a requirement, the activity will be carried out

in a way that would minimize disturbance to natural topography and soils.

• Width of seismic line will be restricted to 4.5m in order to avoid unnecessary cutting of

vegetation and soil removal.

• Unnecessary clearing of vegetation will be strictly prohibited;

• Any loss of dense patches of riverine forest will be compensated by

plantation/replantation. The number of trees to be planted against the number removed

will be determined in consultation with the line department (SFD) and International

organisation like IUCN;

• The camp site and well site should preferably be located outside the protected areas (if

possible) and will preferably be located in existing clearing and levelled land.

• Monitoring of all activities related to removal of plantation and the compliance of

appropriate compensatory mechanism should be done.

• The number of access tracks will be specific and kept to minimum levels.

• The number of routes will be kept to a minimum.

• Vehicle speeds will be regulated and monitored to avoid excessive dust emissions;

• Water sprinkling should be carried out to minimize dust emissions due vehicular

movement and other construction activities;

• Off-road travel should be avoided and observance of this should be monitored during the

operation;

• Periodic trainings will be provided to drivers on mitigation measures related to off-road

travel and speeds limits;

• During seismic survey, construction of seismic camp and well site; movement of

equipment will be restricted to work areas only to avoid unnecessary disturbance to soils in

the project area;

• Total land uptake by the well site, camps, and access road to the well site will be kept to the

minimum required;

• The access track to the well site will be selected to utilize existing tracks as much as

possible;

• The well site and camp site will preferably be located in existing clearing and levelled land;

Chapter 08 10 of 32


• Open soil should be covered especially during monsoon season;

• The construction activities will be planned keeping in view minimum disturbances to soil;

• Movement of construction equipments will be restricted to avoid unnecessary disturbance

to soil;

• Areas along the access track will be visually monitored and any area showing signs of soil

erosion will be compacted as necessary;

• Good engineering practices will be adopted during construction activities to ensure that

soil erosion is minimized;

• All fuel tanks will be properly marked to highlight their contents;

• Fuel and oil storage areas will have secondary containment in the form of sand bunds and

impervious linings.

• Fuels tanks will be daily checked for leaks and all such leaks will be plugged immediately;

• A spill prevention and contingency plan will be prepared to deal with spills;

• Photographs will be taken before project activities to record the conditions of seismic lines

campsite, well site and access tracks at locations that are likely to undergo soil erosion.

Similar photographs will be taken after restoration, where applicable.

8.6.2 WATER RESOURCES


The proposed project may utilize ground water or water will be supplied through tankers.

There may be a probability of use of surface water. Use of water from local surface or ground

water resources for the project resulting in decreased availability of water for local users.

Proposed seismic and drilling activities could affect the area’s water resources in two ways:

• Reduction from use/overuse for locals, and

• Contamination


The use of tanker water may not pose any quantitative impact on local water resources of the

project area. Ground water can be used from existing wells with the permission of local well

owners/community.

In order to ensure that effect on local wells will not be significant enough to cause any localized

depletion of aquifers or effects on local water requirement, the local water wells will only be

used after ensuring that they have the excess capacity to supply the water requirement and

water levels/discharges will be monitored to ensure that any effects remain negligible. In case;

new water well is installed by MPCL, only water from deep aquifer will be tapped.

Chapter 08 11 of 32


In case of utilization of surface water, formal approval will be required from concerned

department. In this case change management statement will be essential prior to use of surface

water; otherwise surface water usage for project activities will not be allowed. This statement

should be developed by MPCL and issued to seismic, drilling contractor in which additional

mitigation will be clearly mentioned. If utilization of water from existing wells will be required,

only those will be considered which will at least 500 meters away from nearest community.

Therefore, impact on local water resources is not significant.

Surface water quality may deteriorate if waste disposal is not carried out properly and mixed

with surface runoff during rain which leads to contamination of water resources in the vicinity.

Potential sources of impact may include:

• Domestic effluent (i.e. grey and black waters);

• Sediments from altered land surface (well and camp sites, new tracks);

• Spilled fuel, oil and other chemicals;

Fuel Storage, Transfer and Use: There is a chance of release of fuel, oil and chemical by leakage

or spill during project activities from loading/unloading and transfer operations. From a

management perspective these have been categorized as minor, moderate or major and must be

dealt according to their impact severity.

All fuel/oil storage, transfer and use activities will be carried out according to well-established

operational procedures. Additional measures, such as implementation of the oil spill

contingency plan, will be implemented to achieve specific objectives of operational safety. The

contingency plans will also identify various organizations and their focal person so that in case

of any accident appropriate resources can be mobilized to control and manage releases.

On the basis of above, it is concluded that the consequences of the impact would be medium

and its likelihood would be low. The impact is therefore assessed to be of low significance.

Suggested mitigation measures will further reduce any impact.

Domestic Waste: Waste such as plastic products, cans, glass, paper, cans and metals will be

stored in designated areas for proper disposal.

Moreover, surface or ground water in the vicinity of the study area may also be affected from

project activities if proper management of waste will not be carried out. Improper waste

management practices can favour waste accumulation in nearby environment and deteriorate

the aesthetic look. Environmental condition may worst if any waste will dispose directly into

water bodies or due to leachate which may lead to ground water contamination, especially in

rainy season. This may adversely affect the community/workers health, cause soil

contamination, and deteriorate the surface and groundwater quality. However, implementation

of comprehensive waste management plan will reduce the probability of occurrence of this

impact. Therefore, the impact is assigned minor significance.

Chapter 08 12 of 32



The mitigation measures described below will ensure that the project area’s surface and ground

water resources are not significantly affected by the project activities.

• The water extraction will be kept at minimum;

• The water used during project activities (construction and drilling) will be kept to the

minimum required by taking cautious on site measures related to water conservation;

• Water conservation strategies will be developed to avoid over consumption or depletion of

water resource in the project area;

• In case; new water well is installed by MPCL, this shall be drilled in deep aquifer and at

least 500 m away from nearest community water well;

• Water from public sources i.e. surface or ground water will only be abstracted after getting

formal permission from the concerned department and fulfilling the requirements of the

EIA and EMP;

• Follow good housekeeping practices with all machinery that may potentially discharge into

wastewater pit;

• Septic tanks and soak pits will be emptied periodically to ensure that effluent does not

overflow into surrounding areas;

• Sumps will remain covered all the time and measures will be taken to prevent rainwater

entry;

• Septic tanks and wastewater pits will be designed so that runoff does not flow into them;

• At the time of restoration, septic tanks and soak pits will be backfilled;

• Develop and follow a project-specific spill contingency plan following MPCL internal

procedures;

• Waste storage area should be properly covered, isolated and lined with tarpaulin or other

appropriate material to avoid ground water contamination from leachate.

• Fuels and lubricants will be stored in areas with impervious floors and bunds that can

contain spills. The volume of the containment area should be equal to 110% of the total

volume of largest tank;

• All areas containing potentially hazardous materials will be hydrologically isolated from

the remaining site;

• All fuel tanks will be properly marked to highlight their contents;

• Fuels tanks will be daily checked for leaks and all such leaks will be plugged immediately;

Chapter 08 13 of 32


• To minimize the impacts on aquifer due to each well to be drilled, which could cause

aquifer contamination and aquifer cross-contamination, following mitigation measures will

be taken into consideration;

o Ensure a thorough understanding of aquifer formations;

o Ensure an adequate cementing and casing program to provide isolation between the

aquifer and the well bore, when crossing aquifers;

o When crossing aquifer and where technically feasible, minimize mud overpressure to

aquifer pressure to minimize infiltrations.

8.6.3 AMBIENT AIR QUALITY


Impacts on air quality as a result of project activities may arise from the liberation of dust

during excavation, vehicular movement and exhaust emissions from vehicles, generators and

burning of combustible wastes. Moreover, during drilling phase there is a potential of

emissions from flare during well testing and release of hydrogen sulphide gas above safe

acceptable limits in case of any emergency.


Dust generated during the excavation activities should be limited to the civil work. However,

with the increased vehicular activity and construction of access tracks, the impact of dust may

become more extensive. The dust associated with seismic activity, site clearance and

excavations will be limited to the duration of the civil works and may exaggerate if this activity

is undertaken during the dry season. The impact is expected to be limited only during project

activities and considered to be low by applying below mentioned mitigation measures.

Vehicular and exhaust emissions generally emit particulate matters in the form of smoke,

carbon dioxide (CO2), oxides of nitrogen (NOX), sulphur dioxide (SO2), carbon monoxide (CO)

and volatile organic compounds (VOCs) are principal atmospheric pollutants from above

mentioned sources.CO2 is the principal greenhouse gas (GHG) among these pollutants. The

environmental impacts of stated pollutants are summarized as following.

Type of Emission Environmental Impact

Particulate matters May cause lungs/respiratory, visibility/haze problem etc.

Carbon dioxide (CO2) A GHG that is believed to contribute to climate change.

Carbon monoxide (CO) Enhances low level ozone production, indirectly contributing

to climate change.

Oxides of nitrogen (NOX)

Contributes to acid deposition (e.g. acid rain). May also

enhance ground ozone when mixed with VOCs in sunlight

level.

Chapter 08 14 of 32


Sulphur dioxide (SO2) Contributes to acid deposition (e.g. acid rain). Toxic gas.

Improper tuning of generators and vehicles may lead to deteriorate the air quality of project

area. However, MPCL will monitor all emission sources during project activities through IMC.

Emissions in the form of oxides of carbon, nitrogen and sulphur will be produced during

flaring. Flaring is a much better environmental option than venting. As the flare will be kept

downwind of the well site and at least 500 m away from any community, hence no impact on

communities or workers will occur. In the unlikely event of any release of hydrogen sulphide

emissions, emergency response procedures will be adopted.

Above mentioned assessment shows that the sources of emission during seismic and drilling

operations will not be significant enough to alter the ambient air quality and the impact is

assessed to be of low significance due to medium likelihood and low severity to alter ambient

air quality due to project activities.


The mitigation measures given below will further reduce their impact, and ensure that they

remain within acceptable limits.

• All equipment, generators, and vehicles used during the project will be properly tuned and

maintained in good working condition in order to minimize exhaust emissions;

• All project vehicles will be checked regularly to ensure that engines are in sound working

condition and are not emitting smoke;

• Well site and campsite will be located at least 500 m away from communities;

• Access track to access well sites and camp site will maintain a practical distance from

communities in order to avoid dust impacts on nearby communities;

• Dust emissions during construction activities will be minimised by good management

practices such as locating stock piles out of the wind direction, keeping the height of the

stock piles to a minimum, keeping earthwork areas damp etc.;

• Imposing speed limits and encouraging more efficient journey management will reduce the

dust emissions produced by vehicular traffic;

• Water sprinkling should be carried out to minimize dust emissions in order to minimum

deterioration of ambient air quality;

• To minimize the impact of flaring during well testing, following mitigation measures will

be considered and implemented:

o A flared test will be carried out only if deemed necessary from preliminary

evaluation;

Chapter 08 15 of 32


o Should a flared test be deemed necessary, its duration will be defined on technical

parameters;

o Flare pit will be kept downwind of the well site and at least 500 m away from the

nearest community;

8.6.4 NOISE POLLUTION AND VIBRATION


Potential sources of noise and vibration will include operation of seismic survey activities,

generators, machinery, drilling rig, construction equipment, and vehicles. The maximum

disturbance may occur along the roads, seismic lines and well site(s). Generally different types

of vehicles like, 4x4 DD IMV, cranes, lifter, loader, cars, mobile welding plants etc. will be used

during the various project activities.

