Eia sujawal
-
Upload
zubeditufail -
Category
Environment
-
view
377 -
download
11
Transcript of Eia sujawal
MMMMMMMMAAAAAAAARRRRRRRRIIIIIIII PPPPPPPPEEEEEEEETTTTTTTTRRRRRRRROOOOOOOOLLLLLLLLEEEEEEEEUUUUUUUUMMMMMMMM CCCCCCCCOOOOOOOOMMMMMMMMPPPPPPPPAAAAAAAANNNNNNNNYYYYYYYY LLLLLLLLIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEEDDDDDDDD MMMMMMMMPPPPPPPPCCCCCCCCLLLLLLLL
DDDDDDDDrrrrrrrraaaaaaaafffffffftttttttt RRRRRRRReeeeeeeeppppppppoooooooorrrrrrrrtttttttt
DDDDDDDDaaaaaaaatttttttteeeeeeee:::::::: DDDDDDDDeeeeeeeecccccccceeeeeeeemmmmmmmmbbbbbbbbeeeeeeeerrrrrrrr 22222222000000001111111144444444
DDDDDDDDiiiiiiiivvvvvvvviiiiiiiissssssssiiiiiiiioooooooonnnnnnnn:::::::: EEEEEEEEnnnnnnnnvvvvvvvviiiiiiiirrrrrrrroooooooonnnnnnnnmmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaallllllll SSSSSSSSeeeeeeeerrrrrrrrvvvvvvvviiiiiiiicccccccceeeeeeeessssssss
SGS Pakistan (Private) Ltd.
EEEEEEEEnnnnnnnnvvvvvvvviiiiiiiirrrrrrrroooooooonnnnnnnnmmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaallllllll IIIIIIIImmmmmmmmppppppppaaaaaaaacccccccctttttttt AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssssmmmmmmmmeeeeeeeennnnnnnntttttttt ((((((((EEEEEEEEIIIIIIIIAAAAAAAA))))))))
SSSSSSSSttttttttuuuuuuuuddddddddyyyyyyyy ooooooooffffffff EEEEEEEExxxxxxxxpppppppplllllllloooooooorrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnn AAAAAAAAccccccccttttttttiiiiiiiivvvvvvvviiiiiiiittttttttiiiiiiiieeeeeeeessssssss iiiiiiiinnnnnnnn SSSSSSSSuuuuuuuujjjjjjjjaaaaaaaawwwwwwwwaaaaaaaallllllll
BBBBBBBBlllllllloooooooocccccccckkkkkkkk //////// SSSSSSSSiiiiiiiinnnnnnnnddddddddhhhhhhhh
Executive Summary i of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
EXECUTIVE SUMMARY
Mari Petroleum Company Ltd (MPCL) was granted exploration license for the Sujawal Block
(EL-2467-11) Sindh in June 2006 with 100% working interest. In order to carryout Exploration &
Production activities, MPCL conducted an IEE study in August 2007 for a proposed area and
was granted NOC/approval from SEPA in November 2007. Subsequently, MPCL carried out
Seismic data acquisition in the year 2008.
Now, MPCL intends to further amplify the exploration activities including 2D/3D seismic
survey and drilling activities at Sujawal Block (EL-2467-11), after fulfilling the associated
environmental regulations. MPCL has contracted SGS Pakistan (Private) Limited (SGS) to carry
out environmental assessment of the proposed activities in order to assess the environmental
viability of the same. This report has been prepared in accordance with the requirements set-
forth in Sindh Environmental Protection Act 2014 (SEPA), the Pakistan Environmental
Protection Agency (Review of IEE ad EIA) Regulations, 2000 and the guidelines provided in the
Pakistan Environmental Assessment Procedures, 1997. Section-17 of SEPA 2014 which states
that: "No proponent of a project shall commence construction or operation unless he has filed with the
Agency an initial Environmental Examination or Environmental impact Assessment, and has obtained
from the agency approval in this respect thereof”.
The Pakistan Environmental Protection Agency (Review of EIA/IEE) Regulations 2000 clearly
defines the categories of projects requiring an Initial Environmental Examination (IEE) or
Environmental Impact Assessment (EIA) referred to in Schedules I & II respectively. According
to Schedule II, Category I (Environmentally Sensitive Areas), defines that the projects situated
in environmentally sensitive area require an EIA. The EIA study has been carried out in
consideration of:
• Major concerns on the microenvironment in which the project is proposed to be sited;
• Construction and operational phase impacts being confined to and localized into the
microenvironment;
• Sujawal block encompasses number of wildlife protected and reserve forest areas including
Mirpursakro (Game Reserve), Cut Munarki Wildlife Sanctuary, Bijora Chach Wildlife
Sanctuary, Gullel Kohri Wildlife Sanctuary, Munarki Wildlife Sanctuary and Sadnani
Wildlife Sanctuary and most of the protected areas are located along Indus River including
Reserve forests.
Mari Petroleum Company Limited is one of Pakistan’s largest E&P companies operating the
country’s 2nd largest gas reservoir at Mari Field, District Ghotki, Sindh. The Company is
primarily engaged in exploration, development and production of hydrocarbon potentials
(Natural gas, Crude oil, Condensate & LPG) in the country. MPCL is also exploring
opportunities of expanding its business to become a significant player in the International
hydrocarbon Market. At present, in addition to Mari Gas Field, MPCL operates nine exploration
blocks (Ziarat, Hanna, Harnai, Sukkur, Sujawal, Karak, Ghauri, Peshawar East and Khetwaro)
Executive Summary ii of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
and one D&P Lease (Zarghun South). The Company is also a non-operating joint venture
partner in six exploration blocks (Kohlu, Kalchas, Kohat, Bannu West, Zindan and Hala).
Moreover, the Company is also joint venture partner in block 43B with 25% working interest in
Oman with MOL.
MPCL is planning to conduct further exploration work including seismic (2D/3D) and drilling
activities in Sujawal Block. The Block is located in district Thatta and Sujawal of Sindh, having a
total area of about 2,416.43 square kilometres (km2), whereas, reserve forest areas of the block
comprises of about approximately 570.23 km2. MPCL is planning to acquire 2D seismic data in
approximately 320 Line km (L. Km) and 900 sq. km for 3D data, followed by drilling activity. It
is envisaged that one well will be drilled on the basis of seismic survey data, most probably at
eastern part of the block.
The project duration for construction and operation for drilling well is expected to take 5-6
months. The drilling schedule for well operation is expected to be as under:
Seismic Activities: 24 weeks
Construction Work: 12-16 weeks
Mobilization: 3-4 weeks
Drilling and Testing: 12-16 weeks
Demobilization: 2-3 weeks
The project shall require approximately 1700 gallons of water per day and 2,500 litres of fuel per
day during construction phase and seismic activities respectively and approximately 50,000 to
60,000 gallons of water per day & 8,000-12,000 litres of fuel per day during Operation/Drilling
Phase.
The project area falls in the district Thatta and Sujawal of Sindh province. The district is
bounded in the north by Dadu district, in the south by Runn of Katch area, in the east by
Hyderabad and Badin Districts and in the West by Karachi Division. Total area of both districts
is 17,355 km2 and comprises of 9 talukas, out of which six are coastal and three are non coastal
talukas; and 53 Union Councils. District Sujawal consists of Taluka Mirpur Bathoro, Shah
Bander, Kharochan, Jati and Sujawal, while, District Thatta consists of Taluka Mirpur Sakhro,
Ghorabari, Keti Bandar and Thatta. Among these talukas, EIA study area spreads over in
Mirpur Sakhro, Mirpur Bathoro, Jati Sujawal, Thatta and Ghorabari. Talukas of the districts.
The macro-environment of the project area i.e. district Thatta and Sujawal have varied features
in its physical aspects, which range from coastal swamps to fresh water marshes and lakes and
from river islands to coastal deltas. The current terrain of the districts consists of the Makli Hills
in the vicinity of Thatta town. These hills are 32 km in length and are well known on account of
the ancient tombs which are located here. The north western part of the district consists of hilly
tracts known as Kohistan. Between Sir and Khori Creeks lie the great Sirganda salt deposits
Executive Summary iii of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The Lower Indus Platform Basin is bounded to the north by the Central Indus Basin, to the
northwest by the Sulaiman Foldbelt Basin and the Kirthar Fold Belt Basin in the south west.
The climate of the Thatta, Sujawal district is moderate. The mean maximum and minimum
temperature recorded about 40°C and 25°C respectively. The sea breeze blows for eight months
of the year, from March to October, making the hot weather comparatively cool. January is
recorded as the coldest month of the year. The annual average rainfall of the district is recorded
as approximately 200 mm.
Besides Indus, the district Thatta/ Sujawal has numerous water courses which drain from the
hills and are known as Nais. The important Nais is the district is Gagar and Ranpathani. There
are many lakes in the district. The famous are Kalri and Haleji. Kalri is a picturesque lake,
situated about 19 Km south of Thatta. It was formed by joining of two lakes Kinjhar and
Sonehri, and takes its present name from the main canal Kair-Bagha feeder, from which it is
currently fed. This lake acts as a great reservoir for feeding canals of Thatta sub-division. In
project area natural and manmade wetlands exist in which rain or flood and irrigated waste
water is stored. These wetlands are commonly called Dhands. Wetlands have mechanism to
provide shelter to different animals, reptiles, fish and bird’s species & preservation of bio-
diversity. Ground water is available in the project area for domestic and drinking purposes.
Main source of recharging groundwater is Indus River while, ground water table in project area
varies from 20 ft to 60 ft.
The air quality in the area is generally good, with negligible sources of pollution like emissions
from vehicular traffic that causes smoke and dust emissions with localized effect. Elevated noise
is viably absent in project proximities due to absence of noise causing equipments in the project
corridors.
The block has been occupied by agricultural settlements comprising of sugarcane, cotton,
wheat, tomato banana plantations & seasonal vegetables. The macro-environment along the
north east and north west part of the project area is occupied, mainly by agricultural fields and
human settlements. The agricultural lands are spread over both sides of the road leading to
major and minor settlements in the area.
The project area is located in the eastern and western side of the Indus River, where there is a
number of Reserve Forests. The one major forest type that falls within the study area is Riverine
forest along the banks of the Indus. Major species of the Riverine forest are Babul or Kiker
(Acacia nilotica), Kandi (Prosopis cineraria) Bahun ( Prosopis euphartica) and Lai (Tamarix
Spp.). Acacia nilotica is the most common species in the project area, while Prosopis Spp. is also
fast growing in the project area.
The common and widespread species of birds includes: Common Myna, Bank Myna, Common
Kite, House Crow, House Sparrow, White-cheeked Bulbul, Ring Dove and Little Brown Dove.
During our field visit 18 mammals, 41 birds and 14 reptiles’ species were reported/observed
within the project area. A small number of migrant species of birds was also recorded in the
area. About 08 species of migratory birds were observed in the project area which is, Common
Executive Summary iv of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Kestrel, Common Sandpiper, Pale Crag Martin, Common Swallow, Common Chiffchaff, Black
Redstart, White Wagtail and Yellow Wagtail.
According to the census of 1998 the population of Thatta district was recorded at 1.113 million.
The population of project area distributed among urban and rural areas. According to 1998
Cenus report, 11 percent population is characterized as urban and remaining 89 percent is rural.
Current population (2014) of the both the districts is estimated to be 1.6 million. The estimated
population density is 92 person sq. km. The recent (2013-14) literacy rate for both the districts is
36 percent, among them 48 percent are males and 23 percent are females.
People of different castes dwell in the project area. It includes Shora, Khaskheli, Panhwar,
Khuwaja, Baloch, Chandia, Alwani, Otha, Awan, Lashari, Kalmati, Jokhia, Dul, Sayyed, Jat,
Samo, Mallah, Mirbahar, Soho, Rind, Khalifa, Lothya, Halayo, Burfat, Memon, Shaikh, Nahiyo,
Zangiani, Gaho, Sheedi, Palari and Solangi. Majority are Muslims and Sindhi speaking; while a
few are non- Muslims specially scheduled castes of Hindus.
The western boundary of Sajawal block falls inside the declared protected area i.e. Marho
Kotri Wilde life Sanctuary.
The proposed study has been carried out to take into an account likely positive and negative
impacts of exploration activities on the physical, biological and social environment. The
assessment was primarily focused on the impact of activities due to construction at camp site,
well site seismic and drilling operation on the physical, biological and social environment. The
major areas covered in the impact analysis include wastewater, solid waste, biodiversity, water
resources and socioeconomic factors as well as occupational health safety.
A detailed assessment of the environmental issues due to each impact has been carried out.
After assessment of potential impacts, if the predicted impact is classified as significant, suitable
mitigation measures will be suggested to reduce the consequences or likelihood of occurrence
of that particular impact. There is a range of mitigation measures that will be applied during the
different phases of proposed project which can reduce adverse environmental, biological and
social impacts.
Potential impacts of the project are identified by utilizing different means and ways including
desktop screening exercise, using checklist during field visit for collection of baseline data,
professional judgment, published literature on environmental impact of similar projects and
environmental guidelines. It is identified the project activities may involve the clearing of land
for campsite and access track which can cause dust emissions, erosion of land, and generation
of construction waste, noise and damage to the surrounding structures. This may be avoided by
proper management and planned as suggested in Environmental Management Plan. The
seismic and drilling activities generate waste and noise which may affect the water resources,
soil, air biodiversity and the local community settled in the vicinity of the project. Therefore it is
suggested that work may be avoided or kept to minimum at night to avoid community and
wildlife disturbances with reference to noise. To keep the disturbance level at minimum it is
advised to maintain a fair distance from community and water bodies as much as possible.
Executive Summary v of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The effect of vegetation clearing and loss of habitat is less significant for development activities
because campsite will be constructed at existing cleared land wherever possible, dense patches
of vegetation will not be removed and new tracks will be avoided as much as possible. Loss of
vegetation will be observed mainly for the development of access track. However, mitigation
measures recommended will ensure that the impacts are kept to the minimum possible.
Improper waste management practices will favour waste accumulation in nearby environment
and may deteriorate aesthetical and environmental conditions of the project site and requires
serious consideration. Surface water quality may deteriorate if pollutants are mixed with
surface runoff during rain and carried to water resources in the vicinity.
The sources of emissions during construction and drilling will not be significantly enough to
alter the ambient air quality. The existing air quality in the area is generally good, with very few
sources of pollution and dust emissions with localised impact.
Emissions in the form of oxides of carbon, nitrogen and sulphur will be produced during
flaring. Flaring is a much better environmental option than venting. As the flare will be kept
downwind of the well site and at least 300 m away from any community no impacts on
communities or workers will occur.
Vehicular movement is not a continuous activity which could cause continuous impacts on
wildlife and local community. As the project facilities will maintain appropriate distances from
human settlements, disturbance to local community due to dust, noise and accident because of
vehicular movement will be insignificant.
The impacts on community due to proposed project are negligible as compared to the potential
improvement of social status of the community as a result of generation of new employment
opportunities. There will be positive impact on sanitation, transportation, communication and
community health due to development in the project area.
Failure to maintain the appropriate project activity distance from the local communities may
possibly create disturbance due to noise, dust, vehicular movement, and improper disposal of
waste generated due to project activities. Access track passing close to the settlement may also
result in disturbance to the locals. Moreover, sharing of local resources may be the point of
conflict between project proponent i.e. MPCL, and local community. All these impacts due to
seismic, construction and drilling activities would be of variable significance that would be
minimized through MPCL Cooperate Social Responsibility (CRS) Policy and through applicable
laws and regulation.
Mitigation measures have been proposed to minimize the environmental & social impacts.
MPCL shall watch over all activities and shall adopt mitigation measures so that the activities
are performed in an environmentally sound manner.
In addition to the impact assessment and mitigation measures suggested, the implementation of
environmental Management Plan (EMP) will be sufficient to mitigate potential environmental
impacts therefore, an EMP has been produced and compiled for the assistance of MPCL which
Executive Summary vi of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
shall supervise and monitor all the mitigation measures and their effectiveness. The overall
responsibility for compliance with the environmental guidelines and mitigation measures will
rest with MPCL. The contractor will have liabilities under the environmental laws and under
the contract with MPCL to follow the EMP and environmental guidelines.
Based on the environmental baseline and assessment of potential impacts, it has been concluded
that if the activities are undertaken as per suggested mitigation measures and Environmental
Management & Monitoring Plan is effectively implemented, the project activity will not cause
any significant impact on the natural environment, wildlife and local community of the Sujawal
Block.