Likely impacts of these activities can include:

• Local community and exposed personal disturbance;

• Migration of wildlife and bird from the area;

Assessment of Potential Impacts

There is no continuous major source of noise and vibration observed during site visit of project

area. Although intermittent sources of noise include road traffic on different roads inside the

project boundary was observed.

The noise and vibration during seismic and drilling activities would affect the exposed

personnel and may cause nuisance or hearing impacts on workers associated with these

activities. In addition, elevated noise levels due to project activities can be a source of nuisance

for locals and a source of disturbance to wildlife.

Noise monitoring of 08 hours were conducted at different locations of the project area. The

results show that noise levels slightly above from NEQS level. Similarly noise levels during

project activities generally attenuated as the distance from the source and the receiver increases.

As the project facilities will maintain appropriate distances from human settlements, impact of

noise on communities will significantly attenuated. Likewise impact of noise emission on

communities will not be significant when the access tracks are at safe distance.

In addition, it is expected that detonation of dynamite may produce higher noise levels.

However, detonation of dynamite will only be heard at the surface like a muffled thud, and it

will not scare any wildlife in nearby areas. Moreover, as seismic operation will preferably be

planned before or after the migratory season, anticipated impacts on birds are assessed to be

insignificant

The overall impact level will be localized as it will be limited to the immediate project corridor

and short term as the impact will take place as long as the project activities carried out.

Chapter 08 16 of 32


Although the impacts will be localized and short term, for risk assessment point of view; both

likelihood and consequence of the impact would be assessed as medium and therefore assigned

medium significance. The impacts on exposed worker and wildlife will be minimized by

implementation of following suggested mitigation measures.

b) Mitigation Measures

• Proper engineering control will be applied to noise producing sources like generator

(Canopy, muffler and enclosure will be installed/provided to reduce the noise impact on

the surroundings and nearby communities)

• The seismic activities will be completed in limited times as possible.

• It will be ensured that generators, vehicles and other potentially noisy equipment used are

in good condition.

• Noise from generators, vehicles and other equipment and machinery will be kept to the

minimum through regular maintenance.

• The use of horns by project vehicles will be minimised. The use of pressure horns will not

be allowed.

• Well site and campsite will be located at a distance mentioned in this EIA report in order to

minimize the noise impacts on nearby communities.

• All on-site personnel will use required personal protective equipment (PPE) in high noise

areas that will be clearly marked.

• Ambient noise levels (intermittently) will be monitored during construction activities.

8.6.5 WASTE GENERATION


Proposed seismic and drilling activities will generate different types of waste. This includes

domestic garbage, packaging waste, paper waste, glass, metals; concrete waste, oil waste,

spilled chemicals and oil, kitchen waste, medical, drilling mud and cutting, produced water

waste effluent i.e. grey water and black water etc.

Likely impacts of improper waste management generated from project activities can include;

• Surface and ground water contamination

• Soil contamination

• Odour

• Health hazards

• Aesthetic issues

Chapter 08 17 of 32



Improper waste management practices can favour waste accumulation in nearby environment

and deteriorate the aesthetic look. Environmental condition of the project area can be impacted

due to leachate formation which may lead to ground water contamination, especially in rainy

season. This may adversely affect the community/workers health, cause soil contamination, and

deteriorate the surface and groundwater quality. However, a comprehensive waste

management plan has been developed by MPCL and all the waste generated during seismic

and drilling operations will be disposed off through the waste management plan.

Domestic Wastewater (Grey and Black Water)

Black water from the camp site will go into an impermeable septic tank. Treated water will pass

from the septic tank into evaporation pit and into the air. The impermeable septic tank will

prevent untreated sewage from polluting surface water. Regular decanting of the evaporation

pit may be required to manage the level. However, grey water will be used for sprinkling on

Katcha track.

Recyclable and Non-recyclable Waste

Recyclable/reusable waste such as paper, card board, textiles, glass, plastics, tin and aluminium

cans etc. will be sold to recycling vender (recyclable/reusable waste contractor). Non-recyclable

waste will be stored separately and sent to nearest domestic contractor for final disposal.

Leftover food waste can be buried onsite, if appropriate or sent to waste contractor.

Medical Waste

Medical waste - including Syringes, glass bottles, soiled bandages, expired drugs, dressings etc

will be stored separately from other wastes and sent to an approved waste incineration facility.

Spilled Fuel and Oil

Leakage or spill of oil and/or chemical during seismic, construction and drilling phases can

result in contamination of soil and water resources. Consequently spill containment will be

used for storage areas. From a management perspective these have been categorized as minor,

moderate or major and will be remediated as soon as reasonably practical according to their

impact severity.

Produced Water

Produced water will also obtain during drilling operation. Produced formation fluids will be

flared along with the gas or collected inside the lined produced water pit at the well sites.

Drilling Mud and Cuttings

Water based mud will be used during drilling operations. HDPE lined mud waste collection pit

will be constructed for the collection of drilling mud and cuttings. The pits will be of larger

dimension than the expected volume of mud to accommodate overflows. After water

Chapter 08 18 of 32


evaporation, pit will be backfilled. These pits will be closed by providing a top-soil cover at the

time of site restoration. As the mud and cuttings are non-hazardous, impacts on soil or

groundwater are expected to be insignificant.

After assessment of all above mentioned waste categories, it is concluded that likelihood of the

impact would be low due to implementation of waste management plan and consequence

would be moderate (in case waste management plan will not follow), therefore the impact is

measured to be of low significance.


• Black water (sewage water) should be disposed through septic system comprising of soak

pits and septic tanks;

• Grey water (washing water, kitchen water etc.) should be disposed through soak pits and

where required should be sprinkled on access tracks;

• Soak pits and septic tanks should be constructed and designed to accommodate domestic

sewage i.e. black and grey water;

• Soak pits and septic tanks will be confined with a buffer area in order to stop any entrance

or its exposure to outer environment;

• At the time of restoration, septic tanks and soak pits should be dismantled and backfilled

with at least 1m of topsoil cover above the surrounding surface level;

• Solid residue from the septic tanks should be transported to municipal sewage treatment

facilities in any nearby city;

• All project related vehicles should be daily checked for fuel or oil leaks. Vehicles with leaks

should not be allowed to operate until repaired;

• Chemical and fuel storage areas should be clearly identified by marking;

• All chemicals and fuels will be stored in confined buffered areas;

• Chemical and fuel storage drums/cans should be clearly labelled with safety signs;

• All chemical and fuel storage areas are equipped with secondary containment in the form

of concrete or brick masonry dykes/bunds;

• Spill response kit should be available at chemical and fuel storage areas. In addition to this,

ensure the availability of shovels, plastic bags, and absorbent material for the spill

management;

• Solid waste disposal in the field should not be allowed;

• The recyclable waste should be sent to waste contractors/ vender or any other recycling

facility for reused;

Chapter 08 19 of 32


• Medical waste should be sent to an approved incineration facility Non-recyclable debris

and domestic garbage should be stored separately and sent to nearest domestic contractor

for final disposal;

• Waste management procedures and activities should be monitored by an IMC;

• A waste management plan should be developed before the start of the project activities.

Key elements of the waste management system should be the following:

On-site handling

o The recyclable waste should be sent to waste contractors/ vendor or any other

recycling facility for reused.

o Non-recyclable debris and domestic garbage should be stored separately and sent to

nearest domestic contractor for final disposal.

o Waste bins should be placed inside the boundary. All waste removed from the site

should be handled by waste contractors.

o All hazardous waste will be separated from other waste and incinerated through

waste contractors.

Records

o Records of all waste generated during the project activity period should be

maintained. Quantities of waste disposed, recycled, or reused should be logged on a

waste tracking register.

Disposal

o All non-hazardous waste material that cannot be recycled or reused should be

disposed of as per waste management plan;

o Depending on the nature and quantity of the hazardous waste, it should be disposed

of by licensed hazardous waste contractors as per the waste management plan;

Drill Cutting Management

o Water Based mud should be reused and recycle.

o No drilling mud should be deliberately discharged into an uncontrolled

environment. All the mud will be contained.

o The drill cuttings and mud should be disposed off at the well site within HDPE lined

mud waste collection pit.

o The mud waste collection pit design should be based on volumes and type of

cuttings and should also be designed to suit the topography of the area. This will

prevent the risks of transfer of contaminated material from the pit to the

environment.

Chapter 08 20 of 32


o The mud waste collection pit should be located away from local runoff and should be

designed with enough spare capacity to contain spent mud discharged during

drilling and water produced during testing.

o Prior to pit backfilling, the mud waste collection pit should be adequately marked

and fenced to avoid any intrusion by humans or animals.

o Once deemed dry, the mud waste collection pit should be adequately sealed and

backfilled to avoid subsequent airborne dispersion.

o These pits should be closed by providing a top-soil cover at the time of site

restoration.

Other Management Measures

o Training should be provided to personnel for identification, segregation, and

management of waste;

o An emergency response plan should be developed for the hazardous waste (and

substances)

o All containers of hazardous waste should be appropriate labelled;

o Equipment and material containing asbestos, poly-chlorinated biphenyls (PCBs), and

ozone depleting substances (ODSs) should not be used.

8.6.6 VEHICULAR MOVEMENT


Proposed project seismic/drilling activities will involve movement of earth moving, seismic and

drilling equipments which includes cranes, lifter, loader, cars, double cabin and single cabin

pick up etc. Potential impacts of vehicular movement are;

• Disturbance to local community due to

o Dust generation

o Elevated noise

o Vehicular emissions

o Accidents due to vehicular movement.

• Disturbance to wildlife


Vehicular movement is not a continuous activity which poses continuous impacts on local

community and wildlife. However, unsafe driving practices can cause damage to the wildlife

and threat to local community of the project area. As the project facilities will maintain

appropriate distances from human settlements, disturbance to local community due to dust,

noise and accident will be minor. Likewise impact of noise and vehicular emission on

communities will also minor when the access tracks will be maintained a safe distance.

Chapter 08 21 of 32


Moreover vehicular emissions during project activities will not be significant enough to alter the

ambient air quality as discussed above.

Traffic management plan to avoid/minimize night time movement of vehicles will reduce the

disturbance to community and wildlife.

On the basis of above assessment, we conclude that likelihood of occurrence would be moderate

whereas its consequence would be low. Therefore severity of the impact is assigned as low

significance. Implementation of following mitigation measures will further reduce any

anticipated impact.


Traffic management plan to avoid/minimize night time movement of vehicles will reduce the

disturbance to wildlife. Implementation of following mitigation measures will further reduce

any anticipated impact.