Executive Summary vii of vii
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh
2014
Figure ES-I: Location Map of Sujawal Block along
Chapter 02 1 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
TABLE OF CONTENTS
EXECUTIVE SUMMARY 1
1. INTRODUCTION 1
1.1. Preamble 1
1.2. The Sujawal Block 1
1.3. Project Title 1
1.4. Project Proponent 1
1.5. Project Overview 2
1.6. Environmental Consultant 2
1.7. EIA Requirement 3
1.8. Project Categorization 3
1.9. Organization of the Report 4
1.10. Contact Details 5
2. SCOPE AND METHODOLOGY 1
2.1 EIA Process 1
2.1.1 Overview of EIA 1
2.1.2 Objective of EIA 1
2.1.3 Scope of EIA 1
2.2 EIA Methodology 2
2.2.1 Understanding of the Proposed Project 2
2.2.2 Legislative Review 2
2.2.3 Secondary Resources/ Baseline Review 2
2.2.4 Scoping Sessions 2
2.2.5 Approval for Field Visit 3
2.2.6 Site Visit and Primary Data Collection 3
2.2.7 Evaluation of Alternatives 3
2.2.8 Identification, Screening and Assessment of Impacts 3
Chapter 02 2 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
2.2.9 Impacts Assessment and Mitigation Measures 4
2.2.10 Environmental Management Plan 4
2.2.11 Reporting/Documentation 4
3. LEGAL FRAMEWORK 1
3.1 Constitutional Provision 1
3.2 Framework of Environment and Wildlife Institution in Pakistan 1
3.3 National Environmental Policies 2
3.3.1 National Environmental Policy, 2005 2
3.3.2 National Conservation Strategy 3
3.3.3 National Environmental Action Plan-Support Programme (NEAP-SP) 3
3.3.4 Policy & Procedures for the Filing, Review and Approval of Environmental Assessments 3
3.3.5 Petroleum Exploration & Production Policy 2012 3
3.4 National Environmental Legislation 4
3.4.1 Sindh Environmental Protection Act 2014 5
3.4.2 Pakistan Environmental Protection Agency Review of IEE and EIA Regulations, 2000 6
3.4.3 The National Environmental Quality Standards (NEQS) 6
3.4.4 Self-Monitoring & Reporting Rules 6
3.5 The Forest Act 1927 6
3.6 Sindh Wildlife Protection Ordinance, 1972 (SWPO) and Amendments 2001 7
3.7 Sindh Fisheries Ordinance, 1980 7
3.8 Petroleum Act 1934 8
3.9 The Mines Act 1923 8
3.10 Regulation of Mines and Oil Fields and Mineral Development (Government Control)
Act, 1948 9
3.11 Exploration and Production Rules, 1986 9
3.12 The Oil and Gas (Safety in Drilling and Production) Regulations, 1974 9
3.13 Antiquities Act 1975 and the Sindh Cultural Heritage (Preservation) Act, 1994 9
3.14 Land Acquisition Act, 1894 10
3.15 Pakistan Penal Code (1860) 10
Chapter 02 3 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.16 Explosive Substances Act 1908 10
3.17 Explosives Act 1884 11
3.18 National Environmental Guidelines 11
3.18.1 The Pakistan Environmental Assessment Procedures, 199 11
3.18.2 Guidelines for Operational Safety, Health and Environmental Management, December 1996 12
3.18.3 Guidelines for Public Consultation 12
3.18.4 Sectoral Guidelines for Environmental Reports Oil & Gas Exploration and Production 12
3.19 International Guidelines 12
3.19.1 World Bank Guidelines on Environment 12
3.19.2 IFC Performance Standards 13
3.19.3 IFC Environmental, Health & Safety Guidelines 13
3.20 International Conventions & Treaties 14
3.20.1 International Convention on Biodiversity 14
3.20.2 The Convention on Conservation of Migratory Species of Wild Animals, 1979 14
3.20.3 The Convention on Wetlands of International Importance, Ramsar 1971 14
3.20.4 Convention on International Trade in Endangered Species of Wild Fauna and Flora (Cites) 15
3.20.5 International Union for Conservation of Nature and Natural Resources (IUCN) Red List 15
3.21 International and National Environment and Conservation Organization 16
3.22 MPCL Corporate Requirements 16
4 PROJECT DESCRIPTION 1
4.1 Introduction 1
4.2 Project Need 1
4.3 Project Objective 2
4.4 Project Area 2
4.5 Proposed Project 2
4.6 Seismic Operations 3
4.7 Methodology for Seismic Survey 3
4.7.1 Camp Site Selection and Access Track 4
4.7.2 Camp Establishment and Mobilization 4
Chapter 02 4 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.7.3 Land Permitting: 4
4.7.4 Line Survey and Preparation: 4
4.7.5 Data Acquisition: 7
4.7.6 Restoration and Rehabilitation: 9
4.7.7 Accommodation and Suites: 10
4.8 Drilling Operation 10
4.8.1 Sujawal block EL Construction Phase 10
4.8.2 Civil Work Activities 10
4.9 Well Drilling Operation Phase 12
4.9.1 Rig Mobilization 12
4.9.2 Drilling Operation 12
4.9.3 Drilling Mud 13
4.9.4 Disposal of Drilling Wastes 16
4.9.5 Well Completion 16
4.9.6 Well Evaluation and Testing 16
4.9.7 Well Control and Blow Out Prevention 16
4.9.8 Accommodation and Supplies: 17
4.10 Decommissioning/ Restoration Phase 17
4.10.1 Demobilization 17
4.10.2 Restoration 17
4.11 Project Schedule 18
4.12 Resource Usage and Requirement 18
4.12.1 Recruitment 18
4.12.2 Water Requirement 19
4.12.3 Electricity Requirement 19
4.12.4 Fuel Requirements 19
4.12.5 Vehicle Requirements 19
4.13 Waste Generation and Disposal 20
4.13.1 Solid Waste 20
Chapter 02 5 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.13.2 Wastewater 20
4.13.3 Drill Cutting and Mud Waste 20
4.14 Fire and Emergency Preparedness Plan 21
4.15 Health, Safety and Environmental Management 21
5 PROJECT ALTERNATIVES 1
5.1 Project Alternatives 1
5.1.1 No Project Option 1
5.1.2 Drilling Technologies 1
5.1.3 Drilling Mud System 4
6. ENVIRONEMNTAL AND SOCIAL BASELINE 1
6.1. Physical Environment 1
6.1.1. Geography 1
6.1.2. Topography 2
6.1.3. Geology 3
6.1.4. Climatology and Meteorology 6
6.1.5 Water Resources 12
6.1.6. Air Quality 15
6.1.7. Noise 15
6.2. Vulnerability to Natural Disaster/ Cyclones and Floods 19
6.3. Biological Environment 23
6.3.1 Methodology 23
6.3.2 Ecology of Microenvironment of Project Area 23
6.3.3 Protected Areas 26
6.3.4 Flora 26
6.3.5 Fauna 33
6.4. Socio-Economic Environment 45
6.4.1 Data Collection Strategy 45
6.5. Description of the Project Area 45
6.6. Socio-Cultural Aspects 46
Chapter 02 6 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.6.1 Demography/Community Structure 47
6.6.2 Ethnicity/Tribes 47
6.6.3 Energy Supplies 47
6.6.4 Infrastructure 47
6.6.5 Transportation & Communication 48
6.7. Community Wellbeing 48
6.7.1 Livelihood 49
6.7.2 Agriculture & Livestock 49
6.7.3 Fishing 49
6.7.4 Other Occupations: 50
6.7.5 Health 50
6.7.6 Education 51
6.7.7 Water 52
6.8. Women Status & Gender Equity 52
6.9. Local Community Institutions 52
6.10. Archeological Sites 53
7. STAKEHOLDER CONSULTATION 1
7.1 Objective of Stakeholder Consultation 1
7.2 Identification of Stakeholders 2
7.3 Classification of Stakeholders 2
7.4 Methodology for Stakeholder Consultation 4
7.5 Consultation with Communities 5
7.5.1 Community Issues and Expectations 7
7.6 Consultation with other Stakeholder 7
7.6.1 Chief Conservator Sindh Forest Department 8
7.6.2 Director Sindh Fisheries Department 8
7.6.3 Conservator Sindh Wildlife Department 9
7.6.4 Sindh Environmental Protection Agency 9
7.6.5 Assistant Commissioner (AC) Sujawal 10
Chapter 02 7 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
7.6.6 Municipal Committee Thatta, District Thatta 10
7.6.7 Technical Advisor -WWF Pakistan 11
7.6.8 Health Department 11
7.6.9 Education Department 12
7.6.10 Social Welfare Department 13
7.6.11 Archaeology Department 13
7.6.12 National Rural Support Program 13
7.6.13 Coastal Community Development Department 13
7.6.14 SAFWCO 14
7.6.15 Care Takers of Pir Patho Dargah 14
8 IMPACT PREDICTION, EVALUATION AND MITIGATION MEASURES 1
8.1 Identification of Potential Impacts 1
8.2 Impact Assessment Criteria 2
8.3 Impact Assessment Methodology 2
8.4 Impacts Assessment for Design Phase 6
8.4.1 Project Designing 6
8.5 Impacts Assessment for Seismic and Drilling Phase 6
8.6 Impacts on Physical Environment 7
8.6.1 Topography & Soil 7
8.6.2 Water Resources 10
8.6.3 Ambient Air Quality 13
8.6.4 Noise Pollution and Vibration 15
8.6.5 Waste Generation 16
8.6.6 Vehicular Movement 20
8.7 Impacts on Biological Environment 22
8.7.1 Vegetation 22
8.7.2 Wildlife and Habitats 24
8.8 Socio Economic Impacts 27
8.8.1 Land Acquisition and Compensation 28
Chapter 02 8 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.8.2 Community Disturbance 28
8.8.3 Restricted Mobility 29
8.8.4 Community Grievances/Complaints 29
8.8.5 Archeological, Cultural and Religious Sites 30
8.8.6 Community Safety 30
8.8.7 Safety of Workers 31
8.8.8 Emergencies and Accidents 31
8.8.9 Employment 32
8.8.10 Local Economy 32
9 ENVIRONMENTAL MANAGEMENT PLAN 1
9.1 Introduction 1
9.2 Scope of the EMP 1
9.3 Purpose and Objectives of the EMP 1
9.4 Methodology 2
9.5 Components of the EMP 2
9.6 Legislation and Guidelines 3
9.7 Organizational Structure and Responsibilities 3
9.7.1 Project Proponent 3
9.7.2 Contractors 4
9.7.3 Regulators 4
9.7.4 Independent Monitoring Consultant (IMC) 4
9.8 Implementation Stages of EMP 4
9.8.1 Planning and Design Stage 4
9.8.2 Operational Stage 5
9.9 Change Management Plan 7
9.9.1 Changes to the EMP 8
9.9.2 Changes to the Operation 8
9.10 Waste Management Plan 9
9.11 Environmental Monitoring Plan 9
Chapter 02 9 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
9.12 Impacts Mitigation Plan 10
10 CONCLUSION 1
11 REFERENCE 1
ANNEXURES
Annexure I MPCL IMS Policy and Vision Mission Statement
Annexure II Sindh EPA Act 2014
Annexure III Pakistan Environmental Protection Agency (Review of IEE and EIA Regulation 2000)
Annexure IV National Environmental Quality Standard (NEQS)
Annexure V MPCL Waste Management Plan
Annexure VI MPCL Restoration Plan
Annexure VII Socio Economic Matrix
Chapter 02 10 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
LIST OF TABLES
Table 1.1. Project Study Team
Table 3.1 Relevant Environmental Laws and their Applicability
Table 4.1 Geological Co-Ordinates of Seismic Lines
Table 4.2: Project Schedule
Table 4.3 Workforce Required for Proposed Seismic & Drilling Activity
Table 4.4 Water Requirements during Project Activities
Table 4.5 Electricity Requirements for Camp & Rig Sites During Operations
Table 4.6 Fuel Requirements during Proposed Activities
Table 4.7 Vehicle Requirements during Proposed Activities
Table 7.1 List of Stakeholders
Table 7.2 List of Consulted Villages
Table 6.1 Soil Analysis Results
Table 6.2 Annual Rainfall Data
Table 6.3 Monthly Minimum Temperature Data
Table 6.4 Monthly Maximum Temperature
Table 6.5 Mean Monthly Wind Speed Data
Table 6.6 Mean Monthly Relative Humidity
Table 6.7 Summary of the Water Analysis Results
Table 6.8 Ambient Air Quality Monitoring Results
Table 6.9 Noise Level Monitoring Results
Chapter 02 11 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 6.10 Major Disaster History
Table 6.11 List of Wettest Cyclones/ Depressions in the Coastal Areas of Pakistan
Table 6.12 Cover Area Of Protected/ Reserve Area Of Project Area
Table 6.13 List of Floral Species of Project Area
Table 6.14 The List of Mammal Species
Table 6.15 List of Bird Species
Table 6.16 List of Reptiles
Table 6.17 List of Fish and Shrimps
Table 6.18 List of Heath Facility in Project Area
Table 6.19 List of Education Facility
Table 7.1 List of Stakeholders
Table 7.2 List of Villages Visited for Consultation
Table 8.1 Definitions for Consequence and Likelihood of Impacts
Table 8.2 Impact Significant Matrix
Table 8.3 Impact Assessment Criteria
Table 8.4 Impact Assessment Matrix
Table 9.1 Minimum Distance from Environmental Receptors
Table 9.2 Suggested Environmental Training
Table 9.3 Environmental Monitoring Plan
Table 9.4 Impact Mitigation Plan For Seismic, Construction And Drilling Phase
Chapter 02 12 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
LIST OF FIGURES
Figure 1.1 Location Map of Sujawal Block along
Figure 1.2 Proposed Seismic Survey
Figure 4.1 Pakistan Primary Energy Mix
Figure 4.2 Location of Seismic Lines within Sujawal EL Block
Figure 4.3 Shot Hole Drilling Operation
Figure 4.4 A Pictorial View of Geophones and Lying of Cables
Figure 4.5 Vibroseis Truck in Operation
Figure 4.6 Typical Drilling Site Layout (not to scale)
Figure 4.7 Pictorial View of Rotary Drilling Rig
Figure 4.8 Schematic Diagram of Mud Recycling System
Figure 6.1 Graphical Summary of Annual Rainfall Data of Last Six Year
Figure 6.2 Graphical Summary of Mean Annual Minimum & Maximum Temperature.
Figure 6.3 Graphical Summary of Mean Annual Wind Speed.
Figure 6.4 Graphical Summary of Mean Annual Relative Humidity.
Figure 6.5 Environmental Monitoring Location Map
Figure 6.6A to 66 E Forest Maps Provided by Sindh Forest Department
Figure 6.7 Biological Survey Map
Figure 6.8 Social Survey Map
Chapter 01 1 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
1. INTRODUCTION
1.1. PREAMBLE
This report presents the findings of an Environmental Impact Assessment (EIA) for the
Exploration Activities in Sujawal (2467-11) located in Sindh Province. The project proponent,
Mari Petroleum Company Limited (hereinafter referred as MPCL) has appointed SGS to
undertake this EIA.
The Mari Petroleum Company Ltd was granted exploration license for the Sujawal Block (EL-
2467-11) Sindh in June 2006 with 100% working interest. In order to carryout Exploration &
Production activities, MPCL conducted EIA study in August 2007 for a proposed area and was
granted NOC/approval from SEPA in November 2007. Subsequently, MPCL carried out Seismic
data acquisition in the year 2008.
MPCL intends to carry out further Exploration activities which include 2D/3D Seismic, drilling
and associated activities in the remaining part of the Block after fulfilling environmental
regulations.
1.2. THE SUJAWAL BLOCK
Sujawal Block lies in the South Western part of Sindh Province covering an area of 2416.43 sq.
km and fall in Sujawal and Thatta districts of Sindh province Pakistan (Figure-1.1).
1.3. PROJECT TITLE
This study is titled as “Environmental Impact Assessment of Exploration Activities in Sujawal
Block-Sindh”.
1.4. PROJECT PROPONENT
Mari Petroleum Company Limited is one of Pakistan’s largest E&P companies operating the
country’s 2nd largest gas reservoir at Mari Field, District Ghotki, Sindh. The Company is
primarily engaged in Exploration, development and Production of hydrocarbon potentials
(Natural gas, Crude oil, Condensate & LPG) in the country. MPCL is also exploring
opportunities of expanding its business to become a player in the International hydrocarbon
market.
Starting with just the production and sale of natural gas from a single field, the Company has
expanded its scope of business over the years. It now offers full spectrum exploration,
production and sale of oil, gas and other petroleum products in various concession areas, a feat
which required a change of name reflecting the extended scope of business.
Mari Gas Company Limited was incorporated in mid 80's by Fauji Foundation, Govt. of
Pakistan and Oil & Gas Development Corporation (now Oil & Gas Development Company
Limited) to take over the assets, liabilities and operation of Fauji Foundation (Mari Gas) and
Chapter 01 2 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Pak Stanvac Petroleum Project. The Company commenced business in its own name in
December 1984.
The Company was renamed Mari Petroleum Company Limited in November 2012. At present,
in addition to Mari Gas Field, MPCL operates nine exploration blocks (Ziarat, Hanna, Harnai,
Sukkur, Sujawal, Karak, Ghauri, Peshawar East and Khetwaro) and one D&P Lease (Zarghun
South). The Company is also a non-operating joint venture partner in six exploration blocks
(Kohlu, Kalchas, Kohat, Bannu West, Zindan and Hala). Moreover, the Company is also joint
venture partner in block 43B with 25% working interest in Oman with MOL.
Mari Petroleum Company Limited (MPCL) has made a gas/ condensate discovery at Sujawal X-
1 in the Sujawal Block located in Sindh Province. This success of the Sujawal X-1 is an addition
to the indigenous reserve base of the nation, which would ultimately result in saving of foreign
exchange. The first exploratory well in the block was spud-in on February 6, 2010 and was
drilled down to a depth of 3,000 meters in Lower Goru Formation of Cretaceous age. MPCL
IMS policy and vision mission statement given in Annexure 1.
Success Ratio of MPCL as Compared to Other E&P Companies
Name of Company No. of Exploratory
Wells Drilled
No. of
Discoveries Success Ratio (%)
MPCL 13 9 1: 1.44 (69.23%)
*Other E&P
Companies 757 228 1: 3.3 (30.1%)
*Source: Pakistan Energy Yearbook 2010 (Ministry of P & NR - HDIP)
1.5. PROJECT OVERVIEW
MPCL is planning to perform further exploration work in Sujawal block which includes both
seismic (2D/3D) and drilling activities (hereinafter referred as exploration activities). The Block
lies in Thatta & Sujawal districts of Sindh having a total area of about 2416.43 km2 whereas
reserves forest area of the block comprises of about approximately 570.23 km2. MPCL is
planning to acquire 2D seismic data in approximately 320L. Km and about 900 Sq. for 3D
followed by drilling of a deep well.
The EIA report covers approximately 320 Line Km (L. Km) of 2D and about 900 Sq. Km 3D
seismic operation and a drilling of deep well in Eastern part of the block. Location and vicinity
map of Sujawal block along with district boundaries is attached as Figure 1.1 while Figure 1.2
shows proposed seismic activities to be undertaken.
1.6. ENVIRONMENTAL CONSULTANT
MPCL has appointed SGS to carry out the Environmental Impact Assessment (EIA) study of the
proposed project activities in order to assess the environmental aspects of the project. SGS put
Chapter 01 3 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
together a team of consultants to complete the EIA project. The EIA project team comprises of
Ecologist, Environmentalist, Wildlife Expert, Environmental Chemist, Sociologist and Impact
Assessment Experts having diversified experience on local and international assignments. The
project team involved in this study are presented in Table 1.1.
Table 1.1: EIA Study Team
S. No. Name Responsibility in EIA Team
1. Ms. Tasneem Ilyas Project Director
2. Mr. Syed Faseeh Project Manager
3. Mr. Rafi ul Haq Lead Consultant-Senior Ecologist
4. Mr. Athar Khan Project Coordinator
5. Mr. Abdul Rehman Technical Report Writer
6. Dr. Ali Ghalib Wildlife Expert
7. Miss Fiza Qureshi Sociologist
8. Mr. Mumtaz Hassan Water Pollution Expert
9. Mr. Fahad Saleem Subject Expert/Technical Report Writer
10. Mr. Aamir Aziz Environmentalist/Technical Report Writer
11. Mr. Sajid Nazir Field Monitoring Team Leader
1.7. EIA REQUIREMENT
Sujawal block encompass number of wildlife protected areas including Mirpursakro (Game
Reserve), Cut Munarki Wildlife Sanctuary, Bijora Chach Wildlife Sanctuary, Gullel Kohri
Wildlife Sanctuary, Munarki Wildlife Sanctuary and Sadnani Wildlife Sanctuary and most of
the protected areas are located along Indus River including Reserve forests.
The EIA has been prepared to conform to the requirements of the Sindh Environmental
Protection Act 2014 (SEPA), the Pakistan Environmental Protection Agency (Review of IEE ad
EIA) Regulations, 2000 and the guidelines provided in the Pakistan Environmental Assessment
Procedures, 1997.
Section-17 of SEPA 2014 states that:
"No proponent of a project shall commence construction or operation unless he has filed with
the Agency an initial Environmental Examination or Environmental impact Assessment, and
has obtained from the agency approval in this respect thereof.
1.8. PROJECT CATEGORIZATION
The Pakistan Environmental Protection Agency (Review of EIA/IEE) Regulations 2000 evidently
define the categories of projects requiring an Initial Environmental Examination (IEE) or
Environmental Impact Assessment (EIA) in Schedules I & II respectively. As per IEE / EIA
Chapter 01 4 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Regulations, 2000, all projects located in environmentally sensitive or critical areas- including
Wildlife Sanctuaries, National Parks or Game Reserves- require an EIA.
Therefore an EIA study has been conducted for proposed project activities and the report will
be submitted to Sindh EPA for review and approval.
1.9. ORGANIZATION OF THE REPORT
This report has been structured in the following manner:
Executive Summary provides a synopsis of the EIA study.
Chapter 1 (Introduction) gives an overview of the project.
Chapter 2 (EIA Process and Methodology) gives an overview of the EIA process and
methodology.
Chapter 3 (Legal Framework) gives an overview of applicable national policies, and legislations
with international guidelines relevant to EIA of proposed project.
Chapter 4 (Project Description) provides the description of the proposed project, its layout plan
and associated activities, raw material details and utility requirement and project alternatives.
Chapter 5 (Project Alternatives) provides a discussion of the different alternatives considered
for the project.
Chapter 6 (Description of Baseline Environment) provides a description of the micro-
environment and macro-environment of the proposed project site. This chapter describes the
physical, ecological and socioeconomic resources of project area and surroundings.
Chapter 7 (Stakeholder Consultation) provide the details of stakeholder consultation
methodology and its findings.
Chapter 8 (Impact Assessment and Mitigation Measures) describes the potential
environmental and social impacts of proposed project on the different features of the micro and
macro-environment.
Chapter 9 (Environmental Management Plan) explains the mitigation measures proposed for
the project in order to minimize the impacts to acceptable limits. It also describes
implementation of mitigation measures on ground and monitoring of environmental
parameters against likely environmental impacts.
Chapter 10 (Conclusion) presents conclusion of EIA study.
Chapter 11 (References) provides references for the secondary data source.
The last Chapter is followed by series of Annexes that provide supporting information.
Chapter 01 5 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
1.10. CONTACT DETAILS
Client Consultant
Mari Petroleum Company Limited SGS Pakistan (Private) Limited.
Mr. Syed Faseeh
Manager-Operation & Business Development
21, Mauve Area, 3rd Road, G-10/4, H-3/3, Sector 5, Korangi Industrial Area
Islamabad, Pakistan Karachi, Pakistan.
Tel: +92 51-111-410-410 Tel: +92-21-35121388-95
Fax: +92 51-2352859 Fax: +92-21-35121329
Chapter 01 6 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 1.1: Location Map of Sujawal Block
Chapter 01 7 of 7
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 1.2: Proposed Seismic Survey Location
Chapter 02 1 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
2. SCOPE AND METHODOLOGY
2.1. EIA PROCESS
2.1.1 OVERVIEW OF EIA
EIA is a systematic process to identify, predict and evaluate the environmental impacts of
proposed actions and projects. This study suggests mitigation measures with practical approach
of implementation of these measures in the form Environmental Management Plan (EMP). The
process is applied prior to major decisions and commitments being made. Wherever
appropriate, environmental, social and safety impacts are also considered as an integral part of
EIA. Particular attention is given to practical implementation of EIA to prevent and mitigate
significant adverse effects of proposed undertakings.
2.1.2 OBJECTIVE OF EIA
The overall objective of this EIA study includes:
• To explicate the anticipated impacts of proposed intervention;
• Identification of potential environmental impacts;
• Screening of potential impacts to identify significant environmental impacts;
• Evaluation of significant environmental impacts;
• To find out environmentally viable project alternatives;
• To propose appropriate mitigation measures. Discussing appropriate mitigating methods;
2.1.3 SCOPE OF EIA
The scope of EIA is to examine the impacts that will possibly arise from the proposed
exploration activities which include seismic survey and drilling of deep well. This EIA covers
only this segment of the exploration programme and any further activities planned by MPCL
would be the question of separate EIA. This comprehensive EIA study would be carried out in
accordance with the requirements mentioned in the EPA Guidelines and includes:
• Assessment of physical, biological and socio-economic impacts of different stages of
proposed project activities.
• Contemplation of adverse environmental and socio-economic impacts, if any and
suggesting adequate mitigation measures.
• Development of Environmental Management Plan (EMP) which will provide practical
approach in order to manage adverse environmental and socioeconomic impacts, if any.
Chapter 02 2 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
2.2. EIA METHODOLOGY
The EIA project undergoes a series of stages prior to report preparation. The process and
approach followed for the proposed project is defined in the subsequence:
2.2.1 UNDERSTANDING OF THE PROPOSED PROJECT
This step requires collection of information from the proponent on the proposed project,
understanding of the project flow and identification of potential impacts associated with the
proposed activities. A sufficient amount of information regarding the proposed project and its
related activities was collected from MPCL.
2.2.2 LEGISLATIVE REVIEW
SGS team carried out the legislative review of applicable laws, regulations, guidelines and
standards which includes national legislation, international agreements, and environmental
guidelines. In addition, best industry practices were recommended consistent with the
environmental standards that the proponent will require to adhere to, during the different
stages of project.
2.2.3 SECONDARY RESOURCES/ BASELINE REVIEW
Environmental impacts are measured through changes in environment, resulting from a
designated action or activity. In order to identify such changes, it is essential to have as
complete understanding of the nature of existing environment, prior to its interaction with the
proposed activity. This translates into the need to characterize the existing baseline
environmental condition, including establishing prevailing conditions for a range of
environmental media, notably air, water, soil and groundwater, flora and fauna and the human
environment.
This was achieved through a detailed review of available secondary literature, the undertaking
of project specific baseline studies and surveys on physical, biological and socio-economic
environment of the project area. All data sources were reviewed to collect information relevant
to the physical, biological and socio-economic environment within the project area.
2.2.4 SCOPING SESSIONS
Scoping is a vital early step, which identifies the issues that are likely to be important during the
environmental assessment, and eliminates those that are not. Scoping is a process of interaction
between the interested public, government agencies and the proponent. Scoping refers to the
process of identifying the appropriate boundaries of the environmental assessment, the
important issues and concerns, the information necessary for decision making and the
significant impacts and factors to be considered. For scoping process, stakeholders were
carefully selected. The stakeholders included regulators, government representatives and
prominent Non Government Organizations (NGOs).
Chapter 02 3 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Meetings were held with the officials of Sindh EPA, Sindh Wildlife Department, Sindh Forest
Department, Sindh Fisheries Department, Archaeological Department, Assistant Commissioner
and Municipal officers, NGOs: WWF Pakistan, National Rural Support Program (NRSP), to
obtain a better understanding of the project area and its relevant features. All these
organizations provided assistance to the SGS team while conducting this EIA.
2.2.5 APPROVAL FOR FIELD VISIT
SGS team met with Chief Conservator Forest, Sindh Forest Department (SFD) and Conservator
Wildlife, Sindh Wildlife Department (SWD) Conservator Forest Department to obtain a better
understanding of the project area and its relevant features, as mentioned above. In addition,
SGS team obtained formal approval from these departments for baseline data collection within
riverine forest areas and wildlife protected areas. SGS team also requested for their
representatives to accompany SGS team during field visit.
2.2.6 SITE VISIT AND PRIMARY DATA COLLECTION
SGS team visited the project area and its vicinity from October 17 to 22, 2014 to conduct baseline
environmental survey. The team comprised of, ecologist, wildlife expert, environmental experts
and sociologist. During the site visit, primary information on the physical, biological and socio-
economic background conditions of the project area were collected. In addition, discussions
were held with the members of the community resident in the area to collect area-specific
primary information along with their views and concerns regarding the project and its
activities.
2.2.7 EVALUATION OF ALTERNATIVES
To ascertain an environmentally sound preferred option for achieving the objectives of the
proposed project, alternatives were studied in collaboration with the project proponent. All
alternatives which include no project option, alternative site, timing, and alternative
technologies were reviewed and discussed to establish the environmental soundness of the
operations. Technology selection was accomplished by considering options which were
environmentally, economically and socially suitable. A detail of alternatives has been provided
in section 7 of the report.
2.2.8 IDENTIFICATION, SCREENING AND ASSESSMENT OF IMPACTS
The information collected in the previous phases was used to assess and identify the major
issues of environmental concerns and indicate their relative importance to the design of the
project. Potential impacts arising from each phase of the proposed seismic, construction and
drilling activities were identified. The issues studied during impact assessment include
potential impacts on:
• Physical environment of the area
• Biological environment of the area
Chapter 02 4 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Socio-economic environment of the area
Screening and assessment of anticipated impacts, and those that are cumulative, unavoidable or
irreversible were also carried out. Impacts were identified particularly in the wildlife reserve
and assessed on the basis of field data collected from project area, secondary data and expert’s
opinion on the same.
2.2.9 IMPACTS ASSESSMENT AND MITIGATION MEASURES
One of the main tasks of impact assessment is to predict unacceptable adverse effects and their
prevention through the implementation of appropriate project modifications, also known as
mitigation measures. Mitigation measures are helpful to prevent or minimize all potential
adverse environmental impacts of proposed intervention.
Impacts are identified keeping in view the baseline condition of the project area and any change
due to proposed operations on the baseline environmental condition. Considering identified
impacts, appropriate and practicable mitigation measures have been recommended to
eliminate, minimize or compensate for the potential environmental and social impacts on the
project zone of influence.
2.2.10 ENVIRONMENTAL MANAGEMENT PLAN
Environmental Management Plan (EMP) has been developed in order to assist and enable
MPCL for effective management and implementation of mitigation measures. EMP will guide
them throughout the project lifecycle how to maintain environmental and social conditions and
implement occupational safety measures. This plan also delineates the information required to
manage environmental and occupational safety risks arising from proposed project activities as
well as social issues.
EMP will also include environmental monitoring plans in order to comply with local legislative
requirements.
2.2.11 REPORTING/DOCUMENTATION
The EIA report has been prepared under the guidelines issued by the Sindh Environmental
Protection Agency (SEPA) Act 2014 and submitted to SEPA. The organization of the report is
described in the preceding chapter.
Chapter 03 1 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3. LEGAL FRAMEWORK
This chapter provides an overview of the environmental policies, legislation, and guidelines
that may have relevance to the proposed project. These include national environmental policy,
legislation and guidelines; and international conventions and guidelines. MPCL will be
required to adhere to the relevant requirements of the policies and legislation during the
construction and operation of the proposed activities; which has also been incorporated in the
mitigation measures and the EMP provided in the EIA.
3.1 CONSTITUTIONAL PROVISION
According to the Constitution of Pakistan, the legislative powers lie with the federal parliament
and the legislative assemblies of the four provinces of Pakistan. The Fourth Schedule of the
constitution provides two lists of issues. One list, the Federal Legislative List, includes issues on
which only the federal government has legislative powers. The second list, the Concurrent
Legislative List includes issues on which both the federal and the provincial governments have
legislative powers. If a particular legislation passed by a provincial assembly comes into conflict
with a law enacted by the national assembly, then according to the constitution, the federal
legislation will prevail over the provincial legislation to the extent of the inconsistency. The
subject of ‘environmental pollution and ecology’ is included in the concurrent list of the
constitution. Thus, allowing both the federal and provincial governments to enact laws on the
subject. To date, only the federal government has enacted laws on environment, and the
provincial environmental institutions derive their power from federal law. Article 9 of the
constitution defines the right to life as a fundamental right in these words “No person shall be
deprived of life or liberty save in accordance with law”.
3.2 FRAMEWORK OF ENVIRONMENT AND WILDLIFE INSTITUTION
IN PAKISTAN
The Federal Ministry of Environment was the main government organization responsible for
the protection of environment and resource conservation. It was headed by a federal minister.
The Ministry worked with PEPC, and the Federal and Provincial EPAs formed under the PEPA
1997. The roles, responsibilities and authorities of PEPC and the EPA’s have been defined in the
PEPA 1997. However, after 18th constitutional amendment, the said ministry has been
devolved into provinces and Pakistan Environmental Protection Agency is working under the
umbrella of Climate Change Division.
Now, Pakistan Environmental Protection Agency is an attached department of the Climate
Change Division and responsible to implement the Pakistan Environmental Protection Act 1997,
in the country, an Act to provide for the protection, conservation, rehabilitation and
improvement of environment, for the prevention and control of pollution, and promotion of
Chapter 03 2 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
sustainable development. Pakistan Environmental Protection Agency also provides all kind of
technical assistance to the Climate Change Division.