• Noise from all type of vehicles will be kept to the minimum through regular maintenance;

• The use of horns by project vehicles will be minimised. The use of pressure horns will not

be allowed;

• Well site and campsite will be located at least 500 m away from communities;

• Access track to access well sites and camp site will maintain a practical distance from

communities in order to avoid dust impacts on nearby communities;

• Dust emissions during construction activities will be minimised by good management

practices such as locating stock piles out of the wind direction, keeping the height of the

stock piles to a minimum, keeping earthwork areas damp etc.;

• Where required, water sprinkling will be carried out to minimize dust emissions due to

vehicular movement and other activities;

• Imposing speed limits prescribed by MPCL, drivers will receive specific direction on this

requirement;

• Encourage more efficient journey management will reduce the probability of accidents and

dust emissions produced by vehicular traffic;

Chapter 08 22 of 32


8.7 IMPACTS ON BIOLOGICAL ENVIRONMENT

8.7.1 VEGETATION


During the seismic and drilling operations vegetation minimal clearing may be occur along

seismic lines; well site and camp site area, and access tracks (new tracks prepared during

seismic operation and the track prepared to access the well site locations). Minimal damage to

plant species and loss of habitat during road travel may also occur. In addition, clearing of

vegetation may also be envisaged due to project activities.


All the major activities, except seismic transect and drilling for exploratory well, in case seismic

data identified the particular location, will be carried out in land area of the Sujawal block.

The proposed project area consists of a flat terrestrial land comprising of agriculture holdings,

natural vegetation and 15% western deltaic region mainly comprising of barren land creek area

The major area of project utilized for agriculture purpose. Most of riverine forest land also used

for agriculture, fish farming and livestock grazing purpose because population of project area

increasing day by day and they have limited sources for income generation; hence it is

envisaged that there will be limited damage on agriculture holdings causing marginal or

negligible impact.

As the project activities occupy small areas relative to the overall habitat in which they are

located. Unless any sensitive or endemic species are cleared, the amount of vegetation cleared

from the area represents a very small percentage of the total habitat and the associated impacts

would therefore be of no major significance. It was noted during site visit that similar type of

vegetation communities are distributed in other areas of the block over large geographical areas

so the loss of vegetation, if required, from a small area will not result in extinction of any

vegetation community. Due to sparse vegetation cover, major clearing may not be involved.

Due to construction activities, the impact of vegetation clearing and loss of habitat is less

significant because campsite will be constructed at cleared land and dense patches of vegetation

will not be removed and new tracks will be avoided as much as possible.

During project activities, dust will be generated which may accumulate on vegetation and may

possibly hinder the vegetation growth. However, the EIA study area is relatively high wind

area with high percentage of humidity especially in night which cause dew formation. This will

naturally reduce any impact of dust on vegetation cover.

The Indus River is mainly identified by presence of reserve riverine forest which is growing

naturally. The project identifies the importance of this identical vegetation and proposed to

adopt the strategy of offset, wherever possible; however, even the avoidance is inevitable then a

Chapter 08 23 of 32


strategy of minimal destruction will be opted. Further to oversee the process, a close

coordination with the relevant line department, which in this case the Forest department has

also been suggested.

Assessment of impacts on vegetation conclude that, although there is a possibility of occurrence

of vegetation clearing during project activities however resultant damage is expected to be

moderate. Below mentioned recommended mitigation measures will ensure that the impacts

are kept to the minimum.


• Vegetation clearing during seismic activities and construction of well sites and camp sites

will be kept to a minimum;

• Impact of project including construction activities to be carried out in areas with sensitive

vegetation species or communities will be minimized by selecting alternate areas with

reduced sensitivities, where possible;

• Preference will be given to those areas for camp site, well site and access tracks that are

already experiencing human interference;

• When developing new access roads, routes that minimum vegetation loss will be chosen,

avoiding unnecessary damage to vegetation;

• Off-road travelling will be minimized;

• Land requirement for each well site, campsite , and access road will be kept to the

minimum;

• Existing tracks will be utilized as much as possible;

• The access track to each well site will be properly compacted, maintained and sprinkled

with water throughout the construction and drilling operations;

• Use of local vegetation as fuel by project personnel will be prohibited;

• Vehicle speeds will be regulated and monitored to avoid excessive dust emissions, which

may impact on vegetation;

• Water sprinkling should be carried out to minimize dust emissions impacts on vegetation;

• Best available engineering practices will be adopted during construction activities;

• Clearing of dense vegetation shall be minimised by careful selection of camp site and

access track by providing off-site tracks;

• Clearing of vegetation/forest should be avoided and incase of any plant damaged it should

be replanted and monitored through IMC;

Chapter 08 24 of 32


• Trainings would be provided to drivers on mitigation measures related to off-road travel

and speeds limits;

8.7.2 WILDLIFE AND HABITATS


Loss of habitat may disturb the wildlife due to clearing of 4.5 m wide seismic lines for the

operation of vibroseis (if required), preparation of new access tracks; sensory disturbance due to

movement of vehicles and crew personnel; sitting and operation of camps; data acquisition

activities, shooting and recording. Likely impacts from proposed project activities can include:

• Habitat loss due to vegetation clearing

• Temporary disturbance/movement of some wildlife from the proposed project site due to:

o Elevated noise

o Sensory disturbance due to presence and movement of people and vehicles.

o Use of lights

o Improper waste disposal

The project area supports 18 mammals, 42 birds in summer and around 98 birds in winter as a

considerable area falls under famous Indus flyway for migratory birds. In addition, 16 reptile, 4

shrimps and 39 fish species were also reported/observed in the study area. The water bodies

and the forested areas are considered to be critical habitats due to the presence human

settlement and economic development activities (alternation of forest land into agriculture land,

wood cutting, fish farming and livestock grazing) are the major threat to wildlife in project area


Many different wildlife species are found in project area, as discussed in detail in respective

section of the EIA report. Most of the animals in the project corridor are common along with

few sensitive wildlife species.

Potential impacts of project activities on wildlife and habitat could be sensory disturbance to the

species due to personnel movement and noise generated during seismic, construction, drilling

activities, lights used at the well and camp sites, noise and mortalities due to vehicular

movement.

The activities on seismic lines and access tracks will be carried out in series, one line after the

other or at the most two lines at a time. This will provide relief to wildlife species affected by

noise or human presence in neighbouring environment.

The site of the seismic camp will be selected away from the sensitive areas to minimise any

impacts of its operation on the wildlife. Similarly drilling and construction camps will be

preferably constructed away from the wildlife sensitive areas (Active borrows, wetlands, dense

vegetation patches etc.

Chapter 08 25 of 32


Improper disposal of solid waste can disturb the ecology of the project area or may increase the

population of reptiles and rodents. However, implementation of waste management plan will

reduce the impact of improper waste disposal with respect to wildlife.

All the project activities will be properly monitored through IMC. This will avoid disturbance to

wildlife species may affected by noise or human presence in the neighbouring environment.

Impact Assessment on Large Mammals

The project area supports 18 mammals. These include Asiatic Jackal, Common Red Fox, Indian

desert cat, Black napped hare, and Indian crested porcupine, Small Indian mongoose etc.

Determining the effects of noise on wildlife is complicated because responses vary between

species and between individuals of a single population. These variable responses may be due to

characteristic of noise, season, and activity at the time of exposure, sex and age of the

individual, level of previous exposure. However, it has been observed that with continued

exposure to noise, animals show a decreased tendency to move away (Hompland, 1985).

The animals might tend to move away from the area where project activities to be conducted for

an initial period of time but can be expected to return to these areas once they have habituated

to the disturbance. This acclimatization with environment will lessen the significance of this

impact.

Impact Assessment on Birds

A total of 42 birds in summer and around 98 birds in winter as a considerable area fall under

famous Indus flyway for migratory birds. Birds have been categorized as residents and visitors

(summer & winter), a considerable number of avifauna in the area consist of winter visitors. As

the project area (Mirpur Sakhro) touched a part of Indus delta Ramsar site (wetlands of

international importance) exists in the vicinity of EIA study area, however; the disturbed habitat

including Indus delta for these species will be a little fraction of their total preferred habitat.

Moreover, birds are highly mobile and tend to avoid areas of disturbance. Therefore, except for

localised effects on behaviour due to sensory disturbance, a minor to moderate impact on these

bird species can be envisaged and are found to be least to moderate susceptible from the project

activities.

Impacts on Reptiles

A total of 16 reptiles were observed/ reported in the project area.

Potential direct impacts of the project activities on reptiles and small mammals are believed to

be loss of habitat; displacement from the immediate and adjacent areas from seismic lines, well

site, camp sites, and access track; and mortality during construction activities.

Clearing of seismic lines within study area will be minimised by avoiding/minimizing

unnecessary clearing of vegetation in order to limit the habitat loss of small mammals and

Chapter 08 26 of 32


reptiles. Loss of habitat due to construction of access track, well site and campsites will be only

a very small fraction of the total available habitat for these species.

In the absence of any mitigation, clearing of land and vegetation in areas with small mammal or

reptile holes can lead to mortality of these species. It is expected that at the start of construction

work in any area, small mammals and reptiles will flee from the area due to the vibrations and

noise of the construction machinery. As most of the species have developed an intricate

network of holes in the ground, these species will be able to find many escape routes.

For the purpose of risk assessment, we conclude that there is no potential of measurable threat

to the wildlife due to low possibility of occurrence and the impact is assessed to be of minor

significance.


The following mitigation measures will reduce the adverse impacts on the wildlife of the project

area:

• Before start of any activity, awareness trainings will be provided to contractor’s

management and field crew related to wild life protection.

• No-hunting and no-trapping policy will be strictly enforced, unless human life is under

threat.

• Harassment of wildlife during project activities will be avoided;

• Areas with concentrated colonies of active burrows and dens will be avoided during the

seismic operation and access track improvement/construction;

• Prior to the improvement and construction works on the access tracks, areas with small

mammal and reptile holes will be identified. All live holes will be disturbed manually or by

other appropriate means so as to dislocate species residing in these holes.

• A high density of live small mammal and reptile holes will be re-routed during project

activities, if possible, to avoid disturbance to that section of the track.

• Project personnel or vehicles will not be allowed to access the ridges in order to minimize

disturbance to animals.

• Movement of project personnel and vehicles will be restricted to the seismic lines, access

tracks, well and camp site areas;

• Training should be provided to drivers and staff for safe driving practices to protect local

community and wildlife.

• Use of firearms will be clearly restricted;

• General awareness of the crew would be provided regarding the wildlife, through

environmental training, notice board postings, tool box talks etc;

Chapter 08 27 of 32


• The project staff would be educated and morally trained to avoid killing, feeding or

harassment of wildlife;

• Physical disturbance to areas outside the work corridors will be avoided;

• The total duration of activities will be minimized by good management;

• Night travelling during project activities will be kept to a minimum;

• Lights used at the well sites and campsites will be kept to the minimum required;

• Noise generating equipments, machinery and vehicles should be properly tuned and

periodically inspected to minimize excessive noise generation within study area;

• Use of pressure horn will be prohibited at wildlife sensitive areas, especially in night time.

• Avoid unnecessary vehicular movement to minimize noise impacts on wildlife.

• Food wastes will not be disposed off in the open. Food wastes collected in waste

segregation units will be disposed off according to waste management plan;

• Construction work near areas which show reptile populations will commence after a soft

start up and will be randomly monitored;

• Vehicular speed will be monitored and controlled to avoid incidental mortalities of wild

animals;

• Project activities preferably should not be carried out in winter season which is the

migratory seasons of key winter visitors.

• Special care shall be taken if project activities will be executed in winter season especially

from November (when they have reached the desired destinations in warmer areas) to

February (when they back to their homelands).

• Independent Monitoring Consultant (IMC) shall be hired to ensure compliance with

mitigation measures and Environmental Management Plan (EMP) of this EIA report.

8.8 SOCIO ECONOMIC IMPACTS

The project activities will bring certain socio-economic changes in the project surrounding area.

Some of the impacts would be directly beneficial to the socio-economic environment due to

employment potential, improvement in infrastructural facilities, resource utilization from

nearby markets by the employees, whereas some of them would be of adverse nature.

The adverse impacts on community due to proposed project activities include invasion of

privacy; changes in demography; sharing of local resources; loss of standing crops in areas

where agriculture is being practiced; excessive dust emissions; improper disposal of waste;

damage to archaeological or cultural sites due to project activities; noise pollution, and

restriction of mobility of local women etc.

Chapter 08 28 of 32


8.8.1 LAND ACQUISITION AND COMPENSATION

As mentioned earlier, campsite will be constructed on existing clearing wherever possible.

Land might have to be leased for well site and campsites construction. MPCL has a procedure

for leasing of land and its compensation; following which the landowner will be paid a lease

amount for the land as per market rate and a compensation amount for the standing crop

affected at the time of the lease. In addition, the district administration should be involved

while disbursing the compensation amounts so that the rightful owners of the land are

compensated. Any delays in disbursement of compensation amounts should also be avoided so

that the already marginalized communities of the area are not affected.

Mitigation Measures

• A generous compensation will be granted to land owner as per prevailing market rates (if

land acquired)

• In case of acquisition of land, ensure all amounts for leased land will be disbursed in an

equitable and transparent manner.

• Compensation amount should be disbursed in time to avoid any conflicts between

proponent and local community.

• Agricultural, archaeological, religious or otherwise valuable land will not be used for

seismic and exploratory drilling activities without consent of respective authorities.

8.8.2 COMMUNITY DISTURBANCE

The local communities may be disturbed by the noise, dust, vehicular movement, and improper

disposal of waste due to proposed exploration activities... Seismic data acquisition and access

tracks lying close to the settlement will also result in disturbance and annoyance to the local.

Moreover, sharing of local resources may be the point of conflict between project proponent and

local community. All these impacts due to project activities will be temporary in nature and

only the communities adjacent to proposed site may be affected for a short period of time.

Following mitigation measure should be implemented to minimize the disturbance to the

community.

Mitigation Measures

• While deploying major noise generating equipment, it should be checked that all noise

abatement devices are in good working condition and proper measures have been taken to

minimize the noise levels.

• Communities will be informed about project activities and possible disturbance.

• Use alternate route, wherever possible, that passes away from community.

• Water sprinkling should be carried out on regular basis to minimize dust impacts on local

communities, if any.

Chapter 08 29 of 32


• Campsite will be selected away from the human settlements and maintain a minimum

distance of 500 m.

• Consent with local community and approval from respective local authority is mandatory

prior to use of local resources e.g. water.

• Holes, vibroseis and access track will be aligned at a safe and practical distance from

community settlements.

• All the mitigation measurements for the vehicles movement and waste management

mentioned above will be followed to avoid any disturbance to the community.

8.8.3 RESTRICTED MOBILITY

The project activities may affect mobility of local women. Project personnel will be given gender

sensitization briefings and will be instructed to respect local norms, the local culture,

particularly in relation to the womenfolk of the area.

Mitigation Measures

• Project staff should respect local cultural norms.

• Ensure there should be no interaction with the local womenfolk.

• Project crew should be restricted to work corridor.

• Limit the social interaction between the project team and local communities in order to

avoid disputes between the project team and locals;

8.8.4 COMMUNITY GRIEVANCES/COMPLAINTS

Community grievances/complaints related to project activities will be addressed by project

proponent (MPCL). Local complaints on dust, vegetation clearance, fishing farming, use of local

resources, elevated noise, waste from different project activities, spilled oil and chemicals,

hiring issues, invasion of privacy, damages to structures of locals etc. may provide basis for

conflict between the locals and project proponent.

Mitigation Measures

• Grievance handling system will be established on the basis of MPCL’s past experience to

address community grievance/complaints.

• A social complaint register will be maintained on site by MPCLL. All complaints received

from local communities will be noted in this register.

• Community complaints shall be duly addressed and appropriately resolved. The measures

taken to mitigate these concerns will also be noted in social complaint register.

• Mitigation measures related to all above mentioned concerns should be strictly

implemented in order to minimize community grievances.

Chapter 08 30 of 32


8.8.5 ARCHEOLOGICAL, CULTURAL AND RELIGIOUS SITES

Any archaeological, cultural or religious sites (as mentioned in guideline for protected areas)

are not found within project area nor any such site observed during site survey. Local cultural

sites, like Masjid, Mazar, and graveyards were found in the block during site visit. Access track

has been aligned by providing offset to the archaeological finds to avoid the impacts of

construction and drilling activities over the archaeological finds. Similarly, offset will be

provided to avoid damage of any site of historical importance during the course of project

activities. Seismic lines, well locations and camp sites should be located at safe distance (500 m)

from these sites to avoid any harm to the sites or the archaeological artefacts. On the basis of

this assessment, it is clear that project activities will be confined to the limited area therefore no

impacts on these sites will be anticipated. Implementation of following mitigation measures will

further minimize above mentioned impacts.

Mitigation Measures

• Ensure all project activities will be carried out away from any archaeological, cultural and

religious site, if any.

• For all other sites of local significance e.g. Masjids, graveyard etc. a safe distance

(determined after consultation with locals) will be maintained.

• Safe distance should be maintained to avoid any physical damage, change in aesthetic

value, or disrespect to any site of archaeological or religious importance.

• Contractor and MPCL staff will be trained in order to identify and recognize sites of

archaeological, cultural and religious importance. This will prevent any physical damage

and conflict between locals and project proponent.

• Any sudden discovery of any such site of archaeological, cultural and religious importance

during project activities shall be communicated to project proponent for further intimation

to relevant department.

8.8.6 COMMUNITY SAFETY

The proposed project activities may affect the safety of the inhabitants of the area, such as over

speeding, handling and storage of fuels/explosive and field equipments. These activities could

expose the local population to hazard if conducted in populated areas where local people

especially children are likely together to look the activity. Increased vehicular movement at

project site may expose the community towards accidental injuries.

Mitigation Measures

To minimize the safety & security risk following mitigation shall be adopted and monitored.

• Project vehicles should follow speed limits which will reduce road safety issues

significantly.

Chapter 08 31 of 32


• Safe driving practices will be adopted while passing through settlements.

• Explosives should be stored in an isolated and clearly marked area. The area should be

constructed keeping in view community and campsite safety.

• Night time travelling will be kept to minimum.

• Local peoples will be informed about project activities in order to keep locals especially

children away from project area.

• Field equipments should never be left unattended.

• Fire extinguishers and other relevant safety gadgets equipments should be provided.

8.8.7 SAFETY OF WORKERS

MPCL’s management must make sure that workers should use the Personnel Protective

Equipments (PPEs) during project activities specially working on heights, dealing with

explosives, working with machines/equipments, and working in dusty and noisy environment

etc.

Mitigation Measures

To ensure worker’s safety during project activities, following measures should be undertaken:

• Explosives should be stored in an isolated and clearly marked area. The area should be

constructed keeping in view community and campsite safety.

• Fire extinguishers and other relevant safety gadgets equipments should be provided at site.

• First Aid box should be placed on site.

• First Aid training should be provided to all supervisory staff.

• Contact addresses and numbers of local hospitals and other emergency organizations

should be available on site all the time.

8.8.8 EMERGENCIES AND ACCIDENTS

Project activities will increase the possibility of accidental injury or any other emergency

situation like fire, oil spill or any natural disaster may be happened which may impact project

staff and nearby communities as well. To handle this situation, MPCL has clearly defined, well

structured and dynamic Emergency Response Plan available to handle level 1 and level 2

emergencies.

Mitigation Measures

• Ensure emergency response plan should be developed and implemented to cater different

emergency situation as mentioned above.

• Ensure project related staffs are well aware and trained on emergency response plan.

• Ensure provision of first aid at site in case of any emergency.

Chapter 08 32 of 32


8.8.9 EMPLOYMENT

The distribution of employment during implementation of the project activities should be done

in a manner ensuring that the people likely to be affected by the project or the most vulnerable

groups of the community are given preference in employment opportunities.

Employment opportunities shall be created both for skilled and unskilled workers during the

project cycle. Skilled and trained work force is not expected to be available in the area.

However, project proponent will ensure to hire locals for unskilled jobs and wherever possible,

for skilled jobs.

Mitigation Measures

• MPCL and its contractors should employ local residents for semi skilled and unskilled

opportunities and wherever possible, for skilled jobs during the project cycle.

• Local residents living closest to the project location will be given priority in the

employment process.

• Labour from local communities will be recruited equitably among the tribes and the

employment procedures will be transparent.

8.8.10 LOCAL ECONOMY

It is envisaged that turnover of local businesses will be increased due to an increased demand

from project contractors and their employees. During the proposed project activities such as

construction material i.e. gravel, aggregate, steel, cement, sand etc. for camps and well site

construction will be procured preferably from local market. General supplies which include

camp supplies (food, etc.), fuels and oils etc. will also be procured preferably from local market.

This will be a positive impact on local economy. However, care should be taken to avoid heavy

burden on local resources.

• An increase in the income of locals may occur due to increase in employment opportunities

due to project activities.

• An increase in the income of locals may occur due to increased turnover of local businesses

and shops due to an increased demand from project contractors and their employees.

Chapter 09 1 of 24


9. ENVIRONMENTAL MANAGEMENT PLAN

9.1 INTRODUCTION

After the Environmental Assessment process of the proposed seismic and drilling activities, it is

essential to identify project specific actions to minimize the adverse environmental impacts

caused during project activities. These actions are compiled in the form of an Environment

Management Plan (EMP). Though most of the environmental impacts identified in the

proposed seismic and drilling activities are temporary and localized, project specific

recommendations further minimize these impacts.

The potential environmental impacts are identified from the planning stage of the proposed

project through the EIA process. The Environmental Management Plan (EMP) is a vital part of

overall planning and implementation of projects. EMP provides a structural framework and

logical approach for effective implementation of the mitigation measures related to health,

safety and environment, and environmental protection of the project area and it’s surrounding

throughout the project lifecycle.