The National Council for Conservation of Wildlife (NCCW) is responsible for formulation of
national wildlife policies, co-ordination with provincial wildlife department on the
implementation of these policies and co-ordination with international organisations on matters
related to international treaties/conventions. The NCCW works under the Ministry of Climate
Change and is headed by the Inspector General Forests. NCCW comprises of an advisory
council, which is chaired by the Minister of Climate Change and includes representatives from
all Provinces, AJK and Northern Areas, NGOs, members of civil society and other federal
ministries. A small NCCW secretariat is based in Islamabad handles the day-to-day affairs and
the implementation of policies and recommendations of the advisory council. At provincial
level almost each province has a wildlife department and a wildlife protection act.
3.3 NATIONAL ENVIRONMENTAL POLICIES
3.3.1 NATIONAL ENVIRONMENTAL POLICY, 2005
The National Environmental Policy (NEP) was approved by the Pakistan Environmental
Protection Council (PEPC) in its 10th meeting on 27th December, 2004 under the chairmanship
of the Prime Minister of Pakistan and thereafter approved by the Cabinet on 29th June 2005.
NEP is the primary policy of Government of Pakistan that addresses the environmental issues
of the country. The broad Goal of NEP is, “To protect, conserve and restore Pakistan’s
environment in order to improve the quality of life of the citizens through sustainable
development”. The NEP identifies the following set of sectoral and cross-sectoral guidelines to
achieve its Goal of sustainable development.
Sectoral Guidelines:
Water and sanitation, Air quality and noise, Waste management, Forestry, Biodiversity and
Protected areas, Climate change and Ozone depletion, Energy efficiency and renewable,
agriculture and livestock, and Multilateral environmental agreements.
Cross Sectoral Guidelines:
The NEP suggests the following policy instruments to overcome the environmental problems
throughout the country:
• Integration of environment into development planning,
• Legislation and regulatory framework,
• Capacity development,
• Economic and market based instrument,
• Public awareness and education, and
• Public private civil society partnership.
Chapter 03 3 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.3.2 NATIONAL CONSERVATION STRATEGY
Before the approval of National Environmental Policy (NEP) the National Conservation
Strategy (NCS) was considered as the Government’s primary policy document on national
environmental issues. The Strategy approved by the Federal Cabinet in March 1992 and was
also recognized by International Financial Institutions, principally the World Bank At the
moment this strategy just exists as a national conservation program. The NCS identifies 14 core
areas including conservation of biodiversity; pollution prevention and abatement; soil and
water conservation; and preservation of cultural heritage, and recommends immediate
attention to these core areas in order to preserve the country’s environment.
NCS does not directly apply to projects. However, MPCL should ensure that the project should
not add to the aggravation of the 14 core environmental issues identified in the NCS and
mitigation measures should be adopted to minimise or avoid any contribution of the project in
these areas.
3.3.3 NATIONAL ENVIRONMENTAL ACTION PLAN-SUPPORT PROGRAMME
(NEAP-SP)
The Government of Pakistan and United Nations Development Programme (UNDP) have
jointly initiated an umbrella support programme called the “National Environmental Action
Plan-Support Programme (NEAP-SP)” signed in October 2001 and implemented in 2002. The
development objective supported by NEAP-SP is environmental sustainability and poverty
reduction in the context of economic growth.
3.3.4 POLICY & PROCEDURES FOR THE FILING, REVIEW AND APPROVAL OF
ENVIRONMENTAL ASSESSMENTS
The Policy & Procedures for the Filing, Review and Approval of Environmental Assessments,
prepared by the PEPA under the powers conferred upon it by the Pakistan Environmental
Protection Act, provide the necessary details on the preparation, submission, and review of the
Initial Environmental Examination (IEE) and the Environmental Impact Assessment (EIA). It
provides schedules of proposals that require either an Initial Environmental Examination (IEE)
or an Environmental Impact Assessment (EIA).
3.3.5 PETROLEUM EXPLORATION & PRODUCTION POLICY 2012
Government of Pakistan introduced the first petroleum Policy document in 1991.This was then
followed by new Petroleum Policies of 1993, 1994, 1997, 2001, 2007 and 2009.
Policy 2009 had to be amended by new Petroleum Policy 2012 as the new market conditions
warranted urgent changes required for investment promotion in view of increasing
international energy prices. It also reflects the resolve of Government of Pakistan to accelerate
exploitation of indigenous natural resources by attracting foreign investment with technology
as well as promoting local companies to participate in E&P activities on a level playing field.
Chapter 03 4 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The purpose of Petroleum Exploration and Production Policy 2012 is to establish the policies,
procedures, tax and pricing regime in respect of petroleum exploration and production (E&P)
sector.
The Petroleum Exploration & Production Policy 2012 maintains a system based upon the two
different types of agreements to obtain E&P rights in Pakistan:
• For onshore operations, a system based upon a Petroleum Concession Agreement (PCA).
• For offshore operations, a system based upon a Production Sharing Agreement (PSA).
This Policy has incorporated the significant achievements of the Pakistani petroleum industry
with established good international oilfield practices.
3.4 NATIONAL ENVIRONMENTAL LEGISLATION
The legislative assembly of Sindh province of Pakistan passed the bill on 24th February 2014 to
enact Sindh Environmental Protection Act 2014. The Act envisages protection, improvement,
conservation and rehabilitation of environment of Sindh with the help of legal action against
polluters and green awakening of communities.
The definition of environmental law can be derived from the legal definition of ‘environment’.
In Section 2(xii) of the Sindh Environmental Protection Act 2014 (SEPA) environment is defined
to include air, water, land and layers of the atmosphere; living organisms and inorganic matter;
the ecosystem and ecological relationships; buildings, structures, roads, facilities and works;
social and economic conditions affecting community life; and the interrelationship between
these elements. From this definition, an environmental law can be considered to include all laws
that are designed to, or that directly or indirectly affect, the management of natural resources
including the control of pollution of these natural resources.
By this definition, environmental laws include a) laws that have been specifically enacted to
protect the environment such as the SEPA 2014, and b) laws relating to subject such as forest,
water resources, wildlife, land, agriculture, health, and town planning. Table 3.1 shows key
environment, health and safety related legislative powers of federal and provincial government,
enforcing agencies and pertinent laws.
Table 3.1: Relevant Environmental Laws and their Applicability
Subject Legislative
Power Enforcing Agencies Pertinent Laws
Environmental
Pollution and
Ecology
Federal and
Provincial
Ministry of Climate
Change,
Pakistan
Environmental
Protection Agency,
Sindh
Sindh Environnemental
Protection Act, 2014
National Environnemental
Quality Standards (NEQS),
National Environnemental
Quality Standards (NEQS),
Environmental Laboratories
Chapter 03 5 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Environmental
Protection Agency,
2000,
NEQS (Self-Monitoring and
Reporting by Industry) Rules
2005 (Amended)
Regulation of
Labour and
Safety in Mines,
Factories and Oil
Fields
Federal and
Provincial
Chief Inspector of
Mines
Chief Inspector of
Industries
Mines Act, 1923
Factories Act, 1934
Sindh Factories Rules, 1978
Hazardous Occupation
Rules 1963
Ancient and historical
Monuments and
Archaeological Sites
Federal and
Provincial
Department of
Museum
Antiquities Act, 1975
Sindh Cultural Heritage
(Preservation) Act, 1994
Wildlife Federal and
Provincial
Sindh Wildlife
Department Sindh
Wildlife Protection
Ordinance 1972
Forestry Federal and
Provincial
Sindh Forest
Department Forest Act, 1927
3.4.1 SINDH ENVIRONMENTAL PROTECTION ACT 2014
The Sindh Environmental Protection Act, 2014 (SEPA) is the basic legislative tool empowering
the provincial government to frame regulations for the protection, conservation, rehabilitation
and improvement of the environment. The SEPA is broadly applicable to air, water, soil,
hazardous waste, marine and noise pollution. Penalties have been prescribed for those
contravening the provisions of the Act. The powers of the provincial Environmental Protection
Agencies (EPAs) were also considerably enhanced under this legislation and they have been
given the power to conduct inquiries into possible breaches of environmental law either of their
own accord, or upon the registration of a complaint. Sindh Environmental Protection Act, 2014
(SEPA) attached as Annexure 1I.
It equally lays emphasis for the preservation of the natural resources of Sindh and to adopt
ways and means for restoring the balance in its eco-system by avoiding all types of
environmental hazards.
Under section 17 of SEPA, ‘’no proponent of a project shall commence construction or operation
unless he has filed with the Agency an initial environmental examination or environmental
impact assessment and has obtained from Agency approval in respect thereof. ‘’
SEPA shall review the IEE & EIA and accord approval subject to such terms and conditions as it
may prescribe or require. The agency shall communicate within four (04) months it approval or
otherwise from the date EIA is filed failing which the EIA shall deemed to have been approved.
Chapter 03 6 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.4.2 PAKISTAN ENVIRONMENTAL PROTECTION AGENCY REVIEW OF IEE
AND EIA REGULATIONS, 2000
The Pakistan Environmental Protection Agency Review of IEE and EIA Regulations, 2000 (the
‘Regulations’), prepared by the Pak-EPA under the powers conferred upon it by the PEPA,
provide the necessary details on the preparation, submission, and review of the initial
Environmental Examination (IEE) and the Environmental Impact Assessment (EIA).
The Regulation classifies projects on the basis of expected degree of adverse environmental
impacts and lists them in two separate schedules. The Regulations also require that all projects
located in environmentally sensitive areas require preparation of an EIA. As the proposed
project activities will be carried out in protected area i.e. Riverine forest, Game reserves,
wetlands and Ramsar site, an EIA study is therefore required. Pakistan Environmental
Protection Agency Review of IEE and EIA Regulations, 2000 is attached as Annexure III.
3.4.3 THE NATIONAL ENVIRONMENTAL QUALITY STANDARDS (NEQS)
The NEQS promulgated under the PEPA 1997 specify standards for industrial and municipal
effluents, gaseous emissions, vehicular emissions, and noise levels. The PEPA 1997 empowers
the EPA’s to impose pollution charges in case of non-compliance to the NEQS.
During the construction and post development phase of the project, NEQS will apply to all type
of effluents and emissions. NEQS for municipal and industrial effluents, motor vehicle exhaust
and noise and selected gaseous pollutants from industrial source are provided in Annexure IV.
3.4.4 SELF-MONITORING & REPORTING RULES
Pakistan Environmental Protection Council constituted an Environmental Standards Committee
in 1996 to devise realistic modalities for NEQS enforcement and simplified monitoring
procedures with the consultation of representatives of industrial interest groups, non-
governmental organizations (NGOs) and other stakeholders. Their efforts succeeded in the
bringing up of “Self-Monitoring and Reporting System for Industry”. As per the rules set by
this system, industries have to monitor effluents and emissions in compliance with the NEQS
and report it to provincial or federal EPAs. This system classifies industry into three categories
A, B and C each corresponding to a specified reporting frequency. Proposed power plant
project lies under Category A for both liquid effluent and gaseous emissions and thus reporting
frequency to SEPA required every month.
3.5 THE FOREST ACT 1927
This act is applicable to all regions of Pakistan. It includes procedures for constituting and
managing various types of forests, such as reserved forests and protected forests. The act
empowers the provincial forest departments to declare any forest area as reserved or protected.
The act empowers the provincial forest departments to prohibit the clearing of forests for
cultivation, grazing, hunting, removing forest produce; quarrying and felling, lopping and
Chapter 03 7 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
topping of trees, branches in reserved and protected forests. It also defines the duties of forest
related public servants, and penalties for any infringement of the rules.
Sujawal block also encompass reserved forest, which has been declared as protected forest
under this act, therefore the project will implement with any provisions of this Act. Sindh Forest
Department has been informed about development activities and ensure that all activities will
be implemented such that impacts on mangrove shall be minimized, conservation practices
shall be adopted and appropriate mitigation measures, to mitigate the impacts on mangrove
forest, have been suggested in the EIA report.
3.6 SINDH WILDLIFE PROTECTION ORDINANCE, 1972 (SWPO) AND
AMENDMENTS 2001
This ordinance provides for the preservation, protection, and conservation of wildlife by the
formation and management of protected areas and prohibition of hunting of wildlife species
declared protected under the ordinance.
The ordinance also specifies three broad classifications of the protected areas: national parks,
wildlife sanctuaries and game reserves. Activities such as hunting and breaking of land for
mining are prohibited in national parks, as are removing vegetation or polluting water flowing
through the park. Wildlife sanctuaries are areas that have been set-aside as undisturbed
breeding grounds and cultivation and grazing is prohibited in the demarcated areas. Nobody is
allowed to reside in a wildlife sanctuary and entrance for the general public is by special
dispensation. However, these restrictions may be relaxed for scientific purposes or for
betterment of the respective area on the discretion of the governing authority in exceptional
circumstances. Game reserves are designated as areas where hunting or shooting is not allowed
except under special permits.
Two amendments to the Ordinance were issued in January and June 2001 respectively
pertaining to oil and gas activities within national parks and wildlife sanctuaries. The first
amendment allowed the Government to authorize the laying of an underground pipeline
through protected areas. The second amendment allowed exploration and production activities
within national parks and wildlife sanctuaries for which an EIA study have to be prepared by
the proponent and approved by the concerned regulatory departments in accordance with the
SEPA 2014.
3.7 SINDH FISHERIES ORDINANCE, 1980
This Ordinance regulates fishing operations, and applies to inland fisheries in public waters as
well as to territorial waters. Fishing is defined broadly in section 2(d) as the “taking or catching
of fish by any means” while public waters are defined in section 2(r) to include “any waters
other than the private waters and includes territorial waters”. The law applies to “all kinds of
fish” including “molluses, crustaces and kelp-fish”.
Chapter 03 8 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The provincial government has the power to issue leases or fishing licences in any public waters
(section 3(1)). Leaseholders may in turn issue permits for fishing in leased waters (section 3(2)).
The government regulates various aspects of commercial fishing including the size of mesh that
may be employed, the type of fishing equipment that may be used, and processing and
marketing operations (sections 9, 10, 11 and 27). The Ordinance allows the government to
declare “any public waters” to be a sanctuary and to prohibit the killing, capturing or taking of
fish from such waters for a specified period without a “special” permit.
Certain provision of the Ordinance nevertheless serves to protect fish species in general, along
with aquatic environments. Under section 7, for example, the use of explosives, poisons and
“noxious” materials for the purpose of “catching or destroying fish and other aquatic life” is
prohibited in “any waters”. Similarly, section 8 prohibits the discharge of untreated sewage,
“effluence” and factory waste into “any waters”; all such waste must be treated so that it is
“harmless for fish and other aquatic life”. According to the ordinance any discharge of waste
into the water bodies shall not only be prohibited but the offender shall also be punished with
imprisonment for a term which may extend to six months or a fine which may extend to ten
thousand rupees or with both.
The government may appoint fisheries inspectors (section 13) who are empowered to arrest
suspected offenders, seize equipment and fish involved in a suspected offence (section 16),
“compound” offences” (section 26), and call for police assistance (section 18).
The ordinance is relevance to the EIA due to the presence of fish fauna in several water bodies
located within the project area including Indus River and associated water bodies (Dhand) In
this connection, Sindh Fisheries Department has been informed that all project activities near
and/or within water bodies will have to be implemented such that no physical damage to the
habitat or permanent alteration in water quality occurs.
3.8 PETROLEUM ACT 1934
This act regulates the import, transport, storage, production, refining and blending of
petroleum and other flammable substances. The federal government issues licenses and may
make rules to regulate the import, transport and distribution of petroleum (Section 4). The law
requires that all containers carrying “dangerous petroleum” (highly flammable) bear a warning
(Section6). The act also contains provisions regarding the testing and quality control of
petroleum products (Section 14ff.). All powers remain with the federal government.
3.9 THE MINES ACT 1923
This act, which is largely administrative in nature, regulates mining operations and mine
management, and contains provisions regarding the health, safety and working conditions of
mine labour. The power to make rules lies with the “appropriate government” (Section 29),
defined as the federal government in the case of mines extracting radioactive material, oil, gas
and flammable substances, and the provincial government for all other mines.
Chapter 03 9 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.10 REGULATION OF MINES AND OIL FIELDS AND MINERAL
DEVELOPMENT (GOVERNMENT CONTROL) ACT, 1948
This act regulates the development of mines, oilfields and mineral deposits. The federal
government makes rules related to the development of mines and nuclear substances, oilfields
and gas fields, while provincial governments make rules related to other minerals and their
extraction. This Act provides for enforcement of rules related to the storage and distribution of
"mineral oils", the establishment of prices at which mineral oils may be bought or sold and any
matter ancillary and incidental to the objectives set out in the act.
3.11 EXPLORATION AND PRODUCTION RULES, 1986
The 1986 Exploration and Production Rules address environmental concerns, and require
operators to “prevent pollution, avoid accumulation of trash and prevent damage to the
environment and surroundings.”