The EMP is a tool that serves as to manage environmental impacts and specifically focuses on

implementation of mitigation measures in its true sense against likely environmental impacts.

Both negative and positive impacts at each stage of the project activity have been examined in

detail, in this EIA study.

9.2 SCOPE OF THE EMP

The scope of the EMP covers all construction and operational activities and ensures continual

compliance with National legislation, international standards and guidelines, and the MPCL

Health, Safety and Environment Policy.

The EMP covers a series of general and specific recommendations that, collectively, constitute

the basis of the management (mitigation of the impacts) and environmental control during the

project’s life cycle.

The EMP lists the obligations and responsibilities of each party involved in the project;

stipulates methods and procedures that will be followed; and outlines environmental

management actions that will be implemented, considering that the reference framework for the

environmental standards is avoiding negative impacts on the health and well-being of people

and the environment.

9.3 PURPOSE AND OBJECTIVES OF THE EMP

This EMP has been prepared based on the findings of the EIA study and describes management

measures designed to prevent or reduce potential environmental and social impacts of

proposed seismic and drilling activities.

Chapter 09 2 of 24


The purpose of EMP is to ensure the commitments made in this EIA report for effective

implementation of mitigation measures. The primary objectives of the EMP are to:

• Facilitate the implementation of the mitigation measures identified in the EIA.

• Achieve MPCL Health, Safety and Environmental (HSE) goals.

• Ensure compliance of the associated legislative requirements, guidelines, community

issues, if any, and best industry practices that apply to the project.

• Define roles and responsibilities of the project proponent and identify areas where these

roles and responsibilities can be shared with other stakeholders.

• Define a monitoring mechanism and identify monitoring parameters in order to:

� Ensure the complete implementation of all mitigation measures.

� Ensure the effectiveness of the mitigation measures.

• Define requirements for environmental monitoring and auditing;

• Provide a mechanism for taking timely action in case any unanticipated environmental

situation may arise.

• Identify training requirements at various levels.

9.4 METHODOLOGY

The basic approach to prepare this EMP mainly comprise of:

• A review of environmental legislation and guidelines

• A review of past environmental studies carried out in the Sujawal block

• On the basis of past experience gained during the monitoring of similar projects and

adjacent oil and gas Concessions Blocks

• Consultation with Stakeholders and community

9.5 COMPONENTS OF THE EMP

The EMP consists of the following:

• Legislation and guidelines

• Organizational structure and responsibilities

• Implementation Stages of EMP

• Change Management Plan

• Waste Management Plan

• Environmental Monitoring Plan

• Impacts Mitigation Plan

Chapter 09 3 of 24


9.6 LEGISLATION AND GUIDELINES

The EIA has discussed national and international legislation and guidelines that are relevant to

the project. MPCL will ensure that the project is conducted in conformance to MPCL Corporate

HSE policy and national legislations applicable to the project. MPCL will also ensure that its key

project management staff and all its assigned contractors are aware of these legislation and

guidelines prior to the start of project activities. All relevant laws and Regulations are discussed

in details in Chapter 2 of the report.

The NEQS specify standards for industrial and municipal effluents, gaseous emissions,

vehicular emissions, noise levels, ambient & noise level and drinking water quality are

discussed in chapter 2 and attached as Annexure IV.

9.7 ORGANIZATIONAL STRUCTURE AND RESPONSIBILITIES

This section provides an organizational structure for effective implementation of EMP during

seismic, construction and drilling phases of proposed project, and defines the roles and

responsibilities during the project phases. The proposed project includes the following

organizations:

• MPCL as the project proponent and owners of this EMP; and

• Seismic, construction and drilling contractors as the executors of the EMP.

• If the seismic, construction and drilling operation is carried out by MPCL itself, then MPCL

would become the executor of the EMP.

9.7.1 PROJECT PROPONENT

Being a project proponent and owner, MPCL will be responsible for ensuring the overall

implementation of the EMP. Manager Exploration, Senior Manager Designing and Construction

and Drilling specialist will be responsible for overall environmental performance of the project,

and implementation and compliance of the EMP. The QHSE Manager, will be responsible for

providing technical support in environment related issues, Contactor site HSE personal will be

responsible for ensuring implementation of the EMP and will ensure that the project is carried

out in accordance with governing legislation, MPCL’s Corporate Policies and the

recommendations laid down in this EIA.

In addition to that MPCL management will also ensure:

• Deploy a contractor Site HSE Coordinator to accompany field team throughout the

duration of the proposed project. HSE field monitor will also deploy by MPCL on call out

basis to monitor contractors site activities;

• All contracts of MPCL which will execute through contractors and sub-contractors comply

with environmental sensibilities and MPCL’s HSE Policy and guidelines;

Chapter 09 4 of 24


• All HSE personnel will be authorized to implement the policies and requirements of the

environmental management plan;

MPCL will cooperate with regulatory agencies and other stakeholders who may intend to send

their own teams to monitor seismic, construction and drilling activities.

9.7.2 CONTRACTORS

For proposed project MPCL may acquire services for contractors for seismic, civil work and

drilling operations. Civil work contractor would be involved in development of access road,

well site and campsite, whereas, drilling contractor(s) would be involved in well drilling

operation. These contractors will nominate HSE representative / officer for their respective

activities. HSE Representative / Officer will be responsible for implementation of, or adherence

to, all provisions of the EMP and with any environmental and other codes of conduct required

by MPCL. Overall responsibility for environmental performance of the operation will rest with

the senior management of the contractors. Site In-charges of the contractors will be responsible

for the effective implementation of the EMP.

9.7.3 REGULATORS

Sindh Environmental Protection Agency (SEPA) will monitor compliance with the requirements

of EMP of the project and any additional mitigation measures provided in the NOC for the

project.

9.7.4 INDEPENDENT MONITORING CONSULTANT (IMC)

MPCL will be responsible for ensuring the overall implementation of the EMP. For this purpose

it is suggested that MPCL acquire services of Independent Monitoring Consultant (IMC) for

compliance and implementation of EMP. The responsibilities of IMC will include:

• Ensure that all environmental and social parameters/ provisions comply with the

applicable standards;

• Ensure that development and operational activities are carried out in an environmentally

sound and sustainable manner;

• Organize periodic environmental training programmes and workshops for the Contactor's

staff and Site staff in consultation with MPCL.

9.8 IMPLEMENTATION STAGES OF EMP

9.8.1 PLANNING AND DESIGN STAGE

Design and other details of the proposed project include the activities described in Chapter 4 of

this EIA report. Following approval of the EIA from SEPA, if any aspect of the operation or

requirements of the EIA need to be changed, MPCL will categorise that changes in accordance

Chapter 09 5 of 24


with the Change Management Plan provided in Section 9.9 of this EMP and take appropriate

measures thereon.

9.8.2 OPERATIONAL STAGE

Operational stage refers to all stages after designing and planning stage. In this EMP,

operational stage comprises of i.e. rig erection and operation/drilling. EMP will be implemented

during all phases. Implementation of following activities during operational stage is very

essential for overall management of mitigation measures.

a) Minimum Distances

The EIA specifies minimum distances to be maintained from environmental features including

communities, water sources, sensitive areas and archaeological/cultural/religious sites etc.

These minimum distances are provided in Table 9.1. MPCL and the contractors will ensure that

these minimum distances are adhered to during the execution of the project.

Table 9.1: Minimum distance from environmental receptors

Facility Distance

New access tracks

• 50m from all surface water sources

• 100m from Sensitive receptor (house, School and market)

• 100m from Dhands

Campsite

• 500 m from communities

• 500m from cultural sites (including graveyard and shrines)

• 200m from surface water bodies

Upholes

• 30m from water wells

• 50m from houses (including mud house and huts etc)

• 50m from Surface water bodies e.g. dhands

• 50m from reptile hole/nest/den

• 100m from Tank/ dug well/hand pumps

• 50m from archaeological significant and cultural sites

• (including graveyard, religious sites and shrines)

Soak pits • 300m from all surface/ground water sources

Shot holes and

Vibrators

• 50m from water wells

Chapter 09 6 of 24


Table 9.1: Minimum distance from environmental receptors

• 50m from houses

• 50m from Surface water bodies

• 100m from Tank/ dug well/hand pumps

• 50m from reptile hole/nest/den

• 50m from archaeological significant and cultural sites

(including graveyard, religious sites and shrines)

Drilling Site • 500 m From Community

b) HSE Management System

MPCL and the contractors will ensure that the organisational HSE Management System is

implemented during the proposed project activities. The contractors will abide by the relevant

contractual provisions relating to the environment.

c) Emergency Preparedness

Emergency preparedness plan will be prepared and maintained by MPCL and its contractor to

deal with any emergency situation that may arise during the project activities e.g. fire

emergency, major oil spills, blow out (in case excess pressure abrupt rapidly during drilling),

occupational health & safety hazard etc. and communicate these to the regulatory agencies (if

required by these agencies). However, MPCL has a clearly defined, well structured and

dynamic Emergency Response Plan.

d) Communication and Documentation

HSE matters will be discussed during daily tail gate meetings held on-site, in order to monitor,

manage and document the environmental performance of project activities. Environmental

concerns raised during the meetings will be resolved after discussions between MPCL and

contractor’s management representative or higher management (if required). Weekly and

monthly environmental reports will be generated by MPCL Site HSE Coordinator and

contractor’s representative and will be shared to the respective higher management.

e) Environmental Training Programme

The MPCL’s HSE Manager is overall responsible for identifying, arranging evaluating and

development of comprehensive environmental training programme for effective

implementation of the EMP. The MPCL’s Site HSE Coordinator will determine the training

requirements for the contractors necessary for understanding and effective implementation of

the EMP. The MPCL’s Site HSE Coordinator and contractor’s representatives will then

disseminate the necessary training to all project personnel.

Chapter 09 7 of 24


Table 9.2: Suggested Environmental Training

Project Activity Staff Contents

Seismic/Drilling

Drivers

• Road safety

• Road restrictions

• Defensive driving

• Vehicle restrictions

• Alcohol and drug policy

• Socio-economic sensitization

Crew

• Wildlife sensitivities

• Communication of environmental problems to

appropriate officer

• Waste disposal

• Socio-economic sensitization

Camp Staff

• Camp operation

• Waste Segregation

• Waste disposal

Construction Bull Dozer Operators

• Wildlife sensitivities

• Identification and avoidance of sensitive areas

• Waste disposal

• Waste management at work sites

• Communication of environmental problems to

appropriate officer

• Restoration requirements

f) Restoration

MPCL will be responsible for the final restoration of work areas according to the requirements

of the EIA.

9.9 CHANGE MANAGEMENT PLAN

The EIA recognises that changes in the operations or the EMP may be required during the

operation and therefore a Change Management Plan has been provided to manage such

Chapter 09 8 of 24


changes. The management of changes is discussed under two separate headings, changes to the

EMP and changes to the Operation.