3.12 THE OIL AND GAS (SAFETY IN DRILLING AND PRODUCTION)
REGULATIONS, 1974
These regulations outline safety in exploration and production of oil and gas companies
operating in Pakistan. Some of the safety protocols under these regulations include:
• Appointment of a Welfare and Safety Officer in all drilling operations employing more
than 250 workers;
• Safety requirements of workplaces and drilling equipment;
• Fire precautions and fire fighting equipment; personal protective equipment (including
breathing apparatus and safety belts).
3.13 ANTIQUITIES ACT 1975 AND THE SINDH CULTURAL HERITAGE
(PRESERVATION) ACT, 1994
The protection of cultural resources in Pakistan is ensured by the Antiquities Act of 1975.
Antiquities have been defined in the Act as ancient products of human activity, historical sites,
or sites of anthropological or cultural interest, national monuments etc. The act is designed to
protect antiquities from destruction, theft, negligence, unlawful excavation, trade and export.
The law prohibits new construction in the proximity of a protected antiquity and empowers the
Government of Pakistan to prohibit excavation in any area, which may contain articles of
archaeological significance.
The Sindh Cultural Heritage (Preservation) Act, 1994 is the provincial law for the protection of
cultural heritage. Its objectives are similar to those of the Antiquity Act, 1975.
The project area for the EIA contains no notified archaeological site as protected under this act.
Furthermore, the project site is unlikely to contain any buried antiquity. However, the project
staff will be instructed before ground preparation and earthworks to report any archaeological
Chapter 03 10 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
artifact or what may appear to be an archaeological relic to the project management. In case of
such a discovery, appropriate action will be taken.
3.14 LAND ACQUISITION ACT, 1894
The Land Acquisition act (LAA) of 1894 amended from time to time has been the policy
governing land acquisition, resettlement and compensation in the country. The LAA is the most
commonly used law for acquisition of land and other properties for development projects. It
comprises of 55 sections pertaining to area notifications and surveys, acquisition, compensation
and appointment awards and disputes resolution, penalties and exemptions. In the proposed
project there is no such kind of land acquisition or resettlement of proposed project affected
persons.
3.15 PAKISTAN PENAL CODE (1860)
The Pakistan Penal Code (1860) authorizes fines, imprisonment or both for voluntary
corruption or fouling of public spring or reservoirs so as to make them less fit for ordinary use.
The Pakistan Penal Code (PPC) 1860 deals specifically with the pollution of water in Chapter
XIV on public health and safety. Here, “fouling” or “corrupting” the water of a public spring or
reservoir is listed as an offence, punishable with up to three months in prison and/or a fine of
500 rupees (Section 277). This provision is limited in scope, since it applies only to reservoirs
and public springs, and the terms “fouling” and “corrupting” are not defined. But provisions of
PEPA 1997 (Sections 6 and 7) and the NEQS (Appendix I) may be applied to facilitate
enforcement of Section 277. Other sections of this chapter may be interpreted to include the
protection of water resources, including Section 268 on public nuisance, Section 269 on
negligence likely to spread infectious disease, and Section 284 on negligent conduct with respect
to the possession and handling of poisonous substances.
Similarly, Chapter XVII on offences against property contains certain provisions that may be
interpreted to include the protection of water resources. Sections 425–440 deal with “mischief”,
defined as damage to property resulting in destruction or loss of utility. Section 430 provides
specifically for mischief caused to irrigation works, while Section 431 deals with damage to
roads, bridges, rivers or channels. Meanwhile, Chapter XXIII, Section 511 on attempted offences
could also be interpreted to include offences related to the “fouling” or “corrupting” of water.
Under Section 278 of the PPC, the punishment for “making [the] atmosphere noxious to health”
is a maximum fine of 500 rupees. In addition, certain sections of Chapter XIV on public health
and safety concerning “public nuisance” may be interpreted to include air and noise pollution
from vehicles, as well as emissions (Sections 268, 278, 290 and 291).
3.16 EXPLOSIVE SUBSTANCES ACT 1908
This law regulates the possession and use of explosive substances, including materials for the
manufacture of explosives as well as machinery, tools and materials that can be used to cause
an explosion (Section 2). Causing an explosion is punishable with a maximum sentence of life in
Chapter 03 11 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
prison, whether or not the event causes any injury to persons or damage to property (Section 3).
The same maximum penalty applies to making or possessing explosives with intent to cause an
explosion (Section 4). Although the law does not specify conditions under which it is legal to
possess explosive materials, possession of such substances for a purpose that is not “lawful” is
an offence (Section 5), implying that some form of regulatory mechanism is to be put in place.
Powers under this act have been delegated to provincial governments, which may restrict or
allow the courts to proceed with the trial of suspected offenders (Section 7). The 1908 law deals
exclusively with causing explosions or intent to cause explosions.
3.17 EXPLOSIVES ACT 1884
This law deals with manufacture, possession, sale, use and transport of explosives. The
government may prohibit the manufacture, possession or import of any explosive substance,
except with a licence (Section 5), or ban outright the manufacture, import or possession of any
material deemed to be of “so dangerous character [sic]” that it is “expedient for the public
safety” to impose such restrictions (Section 6). Under this law, the maximum penalty for
illegally manufacturing, possessing or importing explosives is 5,000 rupees.
The government may declare any substance deemed particularly dangerous to life or property,
owing to its explosive properties, or any of the processes involved in its manufacture to be an
explosive within the meaning of this act (Section 17). Such materials may include a wide range
of chemical substances that are explosive in nature, although the term “dangerous” itself has
not been defined. No regulatory compliance measures are introduced for the handling of
hazardous materials.
3.18 NATIONAL ENVIRONMENTAL GUIDELINES
3.18.1 THE PAKISTAN ENVIRONMENTAL ASSESSMENT PROCEDURES, 1997
The Pakistan Environmental Protection Agency prepared the Pakistan Environmental
Assessment Procedures in 1997. They are based on much of the existing work done by
international donor agencies and Non Governmental Organisations (NGO’s). The package of
regulations prepared by PEPA includes:
• Policy and Procedures for Filing, Review and Approval of Environmental Assessments;
• Guidelines for the Preparation and Review of Environmental Reports;
• Guidelines for Public Consultation;
• Guidelines for Sensitive and Critical Areas; and
• Sectoral Guidelines for various types of projects.
Chapter 03 12 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.18.2 GUIDELINES FOR OPERATIONAL SAFETY, HEALTH AND
ENVIRONMENTAL MANAGEMENT, DECEMBER 1996
These guidelines are the outcome of a study commissioned by the Directorate General
Petroleum Blocks, Ministry of Petroleum and Natural Resources, Government of Pakistan. The
guidelines list down the relevant laws related to the operational health, safety and environment
and also recommends environmental controls and management practices to be adopted in O&G
exploration projects.
3.18.3 GUIDELINES FOR PUBLIC CONSULTATION
These guidelines are a part of a package of regulations and guidelines. It provides assistance
throughout the environmental assessment of project by involving the public which can lead to
better and more acceptable decision-making.
3.18.4 SECTORAL GUIDELINES FOR ENVIRONMENTAL REPORTS OIL & GAS
EXPLORATION AND PRODUCTION
The guideline will assist proponents to identify the key environmental issues that need to be
assessed as well as mitigation measure and alternatives that need to be considered in the actual
EIA.
This guideline deal with Oil & Gas projects which involved exploration or production of oil and
gas. The environmental issues discussed in this guideline are specific to exploration or
production activities of oil and gas and all such projects should address these issues. The degree
and relevance of the issues will vary from proposal to proposal. The matters identified in this
guideline should provide guidance for the preparation and assessment of most exploration and
production proposals.
3.19 INTERNATIONAL GUIDELINES
3.19.1 WORLD BANK GUIDELINES ON ENVIRONMENT
The principal World Bank publications that contain environmental guidelines are listed below:
• Environmental Assessment-Operational Policy 4.01. Washington, DC, USA. World Bank
1999.
• Environmental Assessment Sourcebook, Volume I: Policies, Procedures, and Cross-Sectoral
Issues. World Bank Technical Paper Number 139, Environment Department, the World
Bank, 1991,
The first two publications provide general guidelines for conducting EIAs, and address EIA
practitioners as well as project designers. While the Sourcebook in particular has been designed
with Bank projects in mind, and is especially relevant for the impact assessment of large-scale
infrastructure projects, it contains a wealth of useful information, for environmentalists and
project proponents.
Chapter 03 13 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The Sourcebook identifies a number of areas of concern, which should be addressed during
impact assessment. It sets out guidelines for the determination of impacts, provides a checklist
of tools to identify possible biodiversity issues and suggests possible mitigation measures.
Possible development project impacts on different areas such as wild lands, wetlands and
forests are also identified and mitigation measures suggested.
3.19.2 IFC PERFORMANCE STANDARDS
International Finance Corporation (IFC), a member of the World Bank Group, is the largest
global development institution focused on the private sector in developing countries. IFC's
Sustainability Framework applies to all investments and advisory clients whose projects go
through IFC's credit review process.
IFC's Performance Standards define clients' roles and responsibilities for managing their
projects and the requirements for receiving and retaining IFC support. The standards include
requirements to disclose information. The Performance Standards may also be applied by other
financial institutions electing to apply them to projects in emerging markets.
The eight Performance Standards establish standards that the client is to meet throughout the
life of an investment by IFC or other relevant financial Institution.
• Performance Standard-1: Social and Environmental Assessment and Management System;
• Performance Standard-2: Labour and Working Conditions;
• Performance Standard-3: Pollution Prevention and Abatement;
• Performance Standard-4: Community Health, Safety and Security;
• Performance Standard-5: Land Acquisition and Involuntary Resettlement;
• Performance Standard-6: Biodiversity Conservation and Sustainable Natural Resource
Management;
• Performance Standard-7: Indigenous People;
• Performance Standard-8: Cultural Heritage.
3.19.3 IFC ENVIRONMENTAL, HEALTH & SAFETY GUIDELINES
IFC has also developed Environmental, Health, and Safety (EHS) Guidelines. These guidelines
are technical reference documents with general and industry specific examples of Good
International Industry Practice (GIIP).
The EHS Guidelines are required to adhere by IFC clients under Performance Standard 3 on
Pollution Prevention and Abatement.
Chapter 03 14 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
3.20 INTERNATIONAL CONVENTIONS & TREATIES
3.20.1 INTERNATIONAL CONVENTION ON BIODIVERSITY
The International Convention on Biodiversity was adopted during the Earth Summit of 1992 at
Rio de Janeiro. The Convention requires parties to develop national plans for the conservation
and sustainable use of biodiversity, and to integrate these plans into national development
programmes and policies. Parties are also required to identify components of biodiversity that
are important for conservation, and to develop systems to monitor the use of such components
with a view to promote their sustainable use.
3.20.2 THE CONVENTION ON CONSERVATION OF MIGRATORY SPECIES OF
WILD ANIMALS, 1979
The Convention on the Conservation of Migratory Species of Wild Animals (CMS), 1979,
requires countries to take action to avoid endangering migratory species. The term "migratory
species" refers to the species of wild animals, a significant proportion of whose members
cyclically and predictably cross one or more national jurisdictional boundaries. The parties are
also required to promote or co-operate with other countries in matters of research on migratory
species.
The Convention contains two appendices. Appendix I contain the list of migratory species that
are endangered according to the best scientific evidence available. For these species, the
member states to the Convention are required endeavour to:
• Conserve and restore their habitats;
• Prohibit their hunting, fishing, capturing, harassing and deliberate killing;
• Remove obstacles and minimize activities that seriously hinder their migration;
• Control other factors that might endanger them, including control of introduced exotic
species.
Appendix II lists the migratory species, or groups of species, that have an unfavourable
conservation status as well as those that would benefit significantly from the international co-
operation that could be achieved through intergovernmental agreements.
3.20.3 THE CONVENTION ON WETLANDS OF INTERNATIONAL
IMPORTANCE, RAMSAR 1971
Pakistan is a signatory to the said Convention. The principal obligations of contracting parties
to the Convention are:
• To designate wetlands for the List of Wetlands of International Importance.
• To formulate and implement planning so as to promote wise use of wetlands, to carry out
an EIA before transformations of wetlands, and to make national wetland inventories.
Chapter 03 15 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• To establish nature reserves on wetlands and provide adequately for their wardening and
through management to increase waterfowl populations on appropriate wetlands.
• To train personnel competent in wetland research, management and wardening.
• To promote conservation of wetlands by combining far-sighted national policies with
coordinated international action, to consult with other contracting parties about
implementing obligations arising from the Convention, especially about shared wetlands
and water system.
• To promote wetland conservation concerns with development aid agencies.
• To encourage research and exchange of data.
So far 19 sites in Pakistan have been declared as wetlands of International Importance or
Ramsar Sites. One Ramsar site named as Indus Delta is located within the In EIA project area.
3.20.4 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED
SPECIES OF WILD FAUNA AND FLORA (CITES)
This convention came into effect on 03 March 1973 in Washington. In all 130 countries are
signatory to this convention with Pakistan signing the convention in 1976. The convention
requires the signatories to impose strict regulation (including penalization, confiscation of the
specimen etc.) regarding trade of all species threatened with extinction or that may become so,
in order not to endanger further their survival.
The Convention contains three appendices. Appendix I include all species threatened with
extinction which are or may be affected by trade. The Convention requires that trade in these
species should be subject to strict regulation. Appendix II include species that are not
necessarily threatened presently but may become so unless trade in specimens of these species
is subject to strict regulation. Appendix III includes species which any contracting party
identifies as subject to regulations in trade and requires other parties to cooperate in this matter.
3.20.5 INTERNATIONAL UNION FOR CONSERVATION OF NATURE AND
NATURAL RESOURCES (IUCN) RED LIST
The red list is published by IUCN and includes those species that are under potential threat of
extinction. These species have been categorized as:
• Endangered: species that are sent to be facing a very high risk of extinction in the wild in
the near future, reduction of 50% or more either in the last 10 years or over the last three
generations, survive only in small numbers, or have very small populations.
• Vulnerable in Decline: species that are seen to be facing a risk of extinction in the wild,
having apparent reductions of 20% or more in the last 10 years or three generations.
• Vulnerable: species that are seen to be facing a high risk of extinction in the wild, but not
necessarily experiencing recent reductions in population size.
Chapter 03 16 of 16
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Lower Risk: species that are seen to be facing a risk of extinction that is lesser in extent that
for any of the above categories.
• Data Deficient: species that may be at risk of extinction in the wild but at the present time
there is insufficient information available to make a firm decision about its status.
3.21 INTERNATIONAL AND NATIONAL ENVIRONMENT AND
CONSERVATION ORGANIZATIONS
International and National NGOs
International environmental and conservation organisations such as IUCN and the World Wide
Fund for nature (WWF) have been active in Pakistan for some time. Both these organisations
have worked closely with government and act in an advisory role with regard to the
formulation of environmental and conservation Policies. Since the convening of the Rio
Summit, a number of national environmental NGO’s have also been formed, and have been
engaged in advocacy, and in some cases, research. Most prominent national environmental
NGO’s, such as the Sustainable Development Policy Institute (SDPI), Strengthening
Participatory Organization (SPO), Shehri, and Shirkatgah are the members of the Pakistan
National Committee (PNC) of IUCN.
As mentioned earlier, environmental NGO’s have been particularly active in advocacy, as
proponents of sustainable development approaches. Much of the government's environmental
and conservation policy has been formulated in consultation with leading NGO’s, who have
also been involved in drafting new legislation on conservation.
3.22 MPCL CORPORATE REQUIREMENTS
Corporate HSE (Health, Safety, Environment) Policy
MPCL undertakes that Health, Safety and Environment (HSE) is a management responsibility
and is committed to give priority to health and safety of all its employees and of other
personnel effected by and involved in its activities. The company HSE policy is built on a “No
Blame” culture. More emphasis is on the recognition and elimination of risk rather than looking
for someone to blame. MPCL also confers its overriding commitment towards minimizing
impact of its activities on the natural environment.
Chapter 04 1 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4 PROJECT DESCRIPTION
4.1 INTRODUCTION
In this chapter salient features of the proposed project are discussed to the extent that they
relate to potential environmental, biological and social impacts. Details of proposed actions,
which include 2D/3D seismic survey, well construction and operational activities, are also
discussed in the subsequent sections.
4.2 PROJECT NEED
Pakistan spends billions of dollars to import the crude oil and other petroleum products and as
a result total import bill is rising for every consecutive fiscal year. To reduce this loss of foreign
exchange the government is committed to maximize replacement of imported furnace oil and
diesel oil with indigenous natural gas.
The share of natural gas in primary energy supplies of the country is about 47.6% (Pakistan
Energy Yearbook, 2011), and is the primary fuel used in the fertilizer industries, in addition to
its uses in the residential, commercial sectors and in power generation.