9.9.1 CHANGES TO THE EMP

The EIA and the EMP have been developed based on the best possible information available at

the time of the EIA study. However, it is possible that during the seismic, construction and

operation phase some aspects of the EMP may need to be changed owing to their non-

applicability in a certain area of operation or the need for additional mitigation measures based

on the findings of environmental monitoring during the seismic, construction and operational

phase. In such cases following actions shall be taken.

• A meeting will be held between MPCL and the concerned contractor. During the meeting

the proposed deviation from the EMP, planning and designing will be discussed and

agreed upon by all parties.

• Based on the discussion during the meeting, a change report will be produced collectively,

which will include the original EMP clause/plan or design, the change that has been agreed

upon, and the reasons for the change.

• The report will be signed by all the parties and will be filed at the site office. A copy of the

report will be sent to MPCL and contractor head offices.

• All relevant project personnel will be informed of the change.

9.9.2 CHANGES TO THE OPERATION

a) First-Order Change

A first order change is one that leads to a significant departure from the project described or the

impacts assessed in the EIA and consequently require a reassessment of the environmental

impacts associated with the change. Examples of such change include change in design of

proposed project.

In such an instance, the environmental impacts of the proposed change will be reassessed, and

the results sent to the Sindh EPA for approval.

b) Second- Order Change

A second-order change is one that entails project activities not significantly different from those

described in the EIA, and which may result in project impacts whose overall magnitude would

be similar to the assessment made in this report.

In case of such changes, the environmental impact of the activity will be reassessed, additional

mitigation measures specified if necessary, and the changes reported to the Sindh EPA.

c) Third –Order Change

A third-order change is one that is of little consequence to the EIA findings. This type of change

does not result in impact levels exceeding those already assessed in the EIA; rather these may

Chapter 09 9 of 24


be made onsite to minimize the impact of an activity. The only action required in this case will

be to record the change in the change record register.

9.10 WASTE MANAGEMENT PLAN

The waste management plan is a necessary requirement to ensure that the impact of generated

wastes is kept to be a minimum. A generic waste management principle is discussed here, that

will be employed during the project while a detailed plan will be developed by the MPCL and

its contractor. Different types of waste will be generated from different project activities which

needs to be properly disposed are;

• Seismic and construction waste

• Excess seismic and construction material

• Fuel, Oil & Chemical

• Drill cuttings and mud

• Recyclable waste

• Garbage

• Sewage etc.

General principles within this plan should be:

• All staff should be aware of waste management procedures;

• Waste Management procedures should be followed;

• Wastes shall be handled, stored and treated according to their nature or type;

• All reusable and recyclable waste should be segregated;

• All reusable waste should be reused where possible or sent for recycling or scrap

contractor;

• Waste generation and disposal records should be maintained.

9.11 ENVIRONMENTAL MONITORING PLAN

Project activities would be monitored by MPCL and its contractors; MPCL Site HSE

Coordinator will monitor project activities and will keep records of all non-conformances

observed and report these along with actions to MPCL management for further action. The Site

HSE Coordinator will also communicate any anticipated impact(s) which was not covered in

EIA for further action.

MPCL, IMC and the contractors will ensure that environmental monitoring of the project

activities is carried out according to the monitoring plan given in Table 9.3.

Chapter 09 10 of 24


Table 9.3: Environmental Monitoring Plan

S. No. Monitoring Parameters Responsibility Timeline/ Frequency

1 Ambient air quality MPCL

Construction: Quarterly

Operation: Biyearly

2 Ambient noise monitoring MPCL


Operation: Biyearly

4 Vehicle Emission MPCL Construction: Quarterly

Operation: Biyearly

3 Drinking Water MPCL


Operation: Biyearly

5 Gaseous Emission MPCL

Construction: Monthly

Operation: Monthly

6 Wastewater MPCL

Construction: Monthly

Operation: Quarterly

Note: Operation Mean Seismic & Drilling Activities

9.12 IMPACTS MITIGATION PLAN

The purpose of impact mitigation plan is to ensure the implementation of mitigation measures

suggested in the EIA report. Impact mitigation plan is a reference tool for systematic monitoring

of the significant impacts identified in the EIA.

Suggested mitigation measures are summarized in Table 9.4 for seismic, construction & drilling

phases and contain the following information.

• The required mitigation measures recommended in EIA report.

• The person/organization directly responsible for adhering to or executing the required

mitigation measures.

• The person/organization responsible for ensuring the execution of mitigation measures in

the EIA report.

• A timescale for the implementation of the action to ensure that the objectives of mitigation

are fully achieved.

MPCL and its contractors will ensure the compliance of suggested mitigation measures during

the entire project as described in this EIA.

Chapter 09 11 of 24


Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase

S. No. Mitigation Measures Execution Monitoring Time Line/Frequency

1. Topography & Soil

1.1 Vegetation clearing will be minimized. CC, SC, DC MPCL Prior and during the land

clearing operation

1.2 Width of seismic line will be restricted to 4.5m in order to avoid unnecessary

cutting of vegetation and soil removal. CC, SC MPCL During line preparation

1.3

Any loss of dense patches of riverine forest/ Vegetation will be compensated by

plantation/replantation. The number of trees to be planted against the number

removed will be determined in consultation with the Sindh Forest department

(SFD) and IUCN.

CC, SC, DC MPCL, IMC As and when required

1.4 The number of access tracks will be specific and kept to minimum levels. CC, SC, DC MPCL During the entire

operation

1.5 Vehicle speeds will be regulated and monitored to avoid excessive dust

emissions. CC, SC, DC MPCL During the entire project

1.6 Water sprinkling should be carried out to minimize dust emissions due vehicular

movement and other construction activities. CC, SC, DC MPCL During the entire project

1.7 Off-road travel should be avoided and observance of this should be monitored

during the operation. CC, SC, DC MPCL During the entire project

1.8 Periodic training will be provided to drivers on mitigation measures related to

off-road travel and speeds limits. CC, SC, DC MPCL, IMC During the entire project

Chapter 09 12 of 24




1.9 The well site and camp site will preferably be located in existing clearing and

levelled land. CC, SC, DC MPCL

At the time of site

selection for camp site

1.10 Access tracks (other than the tracks used for the access the project site) to be used

by water tankers, dumper trucks and other vehicles shall be monitored. CC, SC, DC MPCL During the entire project

1.11 Movement of equipments will be restricted to avoid unnecessary disturbance to

soil. CC, SC, DC MPCL During the entire project

1.12 Areas along the access track will be visually monitored and any area showing

signs of soil erosion will be compacted as necessary. CC, SC, DC MPCL During the entire project

1.13 All fuel tanks/drums will be properly marked to highlight their contents CC, SC, DC MPCL During the entire project

1.14 Fuels tanks/drums will be checked on regular basis for leaks and all such leaks

will be plugged immediately. CC, SC, DC MPCL During the entire project

1.15 A spill prevention and contingency plan will be prepared to deal with spills. CC, SC, DC MPCL During the entire project

1.16

Photographs will be taken before the well site construction activities to record the

conditions of campsite and well site locations that are likely to undergo soil

erosion. Similar photographs will be taken after restoration, where applicable. CC, SC, DC, IMC MPCL During the entire project

2. Water Resources

2.1 The water extraction will be kept at minimum. CC, SC, DC MPCL During the entire project

Chapter 09 13 of 24




2.2 A complete record of water consumption during construction and drilling will be

maintained. CC, SC, DC MPCL

During the entire

operation

2.3

The water used during project activities (seismic, construction) will be kept to the

minimum required by taking cautious on site measures related to water

conservation.

CC, SC, DC MPCL During the entire

operation

2.4 Water conservation strategies will be developed to avoid over consumption or

depletion of water resource in the project area. CC, SC, DC MPCL

During the entire

operation

2.5 In case; new water well is installed by MPCL, this shall be drilled in deep aquifer

and at least 500 m from nearest community water well. CC, SC, DC MPCL, IMC

During the entire

operation

2.6

Water from public sources i.e. surface or ground water will only be abstracted

after getting formal permission from the concerned department and fulfilling the

requirements of the EIA and EMP.

CC, SC, DC MPCL, IMC During the entire

operation

2.7 Follow good housekeeping practices with all machinery that may potentially

discharge into wastewater pit. CC, SC, DC MPCL

During the entire

operation

2.8 Septic tanks and soak pits will be emptied periodically to ensure that effluent

does not overflow into surrounding areas. CC, SC, DC MPCL As and when required

2.9 Sumps will remain covered all the time and measures will be taken to prevent

rainwater entry. CC, SC, DC MPCL

During the entire

operation

2.10 Septic tanks and soak pits will be designed so that runoff does not flow into them. CC, SC, DC MPCL Before start of work

Chapter 09 14 of 24




2.11 At the time of restoration, septic tanks will be removed and the pits will be

backfilled. CC, SC, DC MPCL, IMC

After the completion of

work

2.12

Waste storage area should be properly covered, isolated and lined with tarpaulin

or other appropriate material to avoid ground water contamination from

leachate.


operation

2.13 Fuels and lubricants will be stored in areas with impervious floors and bunds that

can contain spills. CC, SC, DC MPCL

During the entire

operation

2.14 All areas containing potentially hazardous materials will be isolated from the

remaining site. CC, SC, DC MPCL

During the entire

operation

2.15 All fuel tanks/drums will be properly marked to highlight their contents. CC, SC, DC MPCL During the entire

operation

2.16 Fuels tanks/drums will be checked on regular basis for leaks and all such leaks

will be plugged immediately. CC, SC, DC MPCL

During the entire

operation

3. Ambient Air Quality

3.1

All equipment, generators, and vehicles used during the construction phase will

be properly tuned and maintained in good working condition in order to

minimize exhaust emissions


operation

3.2 All project vehicles will be checked regularly to ensure that engines are in sound

working condition and are not emitting smoke CC, SC, DC MPCL

During the entire

operation

Chapter 09 15 of 24




3.3 Well site and campsite should be located at least 500 m away from communities CC, SC, DC MPCL Prior to the construction of

camp site.

3.4 Access track to access well sites and camp site will maintain a practical distance

from communities in order to avoid dust impacts on nearby communities CC, SC, DC MPCL

During the entire

operation

3.5

Dust emissions during construction activities will be minimized by good

management practices such as locating stock piles out of the wind direction,

keeping the height of the stock piles to a minimum, keeping earthwork areas

damp etc.


operation

3.6 Imposing speed limits will reduce the dust emissions produced by vehicular

movement. CC, SC, DC MPCL

During the entire

operation

3.7 Water sprinkling should be carried out to minimize dust emissions in order to

minimum deterioration of ambient air quality. CC, SC, DC MPCL

During the entire

operation

4. Noise Pollution & Vibration

4.1

Proper engineering control will be applied to noise producing sources like

generator (Canopy, muffler and enclosure will be installed/ provided to reduce

the noise impact on the surroundings and nearby communities).


operation

4.2 It will be ensured that generators, vehicles and other potentially noisy equipment

used are in good condition. CC, SC, DC MPCL

During the entire

operation

Chapter 09 16 of 24




4.3 Noise from generators, vehicles and other equipment and machinery will be kept

to the minimum through regular maintenance. CC, SC, DC MPCL

During the entire

operation

4.4 The use of horns by project vehicles will be minimized. The use of pressure horns

will not be allowed CC, SC, DC MPCL

During the entire

operation

4.5 Camp & Well site will be located at a distance mentioned in this EIA report in

order to minimize the noise impacts. CC, SC, DC MPCL

During the entire

operation

4.6 All on-site personnel will use required personal protective equipment (PPE) in

high noise areas that will be clearly marked. CC, SC, DC MPCL

During the entire

operation

4.7 Ambient noise levels (intermittently) will be monitored during construction

activities. CC, SC, DC MPCL, IMC

During the entire

operation

5. Waste Generation

5.1 Black water (sewage water) should be disposed through septic system comprising

of septic tanks and soak pits. CC, SC, DC MPCL

During the entire

operation

5.2 Grey water (washing water, kitchen water etc.) should be disposed through soak

pits and where required should be sprinkled on access tracks. CC, SC, DC MPCL

During the entire

operation

5.3 Septic tanks and soak pits should be constructed and designed to accommodate

domestic sewage i.e. black and grey water. CC, SC, DC MPCL Before start of work

Chapter 09 17 of 24




5.4 Soak pits and septic tanks will be confined with a buffer area in order to stop any

entrance or its exposure to outer environment. CC, SC, DC MPCL At the time of construction

5.5 Solid residue from the septic tanks should be transported to municipal sewage

treatment facilities in any nearby city. CC, SC, DC MPCL

During the entire

operation

5.6 All project related vehicles should be checked on regular basis for fuel or oil

leaks. Vehicles with leaks should not be allowed to operate until repaired. CC, SC, DC MPCL

During the entire

operation

5.7 All chemical and fuel storage areas are equipped with secondary containment in

the form of concrete or brick masonry dykes/bunds. CC, SC, DC MPCL

During the entire

operation

5.8 Solid waste disposal should be through waste contractors CC, SC, DC MPCL During the entire

operation

5.9 The recyclable waste should be sent to waste contractors/ vender or any other

recycling facility for reused. CC, SC, DC MPCL

During the entire

operation

5.10 Medical waste should be sent to an EPA approved incineration facility. CC, SC, DC MPCL During the entire

operation

5.11 Non-recyclable debris and domestic garbage should be stored separately and sent

to nearest domestic contractor for final disposal CC, SC, DC MPCL

During the entire

operation

5.12 Waste management procedures and activities should be monitored to avoid any

land contamination. CC, SC, DC MPCL

During the entire

operation

Chapter 09 18 of 24




5.13

A waste management plan should be developed before the start of the project

activities. Key elements of the waste management system are discussed in detail

in respective section of the EIA report.

CC, SC, DC MPCL Before start of work

6. Vehicular Movement

6.1 Noise from all type of vehicles will be kept to the minimum through regular

maintenance. CC, SC, DC MPCL

During the entire

operation

6.2 The use of horns by project vehicles will be minimised. The use of pressure horns

will not be allowed. CC, SC, DC MPCL

During the entire

operation

6.3 Where required, water sprinkling will be carried out to minimize dust emissions

due to vehicular movement and other activities. CC, SC, DC MPCL As and when required

6.4 Imposing speed limits, all drivers will receive specific direction on this

requirement. CC, SC, DC MPCL

During the entire

operation

7. Vegetation

7.1 Vegetation clearing during seismic activities and construction of well sites and

camp sites will be kept to a minimum. CC, SC, DC MPCL During seismic operation

7.2 When developing new access roads, routes that minimize vegetation loss will be

chosen, avoiding unnecessary damage to vegetation. CC, SC, DC MPCL

During the entire

operation

Chapter 09 19 of 24




7.3 Use of local vegetation as fuel by project personnel will be prohibited. CC, SC, DC MPCL During the entire

operation

7.4 Clearing of dense vegetation during project activities shall be minimized by

careful selection of camps and access tracks by providing off-site tracks. CC, SC, DC MPCL

During the entire

operation

7.5 Clearing of vegetation/forest should be avoided and incase of any plant damaged

it should be replanted and monitored through IMC. CC, SC, DC MPCL, IMC

During the entire

operation

8. Wildlife and Habitat

8.1 No-hunting and no-trapping policy will be strictly enforced, unless human life is

under threat. CC, SC, DC MPCL

During the entire

operation

8.2 Harassment of wildlife during construction activities will not be allowed. CC, SC, DC MPCL During the entire

operation

8.3 Areas with concentrated colonies of active burrows and dens will be avoided

during the seismic activities & access track improvement/construction. CC, SC, DC MPCL

During the entire

operation

8.4

Prior to the improvement and construction works on the access tracks, areas with

small mammal and reptile holes will be identified. All live holes will be disturbed

manually or by other appropriate means so as to dislocate species residing in

these holes.


operation

8.5 Training should be provided to drivers and staff for safe driving practices to

protect local community and wildlife. CC, SC, DC MPCL

During the entire

operation

Chapter 09 20 of 24




8.6 All mitigations related to minimising noise will be adhered to. CC, SC, DC MPCL During the entire

operation

8.7 General awareness of the crew would be provided regarding the wildlife,

through environmental training, notice board postings, tool box talks etc. CC, SC, DC MPCL

During the entire

operation

8.8 The project staff would be educated and morally trained to avoid killing, feeding

or harassment of wildlife. CC, SC, DC MPCL

During the entire

operation

8.9 Night time travelling will be kept to a minimum. CC, SC, DC MPCL During the entire

operation

8.10 Lights used at well sites and campsites will be kept to the minimum required. CC, SC, DC MPCL During the entire

operation

8.11 Food wastes will not be disposed off in the open. Food wastes collected in waste

segregation units will be disposed off according to waste management plan. CC, SC, DC MPCL

During the entire

operation

9. Land Acquisition and Compensation

9.1 A generous compensation will be granted to land owner as per prevailing market

rates (if land acquired for construction activities) MPCL MPCL

Prior to or during

construction

9.2 Compensation amount should be disbursed in time to avoid any conflicts

between proponent and local community. MPCL MPCL Before start of work

Chapter 09 21 of 24




9.3

Agricultural, archaeological, religious or other valuable land will not be used for

seismic and exploratory drilling activities without consent of respective

authorities.

MPCL MPCL During the entire

operation

10. Community Disturbance

10.1

While deploying major noise generating equipment, it should be checked that all

noise abatement devices are in good working condition and proper measures

have been taken to minimize the noise levels.


operation

10.2 Use alternate route, wherever possible, that passes away from community. CC, SC, DC MPCL During the entire

operation

10.3 Campsite will be selected away from the human settlements and maintain a

minimum distance of 500 m. CC, SC, DC MPCL

During the entire

operation

10.4 Consent from respective local authority is mandatory prior to use of local

resources e.g. water CC, SC, DC MPCL Before start of work

10.5 All the mitigation measurements for the vehicles movement & waste

management mentioned above will be followed to avoid any disturbance. CC, SC, DC MPCL

During the entire

operation

11. Restricted Mobility

11.1 Ensure there should be no interaction with the local womenfolk. CC, SC, DC MPCL During the entire

operation

Chapter 09 22 of 24




11.2 Project staff should respect local cultural norms. CC, SC, DC MPCL During the entire

operation

11.3 Project crew should be restricted to work corridor CC, SC, DC MPCL During the entire

operation

11.4 Limit the social interaction between the project team and local communities in

order to avoid disputes between the construction team and locals. CC, SC, DC MPCL

During the entire

operation

12. Community Grievance/Complaints

12.1 Grievance handling system will be established to address community

grievance/complaints. MPCL MPCL

During the entire

operation

12.2 A social complaint register will be maintained on site by MPCL. All complaints

received from local communities shall be noted. MPCL MPCL

During the entire

operation

12.3

Community complaints shall be duly addressed and appropriately resolved. The

measures taken to mitigate these concerns will also be noted in social complaint

register.

MPCL MPCL During the entire

operation

13. Archaeological, Cultural and Religious Sites

13.1 Ensure all project activities will be carried out away from any archaeological,

cultural and religious site, if any. MPCL MPCL

During the entire

operation

13.2 For all other sites of local significance e.g. Masjids, graveyard etc. a safe distance

(determined after consultation with locals) will be maintained. MPCL MPCL Before start of work

Chapter 09 23 of 24




13.3 Safe distance should be maintained to avoid any physical damage, change in

aesthetic value, or disrespect to any site of archaeological or religious importance. MPCL MPCL

During the entire

operation

13.4

Any sudden discovery of any such site of archaeological, cultural and religious

importance during project activities shall be communicated to project proponent

for further intimation to relevant department.


operation

14. Community Safety

14.1 Project vehicles should follow speed limits which will reduce road safety issues

significantly. CC, SC, DC MPCL

During the entire

operation

14.2 Safe driving practices will be adopted while passing through settlements. CC, SC, DC MPCL During the entire

operation

14.3 Explosives should be stored in an isolated and clearly marked area. The area

should be constructed keeping in view community and campsite safety. CC, SC, DC MPCL

During the entire

operation

14.4 Local people will be informed about project activities in order to keep locals

especially children away from project area. CC, SC, DC MPCL

During the entire

operation

15. Emergencies And Accidents

15.1 Ensure emergency response plan should be developed and implemented to cater

different emergency situation as mentioned in respective section of the report. MPCL MPCL, IMC

During the entire

operation

15.2 Ensure project related staffs are well aware and trained on emergency response

plan. CC, SC, DC MPCL

During the entire

operation

Chapter 09 24 of 24




15.3 Ensure provision of first aid at site in case of any emergency. CC, SC, DC MPCL During the entire

operation

16. Employment

16.1

MPCL and its contractors should employ local residents for semi skilled and

unskilled opportunities and wherever possible, for skilled jobs during the project

cycle.


operation

16.2 Local residents living closest to the project location will be given priority in the

employment process. CC, SC, DC MPCL

During the entire

operation

16.3 Labour from local communities will be recruited equitably among the tribes and

the employment procedures will be transparent. CC, SC, DC MPCL

During the entire

operation

IMC : Independent Monitoring Consultant

DC : Drilling Contractor

MPCL : Mari Petroleum Company Limited

SC : Seismic Contractor

Chapter 10 1 of 2


10 CONCLUSION

Pakistan is facing severe energy crisis and looking for various options to meet the growing

energy demand. Pakistan’s energy demand over the next 15 years is expected to grow at a rate

of 4.4% to 6.1% per annum based on the projected economic growth and is likely to be in the

range of 115 to 148 MTOE by 2021-22.

Oil and Gas are major components of Pakistan's energy mix meeting over 80% of energy needs.

Around 80% of Pakistan’s crude requirements are met through imports, which is a severe

burden on its foreign exchange reserves.

There is, therefore, a vital need to explore for additional energy reserves and further develop

existing fields. The proposed project will help towards achieving this objective and will

contribute to reduce Pakistan’s energy demand.