Pakistan Primary Energy Mix 2010-11 is given as Figure 4.1. The current situation: Energy
sources in Pakistan's current energy mix include hydel, thermal (coal, gas and furnace oil), and
nuclear for electricity generation, and gasoline, diesel, and Compressed Natural Gas (CNG) for
transport applications. Pakistan's primary energy mix-2011 as derived from Pakistan Energy
Yearbook 2011 is: Oil 32.0%; Gas 47.6%; LPG; 0.5%; Coal 6.7%; Hydro, Nuclear & Imported
Electricity 13.2%.
Figure 4.1: Pakistan Primary Energy Mix
The country has an estimated 824 billion cubic meter of recoverable reserves of natural gas
(Pakistan Energy Yearbook, 2010). Gas consumption is highest in the power generation sector
(27.2% of total gas consumed), domestic use (18.7%), Commercial (3.0%), Transport (9.1%), and
in fertilizer production (18.4% of total gas consumed) (Pakistan Energy Yearbook, 2011). In view
32%
48%
-1%7%
13%
Pakistan's Primary Energy Mix 2010-11
Oil Gas LPG Coal Hydro, Nuclear & Impoerted
Chapter 04 2 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
of Pakistan's current energy crisis, it has become imperative for the country to explore more
indigenous resources to meet the domestic & industrial demands. MPCL is playing a very
important role in order to explore oil and gas in the country so that dependence on import may
be reduced.
4.3 PROJECT OBJECTIVE
MPCL has two prime objectives coupled with proposed 2D/3D seismic and drilling activities.
These two prime objectives are structured as following:
���� Exploration of new hydrocarbon reserves through drilling of exploratory boreholes on the
basis of promising geological features which will be identified in seismic survey.
���� To enhance the production of fossil-fuels in order to reduce energy deficiencies of the
Pakistan.
Above mentioned objectives will further explore and develop hydrocarbon resources in the
Sujawal EL block (2467-11) of Sindh Province, and ultimately of Pakistan for the mutual benefit
of the Pakistani people and MPCL shareholders.
4.4 PROJECT AREA
The proposed 2D/3D seismic and drilling activities will be carried out in Sujawal EL block
(2467-11) occupying a total area of about 2,416 square kilometres. The block is located in
Sujawal and Thatta districts of Sindh Province Pakistan.
The EIA report covers 320 line Km of 2D and 900 sq. km for 3D seismic operation. Seismic lines
will be laid in order to acquire seismic data and drilling of well to be carried out by MPCL in
the eastern part of the project area. Location will be firmed once the G&G evaluations are
completed.
4.5 PROPOSED PROJECT
MPCL was granted exploration license of Sujawal EL block (2467-11) in June 2006 by the
Government of Pakistan. MPCL is willing to continue its exploration activities and enhance
production capacities. In this connection, MPCL is going to perform seismic (2D/3D) and
drilling activities in Sujawal EL block (2467-11) this will include seismic data acquisition within
the project area and drilling of exploratory well. All these proposed activities will be carried out
after approval of Sindh EPA.
Exploratory activities will involve three different phases both for seismic and drilling segments.
This will include Construction phase, Operational phase and Restoration phase. During
proposed exploration activities, initially seismic survey will be carried out followed by drilling
activity in the project area.
2D/3D seismic data collection occurs along a line of receivers and resulting image represents
section below the line. Seismic survey will take around five months for completion. Generally
two techniques will be used for data acquisition; vibroseis in terrain with gentle slopes and flat
Chapter 04 3 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
sandy areas; dynamite within agricultural lands, tidal flats/coastal areas, shallow waters (less
than 2m depth) and all other areas where access and working of the vibroseis will be difficult.
Up-holes may be drilled at selected locations within the area of seismic survey.
Seismic operation will involve housing about 450 people in a camp site and use of water for
domestic and operation purposes. Local labour will also be employed during the operation.
Description of activities involved in seismic activities is discussed in below section.
Drilling operation will be undertaken on a round-the-clock basis with two shifts. The total
estimated time for the drilling of a well is approximately 02-05 months, dependent on the well
type (exclusive of rig movement, rig up and down days). However, this largely depends upon a
number of factors and, therefore, may extend.
Drilling will be carried out using conventional equipment, techniques and practices for
hydrocarbon exploration. A Kelly or top-drive rotary drilling rig will be expected to use in this
operation. The derrick is mounted on a steel platform known as the rig floor. The rig floor
provides the working area for the drilling operations and personnel. A hoisting drum called
draw works is mounted on the rig floor at the base of the derrick. A wire rope called the drilling
line pass from the draw works to the top of the derrick through a system of pulleys called the
crown block and attached to a further system of pulleys known as the hook and block. The
whole system of wire rope and pulleys operates like a crane. A drill string made up of uniform
lengths of hollow steel pipes is suspended from the hooks.
During project activities, construction of campsite, well site; access tracks and other civil works
will be carried out which may also requires land clearing. If existing tracks will found,
improvement of existing tracks will also be carried out in order to utilize these track during
project life.
4.6 SEISMIC OPERATIONS
Information about subsurface geology is gathered by directing shock waves into the ground
and recording the time taken for them to reflect off subsurface rock layers. The shock waves are
generated either by detonating dynamite in holes drilled in the ground or by surface vibration.
The reflected shock waves are recorded using geophones (sensitive microphones), which are
laid out along the area where the detonation or vibration takes place.
Seismic surveys can be conducted using a number of methods, including deep holes, shallow
holes (also referred to as the pop-shot method), surface shots, and truck-mounted vibrators
(Vibroseis TM). For proposed project dynamite and vibroseis techniques for data acquisition
will be used and are discussed in Section 4.7.5 below.
4.7 METHODOLOGY FOR SEISMIC SURVEY
The following different activities that will be involved in conducting the seismic survey are:
• Campsite selection and access track development or improvement (if needed);
Chapter 04 4 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Camp establishment, mobilization and permitting
• Line survey & preparation
• Data acquisition (e.g. Dynamite, Vibroseis )
• Cabling
• Shooting and recording
• Restoration and rehabilitation
The typical seismic survey procedure is described below.
4.7.1 CAMP SITE SELECTION AND ACCESS TRACK
Seismic program will initiate with the selection of site for camp. Camp site selection will be
carried out taking into consideration the environmental and social aspects of the proposed site.
Usually, a flat tract of land with good access is chosen for camp establishment. Camp site will
be selected keeping in view the minimum clearing of vegetation; however it is likely that any
levelling and clearing will be conducted.
The existing track network will be relied upon to access the seismic lines. Improvement of
existing tracks will also be carried out, where required. Moreover, temporary tracks will also be
developed for seismic program, if necessary.
4.7.2 CAMP ESTABLISHMENT AND MOBILIZATION
Once the access track is completed, camp establishment and mobilization are started. Usually, a
flat tract of land is chosen for camp establishment and nominal levelling and clearing are
carried out, if necessary.
To mobilize the heavier loads, flat-bed trucks are used; for others, ordinary trucks (with a
carrying capacity of 10-15 tons). It takes about 15 days to complete the camp establishment and
mobilization. The seismic crew is mobilized once the camp is fully operational.
4.7.3 LAND PERMITTING:
Before commencement of work a permitting team headed by a chief permit man will arrive in
the area. The team early arrival will facilitate activities such as liaising with local landowners
and authorities to inform them of the operation and make necessary arrangements. The
permitting team will identify the ownership of the land areas over which the seismic operations
will be undertaken. In consultation with the district administration and following agreed rates,
compensation will be given to the land owners wherever applicable. During the seismic survey,
the chief permit man will be the focal point for communication between local inhabitants and
seismic survey personnel.
4.7.4 LINE SURVEY AND PREPARATION:
After obtaining permission from the permitting team, the locations of shot holes will be
surveyed. In this activity, the seismic lines will be marked on the ground by survey teams. Each
Chapter 04 5 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
team will comprise of 4 to 5 people. The survey teams will use a global positioning system to
mark shot points on the seismic lines at every 40-50m interval with whitewashed stones or
wooden pegs.
Clearing of trees and dense patches of vegetation will be avoided and seismic lines will be laid
on the plain area. This will be helpful, if vibroseis technology will be used and allow the
movement of vibroseis trucks over the cleared strip of land along the line. Dynamite will be
always used as energy source if seismic lines lying in agricultural fields and will not be cleared.
Geographical Coordinates of Seismic lines given in Table 4.1 and arrangement of seismic lines
is depicted in Figure 4.2.
Table 4.1. Geological Co-ordinates of Seismic Lines
Sr. No. Line No. Line (KM) Latitude Longitude
Deg. Min. Sec. Deg. Min. Sec.
1 SUJ14-01 23.121 24 29 14.4 67 26 5.92
24 41 37 67 28 36.1
2 SUJ14-02 15.683 24 37 27 67 25 0
24 41 37 67 33 9
3 SUJ14-03 23.121 24 30 0 67 31 4.75
24 41 37 67 36 10.9
4 SUJ14-04 27.683 24 34 12.1 67 25 0
24 41 37 67 39 20.2
5 SUJ14-05 23.121 24 30 0 67 37 28.25
24 41 37 67 42 35.1
6 SUJ14-06 39 24 31 13.4 67 25 0
24 41 37 67 45 6.1
7 SUJ14-08 46.163 24 29 18.75 67 25 0
24 41 37 67 48 48.9
8 SUJ13-10 54.923 24 27 0 67 25 0
24 41 37 67 53 21.4
9 SUJ14-12 25 24 30 0 67 35 20.7
24 36 40.6 67 48 14.8
10 SUJ14-14 27.185 24 30 0 67 38 43.45
24 37 12.45 67 52 39.1
11 SUJ14-16 15 24 30 0 67 42 32.65
24 34 0.9 67 30 17.75
TOTAL 320 L.KM
Chapter 04 6 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 4.2: Location of Seismic lines within Sujawal EL Block
Chapter 03 7 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.7.5 DATA ACQUISITION:
The typical procedure for data acquisition using the shot/deep whole technique is described
below.
Dynamite:
In this technique, shot holes (~24m), will be drilled after every 40-50m along sections of the
seismic lines passing through agricultural lands, mountainous region or any other area of
interest. These holes will be drilled using portable hand driven drills or potable jackrob drilling
units. Drill will be operated by a team of 4-5 drillers headed by a foreman.. If a shot point
cannot be drilled at a specified location because of any environmental restriction, a replacement
point will be located as close to the original shot point as possible.
After completion of drilling, each shot hole will be loaded with optimum amount (2 -6 kg) of
dynamite and 1 or 2 detonators. Explosives will be handled by a loading crew who will be
specially trained in the handling, storage, transportation, charging, firing and safety of
dynamite. Charges will be carefully inserted into each hole. Each hole will then be backfilled
with sand/mud. Shot Hole drilling operation is depicted in Figure 4.3.
Figure 4.3: Shot Hole Drilling Operation
Labours will be divided into six teams including front crew, back crew, shooting crew,
recording crew and green crew that will carry out shooting, recording and restoration along the
seismic lines. These teams will operate several days behind the drilling team. Front cable-crew
will lay down the cables and plant geophones along the seismic line. Cables and geophones will
be symmetrically laid down along the seismic line on either side of a shot point. Geophones
connected together in groups of 24 or more will be planted along the line at intervals of 1 to 4
meter. Each string of geophones will be connected to a cable which will be connected to a
station unit. Station units will be connected to a recording unit through the same cable. Points
along which cables and geophones will be laid are termed receiver array. Approximately 70
Chapter 03 8 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
labours will be employed for laying and retrieving of cables. A pictorial view of Geophones and
lying of Cables is depicted in Figure 4.4.
Figure 4.4: A pictorial view of Geophones and lying of Cables
After the cables and geophones have been laid out along the line or around the shot hole
containing the charge, the charge is detonated by a crew comprising of 4 men. The charge in one
shot hole will be detonated at a time. At the surface, the sound of the detonation is normally no
more than a muffled thud. The process will be successively repeated for each shot hole, with
cables and geophones being removed from the back of the line and placed at the front of the
line as the detonating team progresses.
The sound waves reflected off geological layers will be picked up by the geophones, amplified
and recorded electronically by mobile recording units. Subsequently, the data will be processed
by computer to produce a map of the underlying structure. This information will then be
processed and interpreted by geophysicists and geologists.
Vibroseis:
This technique will make use of vibrators as an energy source. Vibrator consists of a heavy mass
attached to a steel plate mounted on a truck. Truck will lower the steel plate to rest on the
ground by means of hydraulic jacks. Steel plate will be made to vibrate, creating energy waves
that will travel downwards into the earth surface. Reflected waves will be received on the
ground by cables and geophones laid along the seismic line. Arrangement of cables, geophones
and station units will be similar to the arrangement adopted for dynamite. A series of 4
vibrators will follow each other along the line. All 4 vibrators will stop at a point called
vibroseis point, and produce energy waves of between 2-80 Hz for a period of less than 20
seconds in the manner described above. With this technique approximately 4-8 km of line can
be recorded each day. Operation of Vibroseis is presented in Figure 4.5 below.
Chapter 03 9 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 4.5: Vibroseis Truck in Operation
4.7.6 RESTORATION AND REHABILITATION:
After completion of the seismic operation all affected areas (including access tracks, seismic
lines and camp sites) will be restored. A restoration and rehabilitation crew will be mobilized to
ensure that the affected areas are being brought back to their original condition as much as
possible.
Specific to campsites restoration, following activities will be carried out for site restoration.
Moreover, for reference purposes photographic record of the campsites prior to set-up will be
established.
• Demobilization of all equipment and machinery.
• Disposal of any waste material remaining at the time of completion of the operation.
• Backfilling of all soak pits and septic tanks.
• Backfilling of all holes and pits
• Dismantling and removal of fence or barriers surrounding the camp area.
• General restoration of the site area including landscaping and restoration of drainage where
required.
Restoration of seismic lines will include removal of all cables, geophones, station units, flags,
stakes and wastes from the lines and back filling of all mud pits. For reference purposes a
photographic record of selected sections of seismic lines could be taken before and after the
operation.
Chapter 03 10 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.7.7 ACCOMMODATION AND SUPPLIES:
One base camp and fly camps (if required) will be prepared to house a maximum of 450 crew
members. The approximate area for the base camp will be between 50,000 - 60,000 sqm and will
include accommodation area including tents and portacabins; senior and junior kitchens and
mess; laundry area; toilets; workshops; vehicle parking area; equipment storage areas; fuel and
oil storage area; generator area, septic tanks and soak pits; and a garbage pit. The camps will be
fenced for security reasons. The base camp will be prepared by an advance party. Survey work
will start only after satisfactory set up of the base camp. Most camp supplies will be transported
from Karachi, Gharo and Hyderabad. Water will be required during the operation for domestic
and drilling purposes. Water will be transported to the site from the suitable source. The
required quantity of water will be obtained either from existing local tube well or well drilled
for the project or can be supplied through water boozers. Quantity of water required during
various operations of the seismic survey is provided in Table 4.4.
A bulk stock of dynamite will be transported to the project area. This will be stored in a purpose
built explosive storage area located at a safe distance from communities and the seismic camps.
The explosives will be stored in an excavated pit lined with concrete blocks and covered with
tarpaulins. The area will be fenced and guarded for security reasons.
Power required during operation of the base camp will be met through installation of diesel
generators.
4.8 DRILLING OPERATION
MPCL will carry out drilling activities on the basis of data gathered from the seismic activities.
It is envisaged that based on the results of the seismic operation, a deep exploration well will be
drilled in the eastern part of project area. Activities associated with the drilling will include
construction of a well site, camp site, an access track; septic tank, platform, pits, drilling of the
exploration well; possible well testing in case of a discovery; abandonment, completion or
suspension of the well depending on the success or failure of the well and site restoration. A
detailed description of these activities has been provided in the following sections. The
exploratory well to be drilled will be finalized after assessment of the seismic data.
4.8.1 SUJAWAL BLOCK EL CONSTRUCTION PHASE
In this phase, civil work will be performed which includes construction of a well site, camp site,
an access track; septic tank, platform, pits etc. A detailed description of these activities has been
provided in the following sections.
4.8.2 CIVIL WORK ACTIVITIES
Before the commencement of drilling, each selected site for drilling will be developed according
to the requirements of the selected drilling rig and well drilling program. Existing tracks will be
used as much as possible to access the proposed drilling site but it is expected that about 2 to 4
km long katcha track will be constructed to access the well site.
Chapter 03 11 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Well site and campsite cover an area of 15 acres and 5 acres respectively. The construction
contractor will develop its own camp for construction purposes. The camp will house a
maximum of 150-200 people. The contractor will also hire local people for unskilled jobs.
The construction works will take approximately 4 months. A typical drilling site layout is
presented in Figure 4.6.
Figure 4.6: Typical Drilling Site Layout (not to scale)
A campsite is needed to support drilling operations. For campsite construction, following
activities are involved.
• Clearing and Levelling of the area using bulldozers, tractors and graders;
Chapter 03 12 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Construction of auxiliary facilities such as barracks, guard room, watch towers, kitchen,
mosque, water pit, sewerage lines, septic tanks and soak pits.
• A rig camp consisting of portable cabins, kitchens, mess rooms, bathrooms, laundries etc for
which limited construction works including filling, compaction and construction of cabin
foundation are required.
• Installation of a fence around the area.
A single cement pad will be constructed near well location to support the drill rig, mud pumps
and ancillary equipment. At least five pits will be excavated around the periphery to store
water, drill cuttings, wastewater, and solid waste and flare pit where necessary. Following
activities are involved for construction of well site.
• Land Clearing and Levelling of the area;
• Construction of cellar, drilling rig pad and miscellaneous concrete pads to support heavy or
vibrating equipments;
• Filling and compaction to raise the site level;
• Construction of platform for fuel storage tank with sump and loading/un-loading pad,
storage yard, drilling waste mud pit, water pits and flare pit.
• Installation of a fence around the area.
4.9 WELL DRILLING OPERATION PHASE
Upon completion of construction work, mobilization of the rig and related machinery and
equipment commences. This is followed by the drilling operation and at the completion of
drilling, fracture stimulation may be performed in case the well is found to be productive.
Drilling operations are generally conducted round the clock. The time taken to drill a bore hole
depends on the depth of the hydrocarbon bearing formation and the geological conditions, but
it is commonly of the order of few months. Where a hydrocarbon formation is found, initial
well tests will be conducted to establish flow rates and formation pressure.
4.9.1 RIG MOBILIZATION
The drilling rig is transported to the site using trailers. The rig is assembled and erected over the
well location. Other ancillary equipment such as power generators, mud pumps, mud tanks,
shale shakers, cementing unit, drill pipe and collars will also be transported to the site.
4.9.2 DRILLING OPERATION
The well will be drilled using a rotating bit, suspended at the bottom of a drill string. The drill
bit drills through the formations by the combined effect of the weight of the drill collar and the
rotary action provided to the bit by a rotary table mounted on the rig floor. Rotation of the
drilling bit and string will be achieved by means of powerful electric motors on the surface.
Chapter 03 13 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Steel casings will be run into completed sections of the well and cemented into place. The casing
will provide structural support to maintain the integrity of the well hole by sealing potentially
weak zones, and will protect aquifers from contamination that could occur due to drilling
fluids. A pictorial view of a rotary drilling rig is shown in the Figure 4.7.
Figure 4.7: Pictorial View of Rotary Drilling Rig
4.9.3 DRILLING MUD
The conventional process of drilling for oil and gas well uses a rotary drill bit that is lubricated
by drilling fluids known as “mud”. As the drill bit grinds downward through the rock layers,
producing fragments, which range in diameter from 10’s of microns to 1-2cm, depending
largely on the nature of the rock (McFarlane and Nguyen, 1991) and generates large amounts of
ground-up rock known as drill cuttings.
Chapter 03 14 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Drilling mud is pumped through the drill string down to the drilling bit and is returned to the
drill rig in the space (or annulus) between the drill string and the casing as mention in
Figure 4.8.
Figure 4.8: Schematic Diagram of Mud Recycling System
Drilling mud will be used during the operation to serve the following functions.
• The hydrostatic pressure generated by the mud’s weight controls the downhole pressure
and prevents formation fluids from entering the well bore.
• It removes the rock cuttings from the bottom of the hole and carries them to the surface and
when circulation is interrupted it suspends the drill cuttings in the hole.
• It lubricates and cools the drill bit and string.
• It deposits a mud cake on the wall of the well bore effectively sealing and stabilising the
formations being drilled.
Chapter 03 15 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The mud will be recycled and maintained in good condition throughout the operation. The
mud and suspended cuttings are processed on the surface through screens called “shale
shakers” to maximise recovery of the mud. The recovered mud is then generally passed
through a desander to remove sand particles and, if necessary, subsequent treatment is
provided by a centrifuge or desilter. This additional equipment removes the fine colloidal
solids, the particles too small to be removed by the conventional equipment, which if allowed to
build up can make the mud too viscous. If the viscosity is not controlled at source a proportion
of the mud would have to be discharged and the remainder diluted with oil and/or water. The
composition of the mud depends on the geology of the well and will change as the well
progresses
A water based drilling mud will be used during the operation. However, where necessary, oil
based mud can be used. A. waste management plan will be developed and implemented for
safe disposal of drilling mud. Variety of additives are also used in water based mud for specific
purposes, these additives serve the following functions:
Fluid loss control: The layer of mud on the wall of the well bore retards the passage of liquid
into the surrounding rock formation. Bentonite is the principal material for fluid loss control
although additional additives such as starch and cellulose, both naturally occurring substances,
are also used.
Lost circulation: Naturally occurring fibrous, filamentous, and granular or flake materials are
used to stop lost circulation when the drill bit enters a porous or fractured formation. Typical
materials include ground nut shells and mica.
Lubricity: Normally the drilling mud alone is sufficient to adequately lubricate and cool the bit.
However, under extreme loading, other lubricants are added to prevent the drill string from
becoming stuck.
pH Control: Caustic and lime increase the pH of the mud to between 9 and 10. This ensures the
optimum performance of the mud and controls bacterial activity.
Pressure Control: Barite is generally used as a weighting agent to control downhole pressure.
Typically a single well may lead to 1000 - 4000 m3 of cuttings and mud depending on the nature
of cuttings, well depths, hole diameter and rock types.
The drilling mud will consist of slurry of formation cuttings suspended in a liquid phase.
Certain additives such as bentonite, barite and salts will be used for initial mud formulation and
subsequent changes as required during the operation. The exact constituents and concentrations
will be finalized before the drilling operation. The quantity of drilling mud used and the
cuttings generated will depend upon the well geology, depth of the well, and other operating
factors.
Chapter 03 16 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.9.4 DISPOSAL OF DRILLING WASTES
Conventional drilling waste management involves discharging the mud and cuttings into a
lined waste pit. The waste management system is considered to be technologically and
environmentally the most preferred option. The drill cuttings and mud will be disposed off at
the well site within HDPE lined waste pits. These pits will be closed by providing a top-soil
cover at the time of site restoration.
4.9.5 WELL COMPLETION
When the well has reached total depth and final logging has taken place, the well will be sealed
by running a final string of casing into the ground in the form of a liner. This will then be
cemented. Following this a completion string will be run made-up of down hole seals and
valves which will be sealed at the surface and the well capped with a Christmas tree.
The well is expected to be imperforated awaiting testing at a later date, at which point the well
will be perforated and allowed to produce gas.
The drilling rig will be moved to the next location after the well has been completed and a Well
Intervention unit and associated equipment will be mobilised to the well to undertake well
bracing and testing operations.
4.9.6 WELL EVALUATION AND TESTING
After the completion of the drilling operation, well testing may be carried out to establish a
number of parameters such as gas composition and pressure. During well testing hydrocarbons
from the testing zone will be flowed to the surface. In order to control the operation, and to
avoid the risk of accident, formation gases or any other gases produced during well testing will
be flared under controlled conditions. These gases will be flared from the end of a flare line laid
horizontally on the ground, and extending to the flare pit. Any formation water will be
separated and discharged into the mud pit.
Farcing operations may be carried out in order to improve the production from the well. This
entails pumping large quantities, approximately 1500 cu metres, of special water based fluid
into the well to open up flow paths in the reservoir rock and allow the well to produce more
efficiently.
4.9.7 WELL CONTROL AND BLOW OUT PREVENTION
Besides careful monitoring and control of the mud system and the installation of casing in each
section of the well, a surface wellhead consisting of a series of Blow out Prevention (BOP)
valves will be installed at the top of the casing. The function of BOP is to prevent uncontrolled
flow from the well by positively closing in the well bore as and when required. The BOP is
made up of a series of hydraulically operated rams, and is designed to withstand pressures well
in excess of those expected to be encountered.
Chapter 03 17 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.9.8 ACCOMMODATION AND SUPPLIES:
During the drilling and completion operation, accommodation for an average of about 150 rig
crew and 50 local labours will be arranged in a campsite. The camp area in addition to
workforce accommodation will include facilities for catering, washing and laundry, storage of
water and fuel, and power generation.
During the drilling program, the supplies, with the exception of casing, will be transported to
the rig in smaller trucks. Casing will be carried to the rig in 40ft flatbed trucks. General supplies
transported will include camp supplies (food, etc), fuels, oils and chemicals, and equipment
maintenance parts. Project personnel will travel to and from the rig in smaller vehicles, mostly
four-wheel drive pickups.
Water for rig and camp operation will be transported to the site from the suitable source. A
maximum of 150,000 litres of water will be required per day for this purpose. Water required
during construction of well site and all drilling activities is provided in Table 4.2.
Again the power requirement for drilling and domestic purposes will be met through
installation of diesel generators.
4.10 DECOMMISSIONING/ RESTORATION PHASE
The primary objective of this activity will be to ensure responsible waste management occurs on
site so as not to present any undue risk to the physical, biological or human environment. At the
conclusion of the drilling programmed a demobilization plan will be implemented. This will
provide for the orderly withdrawal of all personnel, and the removal of all unfixed drilling
equipment.
4.10.1 DEMOBILIZATION
After completion of the drilling and testing operation, the rig will be dismantled and
demobilized off the site. The well head will remain in situ, but all other equipment and
materials will be removed from the well site.
4.10.2 RESTORATION
Restoration will involve the removal of equipment that was not originally at the site and which
had been bought into conduct operation.
Standard Operating Procedure of site restoration for seismic and drilling operations;
• Demobilisation of all equipment and machinery
• Disposal of any waste material remaining at the time of completion of the operation
• Backfilling of all soak pits and septic tanks
• Dismantling and removal of fence or barriers
Chapter 03 18 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• General restoration of the site area including landscaping and restoration of drainage where
required
• Restoration of seismic lines will include removal of all cables, geophones, station units,
flags, stakes and wastes from the lines and back filling of all mud pits
• Liner from the water and waste pits at the well site may be taken out and re-used or
disposed off
• The areas covered by the portion of the access track that will be of no use for other wells
will be restored, in that all gravel topping will be removed.
Restoration plan checklist for seismic and drilling operation is given in Annexure VI.
4.11 PROJECT SCHEDULE
The project duration for seismic, construction and operation phases may increase if any
operational problems occur. The seismic survey is expected to take 6-8 months. The
construction and operation of the well is expected to take eight months. The proposed project
schedule for well Operation is expected to be as follows:
4.12 RESOURCE USAGE AND REQUIREMENT
4.12.1 RECRUITMENT
It is expected that overall project activities generates around 300 vacancies for technical, security
and unskilled worker. Local people will be given preference for unskilled job. Details of the
staff requirement for major phases of the project are as under:
Table 4.2: Project Schedule
Sr. No. Activity Duration (Week)
1 Seismic Activities 24
2 Construction Work 12 - 16
3 Mobilization 3 - 4
4 Drilling and Testing 12 - 16
5 Demobilization 2 - 3
Table 4.3: Workforce Required for Proposed Seismic & Drilling Activity
Type of Workforce Seismic Phase Construction Phase Drilling Phase
MPCL Employees 10 05 15
Contractor 400 30-40 120
Security Guards 40 40 40
Chapter 03 19 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.12.2 WATER REQUIREMENT
During seismic data acquisition, establishment of campsite and operational/drilling activities
either water will be procured through water tankers or obtained from tube well or appropriate
source. The estimated water consumption is mentioned below;
Table 4.4: Water Requirements during Project Activities
Phases Water Requirement (Gallons/day)
Domestic usage during seismic survey Approximate 160 Litres per capita/day
Construction of well site 1691 Gallons/day
Drilling Operations Approximate 50,000 to 60,000
4.12.3 ELECTRICITY REQUIREMENT
Electricity requirements will be fulfilled by diesel generators. Total numbers of generators with
their capacities utilized at different phases are as under:
4.12.4 FUEL REQUIREMENTS
Fuel requirement for the generation of electricity shall be obtained through local market. The
estimated fuel consumption is mentioned below;
4.12.5 VEHICLE REQUIREMENTS
Project personnel will travel to and from camp site and rig site mostly through small cars and
through single and double cabin pick up. Vehicles are used for following purpose;
• Fuel transport vehicles;
• Water transport vehicles;
Table 4.5: Electricity Requirements for Camp & Rig Sites During Operations
Phases Quantity Capacity (KVA)
Camp Site 02 400-500
Rig Site 04-05 1,000-1,300
Table 4.6: Fuel Requirements during Proposed Activities
Phases Fuel Requirement (litres /day)
Seismic 2,500
Operation 8,000-12,000
Chapter 03 20 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Heavy trucks for mobilisation/demobilisation;
• Vehicles for staff mobilisation;
• Earth moving and construction machinery/equipments
Table 4.7: Vehicle Requirements during Proposed Activities
Phases Quantity Vehicle Type
Seismic 4-5 Vehicles e.g. double cabin and single cabin pick up
Construction 3-4 Earth moving & construction equipments
Drilling 10-15 4x4 DD IMV, cranes, lifter, loader, cars and mobile
welding Plants
4.13 WASTE GENERATION AND DISPOSAL
4.13.1 SOLID WASTE
Solid waste generated at campsites will consist of both
hazardous and non hazardous waste. It is expected that 400-
500 kg/ month solid waste (hazardous / non-hazardous) will be
generated. Recyclable solid waste will be recycled through waste
contractor where applicable and hazardous waste will be disposed
off through approved waste contractor.
4.13.2 WASTEWATER
Wastewater produced during project activities mainly consist of grey and black water. Black
water will be directed towards septic tank & soak pit whereas grey water will be stored in soak
pits.
Seismic Phase
It is estimated that during seismic activities approximately 150 litres per capita per day
wastewater will be discharged.
Operation/Drilling Phase
It is estimated that 7000 -8000 Gallons / day effluent will be generated.
4.13.3 DRILL CUTTING AND MUD WASTE
Water based mud will be used during drilling. However HDPE lined, mud waste collection pit
will be constructed for the collection of drill cutting and waste mud. After water evaporation pit
will be backfilled by MPCL. Nature of waste material generation and integrated waste
management plan given in Annexure V
Chapter 03 21 of 21
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4.14 FIRE AND EMERGENCY PREPAREDNESS PLAN
MPCL have a clearly defined, well structured and dynamic Emergency Response Plan. This
plan is prepared to handle level 1 and level 2 emergencies defined by MPCL.
4.15 HEALTH, SAFETY AND ENVIRONMENTAL MANAGEMENT
The seismic, construction and drilling
contractors will have to meet the
requirements of Health, Safety and
Environmental (HSE) management
standards of MPCL. HSE monitoring
consultant will be deployed at project site on
the call out basis to monitor HSE
compliance executed by the consultant.
Health, Safety and Environment Policy of
MPCL, underscores commitment on
prioritizing health and safety of all its employees, contractors and visitors involved in its
activities and confer overriding commitment towards minimizing impact of its activities on the
natural environment.
Chapter 05 1 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
5 PROJECT ALTERNATIVES
5.1 PROJECT ALTERNATIVES
Three types of alternatives are considered for the proposed seismic and drilling activity in
Sujawal EL block:
• No Project Option
• Drilling Based (Coiled, Conventional Rotary, Slim hole)
• Mud Based (Water Based, Oil based)
In order to undertake exploration, a drilling program must be designed and executed. Various
drilling techniques exist and are applied dependant on the geological, reservoir and
environmental conditions of the site. The techniques evaluated include conventional rotary
drilling, coiled tubing and slim hole drilling. The chosen technique for this project is
conventional rotary drilling and the advantages and disadvantages of these are discussed
below.
5.1.1 NO PROJECT OPTION
The energy sector of any country plays a very important role in the growth and development.
Pakistan spends billions of dollars to import the crude oil and other petroleum products and as
a result total import bill is rising for every consecutive fiscal year. To reduce this loss of foreign
exchange the government is committed to maximum replacement of imported furnace oil and
diesel oil with indigenous natural gas.
The share of natural gas in primary energy supplies of the country is about 47.6% (Pakistan
Energy Yearbook, 2011), and is the primary fuel used in the fertilizer industries, in addition to
its uses in the residential, commercial sectors and in power generation.
In view of Pakistan's current energy crisis, it has become imperative for the country to explore
more indigenous resources to meet the domestic & industrial demands. MPCL is playing a very
important role in order to explore oil and gas in the country so that dependence on import may
be reduced.
An oil and gas discovery in the Sujawal EL Block (2467-11) will augment the present oil and gas
supplies of the country and reduce Pakistan’s reliance on imported fuel. With respect to above
realities the No Project Option seems to be highly unfavourable.