SGS Pakistan successfully materialized the EIA study of the proposed project. The study was

based on baseline environmental and socioeconomic information which was collected from a

variety of sources, including reports of previous studies, desk studies, census report etc. All

adequate requirements have been addressed in this EIA report, which has a viable length

covering the following:

• The proposed project activities

• Environmental conditions of the proposed site and its surroundings

• Legislative requirements related to the project

• Significant environmental impacts of the proposed project activities on the physical,

biological and socio-economic receptors

• Mitigation measures in order to reduce any impact on physical, biological and socio-

economic receptors

• An EMP has been provided that will help in effective implementation of the mitigation

measures.

This environmental study has fully examined the potential environmental impacts due to

proposed project activities. Mitigation measures that required minimizing or obviating these

impacts is also suggested.

It is therefore concluded that

“Proposed seismic and drilling activities with associated seismic data acquisition, construction

and drilling work has low intensity adverse impacts, likely to be of short term duration, minor

and of local consequence and are insignificant. A vigilant implementation of mitigation

measures and Environmental Management Plan (EMP) will ensure that environmental impacts

are managed and minimized and are within acceptable limits.”

Chapter 10 2 of 2


Moreover, proposed project activities will not lead to pose adverse environmental impacts, if

suggested mitigation measures and EMP is implemented effectively.

Chapter 11 1 of 4


11 REFERENCES

The information provided in this EIA report has been collected from a variety of sources,

including reports of previous studies conducted by SGS, published literature, and secondary

sources. All these references are presented in this section.

• 1998 District Census Report of Thatta, Population Census Organization, Statistics Division,

Government of Pakistan, Islamabad, February 2000

• Buset, P., Riiber, M., (2001) "Jet Drilling Tool: Cost-Effective Lateral Drilling Technology for

Enhanced Oil Recovery ",SPE 68504, SPE, SPE/ICoTA Coiled Tubing Roundtable, 7-8

March 2001, Houston, Texas

• DOE, 1999, "Environmental Benefits of Advanced Oil and Gas Production Technology,"

DOE-FE-0385, U.S. Department of Energy, Office of Fossil Energy, Washington, DC

• Environmental Legislation in Pakistan and the OECD Guidelines for Multinational

enterprises: A Gap Analysis.

• Environmental Law in Pakistan – Part 1 by IUCN.

• Environmental Management in Oil and Gas Exploration and Production-an Overview of

Issues and Management Approaches. Joint Technical Publication of E&P Forum and

UNEP.

• Pakistan Petroleum Exploration Promotion Conference, 2012, Ministry of Petroleum and

Natural Resources.

• Investment Opportunities in Pakistan’s Upstream Oil and Gas Sector-Ministry of

Petroleum & Natural Resources Government of Pakistan.

• Akber, G and S. Fatima. 2012. Folral guide, Indus ecoregion, Indus for All Programme,

WWF - Pakistan

• Ali, S.I. and Y.J. Nasir. 1989-1991. Flora of Pakistan, fascicles nos.191-193. Department of

Botany, University of Karachi and PARC, Islamabad.

• Ali, S.I. and Y.J. Nasir. (Eds.). 1989-1992. Flora of Pakistan. Nos. 191-204. Islamabad,

Karachi.

• Ali, S.I. and M. Qaiser. (Eds.). 1993-2009. Flora of Pakistan. No. 191-217. Islamabad,

Karachi.

• Ali, S. I. and M. Qaiser. 1986. A phytogeographical analysis of the phanerogams of Pakistan

and Kashmir. Proceedings of the Royal Society of Edinburgh. Pp: 89-101.

• Amjad, S and S. Qidwai. 2002. Freshwater, brackish water and coastal wetlands of Sindh. A

Status Paper. National Institute of Oceanography, Karachi, Pakistan.

Chapter 11 2 of 4


• Anwar, F. 2004. Freshwater Resources of the Indus Delta Eco-region. In: Proceedings of the

consultative workshop on Indus Delta Eco-region (IDER), WWF Pakistan. Karachi. Pp. 17-

37

• Blatter, E., C. McCann, and T. S. Sabnis. 1929. The flora of Indus Delta. The Indian Botanical

Society. The Methodist Publishing House, Madras, India. P.173.

• Chaudhri, I.I. and M.S. Chuttar. 1966. The vegetation and range Flora of Thar desert, W.

Pak. Forest dept., Hyderabad.

• Donaldson, J. S., Mills, A., O'farrell, P., todd, S., Skowno, A. and Nanni, I. 2003.

Conservation Farming with biodiversity in South Africa; A preliminary evolution of

ecosystem goods and services in the Bokkeveld Plateau. In: Lamons, J., Victor, R., and

Schaffer, D. (Eds.) Conserving Biodiversity in Arid regions. Kluwer academic Publishers.

Foreverindus.org/ Indus ecoregion.

• Gregory L. Possehl. (eds.) The Indus civilization. A Contemporary Perspective. AltaMira

Press. 2002.

• Gregory, S.V., Swanson, F.J., McKee, W.A., and Cummins, K.W. 1991. An ecosystem

perspective of riparian zones. BioScience 41: 540-551.

• Hassan, M. H. A. 2003. Preface In: Lamons, J., Victor, R., and Schaffer, )

• Hoekstra, D. A., N. Mahmood., G. R. Shah, W. A. Shah., M. A. Domki., and Q. M. Ali 1997.

Diagnostic study Indus Delta Mangrove ecosystem. Main sub-system characteristics,

problems, potentials, proposed interventions and pilot sites. Sub-project. RRIDM (World

Bank/GoS funds) 76 pp.

• Hughes. A. W. Gazetteer of the Province of Sindh, G. Bell (London) 1876.

• Ismail, S., Saifullah S.M. and Khan S.H. 2006. Assessment of Chromium in the water and

Sediments of Indus Delta Mangroves. . Soc. Pak. (28) 426-429. D. (eds. Conserving

Biodiversity in Arid regions. Kluwer academic Publishers Jour. Chem

• Ishaque, M. Memon, A. and Shahani, N. M. 1986. Annual research report, Survey and

domestication of wild plants in Sind, Pakistan. Department of plant breeding & genetics,

Sindh Agriculture University, Tandojam.

• IUCN, 2004. Sindh State of Environment & Development, Karachi, Pakistan.

• IUCN, 2007. Sindh Strategy for Sustainable Development, Karachi, Pakistan.

• Jafri, S.M.H. 1966. The Flora of Karachi. The Book Corporation, Pakistan.

• Meynell, Peter-Jhon and Qureshi, M. T. 1995. Water resources and management in the

Indus river delta, Pakistan. Parks 5: 15-23.

• Nasir, E. and S.I. Ali. 1969-1989. Flora of Pakistan. No. 1-190. Department of Botany,

University of Karachi.

Chapter 11 3 of 4


• Qazi, J. History, Logic, Law and Politics of water and Indus. In: IBRAT (Newspaper). 2003.

• Qureshi, R. 2004. Floristic and Ethnobotanical Study of Desert Nara region, Sindh. (Ph.D.

Thesis), Department of Botany, Shah Abdul Latif University, Khairpur, Sindh, Pakistan.

Vol. I-II:1-454 pp.

• Qureshi, S. in Nasir, E and Ali, S. I. eds (1972) Flora of Pakistan No 29 ( ), Department of

Botany, University of Karachi.

• Shinwari, Z. K., Watanabe, T., Rehman, M., Yoshikawa, T. 2006. A Pictorial Guide to

Medicinal Plants of Pakistan. Kohat University of Science and Technology, Kohat.

• Smyth, J. W. Gazetteer of the Province of Sind. B (1). The Government Central Press,

Bombay. 1919.

• Stewart, R. R. 1982. Flora of Pakistan. History and exploration of flora in Pakistan and

adjoining areas. E. Nasir and S. I. Ali (eds.) National Herbarium, PARC, Islamabad. Pp 8-

14.

• Swanson, F. J., Kratz, T. K., Caine, N., and Woodmansee, R. G. 1988. Landform effects on

ecosystem pattern and processes. _ BioScience 38: 92-98.

• Urban, L., Bridgewater, S.G. M., and Harris, D.J. 2006. The Macal river: A floristic and

phytosociological study of a threatened riverine vegetation community in Belize.

Edinburgh Journal of Botany 63: 95 - 118.

• Wani, Bashir Ahmed, Hakim Shah and Saliheen Khan. 2004. Forestry statistics of Pakistan.

Pakistan forest Institute, Peshawar.

• Wells, J. T. and Coleman, J. M. 1984. Deltaic morphology and sedimentology, with special

refrence to the Indus River Delta. In: Haq, B. U. and Milliman, J. D. (eds.) Marine Geology

and Oceonography of Arabian Sea and Coastal Pakistan. Van Nostrand reinhold Co.,

NewYork. Pp. 85-100. Salvadoraceae Wikipedia.org/sindh

• Initial Environmental Examination of Exploratory Drilling Activities at Barkhan Block,

District Barkhan, Baluchistan. Prepared by SGS Pakistan.

• Initial Environmental Examination of Multiple Drilling Activities at Kandhkot Mining

Lease, Kashmore, Sindh. Prepared by SGS Pakistan.

• Initial Environmental Examination of Drilling of Hala-2 Exploratory Well in Hala Block,

Sindh. Prepared by Halcrow.

• McFarlane, K., Nguyen, V.T. 1991. The Deposition of Drill Cuttings on the Seabed. Health,

Safety and Environment in Oil and Gas Exploration and Production Conference, The

Hague, Netherlands

• Pakistan Energy Year Book, 2011- Hydrocarbon Development Institute of Pakistan.

Chapter 11 4 of 4


• Pakistan Meteorological Department, Climate Data Processing Centre, Government of

Pakistan. Sectoral guidelines for upstream petroleum sector Volume 2 of 2 - Prepared for

PEPCA.

• Asif Inam. Peter D Clift. The Geographic, Geological And Oceanographic Setting Of The

Indus River

• Annual Flood Report 2010. Government Of Pakistan Ministry of Water And Power

• Environmental Degradation and Impact on Livelihood Sea Intrusion, Case Study IUCN

• Study of Riverine Forest Upstream Sukkur And Downstream Kotri 2008 . K.K Consultants.

• Sindh State of Environment &Development IUCN

• http://www.eoearth.org/view/article/51cbee397896bb431f6963ce/

• Muhammad Rafique, Najam Ul Huda Khan, Distribution And Staus Of Fresh Water Fishes

Of Pakistan

• A. L Korai ,G.A. Sahato Fish Diversity in Relation to Physiochemical Properties of

Kheenjhar Lake ( Thatta District Sindh)

• Fresh Water Turtles Of Pakistan Illegeal Trade In Sindh November 2009 WWF Pakistan

• Integrating Wetland Economics Value Into Indus River Basin Management Indus Delta

Pakistan: Economic Cost Of Reduction In Fresh Water Flow. IUCN.

• Study. Sindh Irrigation Department Bio Saline Agriculture In Badin and Thatta Districts

Feasibility

• Muhammad Iqbal Sheikh 1993. Trees OF Pakistan

Eia sujawal

Environment

Transcript of Eia sujawal