5.1.2 DRILLING TECHNOLOGIES
Coiled Tubing
A relatively modern drilling technique involves using coiled tubing instead of conventional
drill pipe. The technology uses conventional drilling assembly with a down hole motor (ICOTA,
Chapter 05 2 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
2005).This has the advantage of requiring less effort to trip in and out of the well (the coil can
simply be run in and pulled out while drill string must be assembled and dismantled joint by
joint while tripping in and out). Additionally, the coiled tubing is stripped into and out of hole,
providing a hermetic seal around the coil and, if desired, allowing the well to flow during
drilling operations. Instead of rotating the drill bit by using a rotary table or top drive at the
surface, it is turned by a down whole motor, powered by the motion of drilling fluid pumped
from surface.
However, there are some disadvantages of coiled tubing technology as follows:
• The whole diameter required to be drilled across the gas bearing formations in order to
effectively evaluate the productive capacity of these formations cannot be achieved with
current coil tubing technology.
• Coiled tubing cannot rotate so it is not a good option if there is a risk of differential
sticking.
• The tubing is prone to fatigue.
• Control and safety concerns in high-pressure wells with large volumes of pressurized gases
at surface in the exposed.
• Also of concern is depth control and reach limitations for horizontal drilling applications.
• Tighter controls on operating conditions and handling methods are required in coiled
tubing applications than are normally applied when using conventional drill strings.
Slim hole Drilling
The oil and gas well drilling method "Slim Hole Drilling" (micro whole or small hole) is one of
the most cost effective methods of oil and gas reserve development. It involves drilling smaller
diameter holes and using small diameter production casing and tubing. The use of small
diameter well bore reduces the overall cost of exploration drilling and reserve
development. According to DOE (1999), slim hole wells are defined as wells in which at least
90% of the hole has been drilled with a bit six inches or less in diameter. Although slim whole
technology has been available since the 1950s, it was not commonly used because the small-
diameter well bore restricted stimulation, production, and other down whole manipulations.
Slim whole drilling technology can cut the drilling and completing costs significantly. However,
the cost savings achieved from slim whole drilling can be offset by increased mechanical
failures, reduced lateral whole length and lack of directional control. Factors that affect
operations and economics in slim whole drilling are as following:
• The whole diameter required to be drilled across the gas bearing formations in order to
effectively evaluate the productive capacity of these formations cannot be achieved with
slim whole drilling technology.
Chapter 05 3 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• One of the disadvantages for slim whole drilling is drill string failures associated with use
of small diameter tubular. The reduced weight of slim whole drill pipe makes the drill
string mechanically weaker than its conventional equivalent.
• Tool joint failure is another problem for slim whole drilling. Because of small and thin
tubular and joints, they are-inherently weaker and have a tendency to bellying and twist-
offs, particularly in deeper holes.
• Kick detection is a difficult issue for slim whole drilling because a unit of reservoir gas
entering a slim whole annulus will occupy a much greater height than in conventional
wells. This can result in maximum allowable pressure in the casing being approached
faster than in a conventional well.
• Another disadvantage for slim whole drilling is decreasing in penetration rates, especially
for roller cone bits.
• Depth is a key limiting factor when considering slim whole well design.
• Borehole integrity and instability are other concerns for slim whole drilling. Because of
small annul space between drill strings and wellbore, the pressure loss is larger than
conventional drilling.
• One major limit of slim whole horizontal drilling has been the inability to effectively
transmit weight to the bit.
Conventional Rotary Drilling
The conventional process of drilling oil and gas wells uses a rotary drill bit that is lubricated by
drilling fluids or mud. As the drill bit grinds downward through the rock layers, it generates
large amounts of ground-up rock known as drill cuttings. This technology is discussed in detail
in previous sections of this chapter. Its advantages include:
• Most rock formations can be drilled.
• Water and mud supports unstable formations.
• Fast operation is possible above and below the water-table.
• Possible to drill to depths of over 4000 meters.
• Possible to use compressed air flush.
Disadvantages of rotary drilling are:
• Requires capital expenditure in equipment.
• Greater volume of water is required for pumping.
• Greater volume of drill cuttings generated
• Rig requires careful operation and maintenance.
Chapter 05 4 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Selection
Conventional rotary drilling proposed by MPCL has been historically used for the drilling of oil
and gas wells. Other drilling techniques discussed above include coiled tubing and slim holes.
Despite some environmental gains in the use of coiled tubing and slim holes (reduced well site
area, reduced waste volumes etc), both techniques have significant technical disadvantages and
operational limitations. Moreover, there is a finite supply and quantity of suitable drilling rigs
and in the case of breakdowns, required back-up and service facilities, specialized replacement
equipment or technical vendor support this may not be as readily available as for conventional
rigs. Advantages of the two techniques therefore do not outweigh their disadvantages.
Conventional drilling technique proposed by MPCL is therefore considered to be the best
available technology.
5.1.3 DRILLING MUD SYSTEM
Drilling mud (also termed fluids) are used during the drilling process to transport rock chips
(cuttings) from the bottom of the well, up and out of the well bore, where the cuttings are
screened and removed, and the separated mud is reused. Drilling mud also act to cool the drill
bit, to stabilize the well walls during drilling, and to control formation fluids that may flow into
the well.
Generally two broad categories of mud are used for drilling of oil or gas wells;
� Oil Based Mud and
� Water Based Mud
Oil based mud is formulated by mixing chemicals with diesel. This mud is not considered to be
environment friendly due to the risk of contamination of subsurface formations during drilling
and the generation of oily drilled cuttings which require specialized handling and treatment. A
water based mud (WBM) system will be used which due to the above-mentioned reasons has
environmental preference over oil based mud and is therefore considered to be the preferred
alternative.
Chapter 06 1 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6. ENVIRONEMNTAL AND SOCIAL BASELINE
This chapter defines the prevailing physical, biological and socioeconomic environment of the
project area and surrounding. The project area in this document is defined as the area where the
project related activities are to be carried out which include the project site, its surrounding and
the area that can interact with the project’s positive and negative externalities in the long run.
The environmental impact of any activity or process will be assessed on the basis of a deviation
from the baseline or normal situation.
The information presented in this section has been derived by a combination of desk study and
field survey. Field survey was conducted to collate primary data for water, flora, fauna, noise
and socio-economic features. A team consisting of an Environmentalist, Sociologist, Ecologist
and Wildlife experts visited the project area.
Followings are the main components of the baseline discussed in this section.
• Physical Environment
• Biological Environment
• Socio-economic Environment
The description provided in this section is based on followings:
• Desktop study and literature review
• Meetings and data collection form MPCL
• Baseline data gathered from field activities
• Baseline data from relevant departments
• Government released publications such as Provincial and Federal census reports
6.1 PHYSICAL ENVIRONMENT
6.1.1 GEOGRAPHY
Sujawal block falls in districts Thatta and Sujawal of Sindh province. These districts are
bounded on the North by Dadu district, on the East by Hyderabad and Badin districts, on the
South by Runn Cutch area and Arabian Sea and on the West by Karachi division.
The historical city of Thatta, which was once the capital of Sindh, was carved out from Karachi
as a separate city in August 1948. It is the second largest district in Sindh. This district, divided
by River Indus, remained unified for over 65 years. According to the notification October 2013
issued by the Sindh Revenue Department, the right side of River Indus will comprise old Thatta
district and the left side will come under the jurisdiction of newly created Sujawal.
Total area of both districts is 17,355 Km2 and comprises of 9 talukas, out of which six are coastal
and three are non coastal talukas; and 53 Union Councils. District Sujawal consist of Taluka
Chapter 06 2 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Mirpur Bathoro, Shah Bander, Kharochan, Jati and Sujawal while District Thatta consists of
Taluka Mirpur Sakhro, Ghorabari, Keti Bandar and Thatta.
Among these talukas, EIA study area is spread over in Mirpur Sakhro, Mirpur Bathoro, Jati
Sujawal, Thatta and Ghorabari talukas of the districts.
6.1.2 TOPOGRAPHY
The macroenvironment of the project area i.e. district
Thatta and Sujawal has varied features in its physical
aspects, which range from coastal swamps to fresh
water marshes and lakes and from river islands to
coastal deltas. The terrain of these districts consists of
the Makli Hills close by the Thatta town. These hills
are 32 kilometers in length and are well known on
account of the ancient tombs which are located here.
The north western part of the district consists of hilly
tracts known as Kohistan. Between Sir and Khori Creeks lie the great Sirganda salt deposits
which consist of many square kilometers of solid salt.
River Indus flows downstream the Kotri Barrage through numerous creeks till its delta in
Arabian Sea near chach deh wali Mohammad at Keti Bunder. The south-western part of the
district is saline and sea-affected due to long coastline of about 107 kilometres as well as
shortage of river Indus water, while the southern portion adjoining “Great Run of Kachh” on
the border of India is desert like sandy area.
The microenvironment of the study area encompasses a flat terrestrial land consist of
agriculture and reverine forest area of River Indus.
The project area is rich in natural resources having diverse and productive habitats, and
ecosystems. These include forests (riverine and irrigated), variety of biodiversity, water logged
and wetlands. The riverine forests have rapidly converted into agriculture land for economic
development in project area. While agriculture activities are major part of livelihoods, livestock
(cattle poultry and fish farming) was also a key component of earning money. Wood cutting
and forest products enable households to meet timber and fuel needs as well as supplement
their incomes. Infrastructure of metallic paved/ unpaved roads Bachao Band near Indus River is
also exist in the project area.
The area had a rich history and economic opulence in the past. Since last three decades, after the
upstream construction of Tarbella Dam in 1977, the coastal ecosystem of Indus delta is under
stress from seawater intrusion and an increase in salinity and water- logging. Consequently, the
cultivation of field and historical crops like red rice and commercial fish farming has declined
drastically. Potable water has become scarce in the project area.
The project area is quite prone to natural hazards and has experienced six natural disasters in
recent years; a cyclone in 1999, drought in 2000, earthquake in 2001, drought followed by
Topography of Project Area
Chapter 06 3 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
floods in 2003, Super Flood of 2010 and the flash- floods of 2011. Disaster affected families have
never been appropriately assisted through affective recovery and rehabilitation programs. The
other limiting factor in the area is increasing sea intrusion, caused by the diurnal and cyclic
fluctuation of the sea level, apparently it is a climate change effect augmented by the degrading
ecology of the area.
6.1.3 GEOLOGY
The Lower Indus Platform Basin is bounded on the North by Central Indus Basin, to the
Northwest by the Sulaiman Foldbelt Basin and the Kirthar Fold Belt Basin in the South West.
The main tectonic events which have controlled the structures and sedimentology of the Lower
Indus Basin are rifting off the Indian Plate from Gondwanaland (Jurassic or Early Cretaceous)
which probably created NE-SW to N-S rift systems, isostatic uplift or ridge-push at the margins
of the newly developed ocean probably caused uplift and eastwards tilting at the start of the
Cretaceous. Separation of the Madagascan and Indian plates in the mid to late Cretaceous
which may have caused some sinistral strike-slip faulting in the region, hotspot activity and
thermal doming at the Cretaceous-Tertiary boundary. This in turn caused uplift, erosion,
extrusion of the Deccan flood basalts and probably the NNW-striking normal faults.
Palaeocene-Eocene emplacement of the Bela Ophiolites may have caused gentle folding, Eocene
passive margin conditions caused structural quiescence and carbonate deposition, Oligocene to
present-day Himalayan collision caused sinistral transpression in the west of the Lower Indus
Basin, with fold-thrust structures overprinted by sinistral flower structures.
a) Stratigraphy
This tectonic province is underlain by infra-
cambrian to recent clastics and carbonates. It
remained passive margin until the Late Cretaceous,
and then became part of the complex suture
between the Indian Plate and the Afghan Block.
The sratigraphic succession changes from east to
west. Precambrian basement is exposed in the
south-eastern corner of the basin. The thickness of
the sediments increases westward. Important
unconformities occur at base Permian and base
tertiary. In the eastern part of the basin, tertiary has direct contact with the Jurassic sequence.
b) Soils
Project area is located in the lower part of Indus Plain. Its productive soils in central plains have
been formed by actions of the Indus River which deposits silt cover along both sides of river
banks during Abkalani every year since time immemorial. These alluvium soils are largely
medium to fine textured and generally with high ratio of silt, loam, clay and contain equitable
lime-magnesium ratio and low amounts of sodium carbonate (Almubarak, 1975) The soils of
Chapter 06 4 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
riverine tract are sand, slit loam and silty clay in
general are very fertile and the topography of the
riverine belt is flat but uneven due to annual silt
deposition.
In the project area, two types of soil
characteristics can easily be observed i.e.
camborthids and salorthids. Camorthids soil has
more than 15 percent calcium carbonate mostly as
silt size fraction. As there is no strong zone of
lime accumulation, the root zone is quite deep.
Such soils have either no profile development or
only a weak structural B horizon. Many parts of
these soils are strongly saline or saline-alkali. Salorthids soil characteristic found in
indogengatic plain largely are manmade as a result of the application of excessive amount of
irrigation water on a plain which is nearly flat and ground water drainage is slow. The salinity
of river water is low but ground water is quite saline.
The microenvironment of the study area encompasses a flat terrestrial land consist of
agriculture holdings, natural vegetation, River Indus and Southern deltaic region of River Indus
containing number of creeks. Indus delta is assessed to be the seventh largest delta in the world.
The coastal talukas of Sindh is rich in natural resources having diverse and productive habitats,
ecosystems and natural resources. These include forests (riverine and irrigated), variety of fish,
wildlife, agriculture and livestock and a wetlands complex. The area was covered with
agriculture land and some thick patches of riverine forest in north south portion of the project
area. While fruit/crops farming and fishing formed a major part of coastal livelihoods. Wood
cutting and forest products enabled households to meet timber & fuel needs as well as
supplement their incomes. Livestock ownership was an additional resource for supplementing
household consumption and as a key coping mechanism during economic crises and disasters.
Soil samples were collected at different locations of project site. 26 parameters were analyzed to
determine soil quality of the project area. Soil analysis results are given in below Table.6.1
Table.6.1. Soil Analysis Results
S.No Parameters Method Unit LDl
Test Results
S2
(Thatta)
S1
(Sujawal)
01 pH Based on ASTM D
4972-B - - 07.65 08.31
02 Electrical Conductivity 1S0-11265:1994 µS/cm - 12630.00 36100.00
03 Total soluble Salts Calculated (Based
on1S0-11265:1994) mg/kg - 41679.00 118965.00
Chapter 06 5 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
04 Sodium adsorption Ratio
(SAR) calculated - - 04.90 25.11
05 Sulfate In house
Gravimetric mg/kg 50.00 576.10 25492.43
06 Chloride (Cl) (Water
soluble)
Based On APHA
4500Cl-B mg/kg 01.00 12695.56 32526.89
07 Calcium (Ca) Based on USEPA
3050 B mg/kg 00.50
275000.0
0 32000.00
08 Magnesium(Mg) Based on USEPA
3050 B mg/kg 00.50 5500.00 16200.00
09 Phosphorous, Total Based on USEPA
3050 B mg/kg 01.00 114.25 518.90
10 Potassium Total Based on USEPA
3050 B mg/kg 00.50 2550.00 5400.00
11 Nitrogen, Nitrite(Water
soluble)
In house
colorimetric mg/kg 01.00 02.48 56.80
12 Nitrogen, Ammonia APHA 4500 NH3
B&C mg/kg 01.00 736.84 902.63
13 Nitrogen, Total
Kjeldahl(TKN)
Based on APHA-
4500Norg B mg/kg 01.00 921.05 994.74
14 Boron USEPA 3050B mg/kg 00.50 56.05 82.40
15 Manganese USEPA 3050B mg/kg 00.50 179.60 339.80
16 Molybdenum (Mo) USEPA 3050 B mg/kg 00.50 <00.50 08.40
17 Zinc(Zn) USEPA 3050B mg/kg 00.50 01.75 38.00
18 Arsenic (As) USEPA 3050B mg/kg 00.50 <00.50 <00.50
19 Cadmium(Cd) USEPA 3050B mg/kg 00.50 <00.50 <00.50
20 Chromium(Cr) USEPA 3050B mg/kg 00.50 11.45 19.20
21 Lead USEPA 3050B mg/kg 00.50 07.85 08.00
22 Mercury (Hg) USEPA 7471B mg/kg 0.050 30.08 44.44
23 Selenium (Se) USEPA 3050B mg/kg 00.50 <00.50 <00.50
24 Oil & Grease In house
Gravimetric mg/kg 10.00 <10.00 <10.00
25 Phenols, Total In house
colorimetric mg/kg 01.00 <01.00 <01.00
26 Nitrogen, Nitrate (Water
soluble)
In house Uv
spectrophotometri
c
mg/kg 01.00 45.52 438.89
Soil quality monitoring of MPCL project area was conducted in accordance with standard
procedures and protocols at 2 sites of the project to determine the extent of its naturally derived
Chapter 06 6 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
essential components and assess any suspected pollution caused by anthropogenic activities.
Details of these samples are depicted below:
• Fertile land ( Thatta S-2)
• Barren Land (Sujawal S-1)
Soil constitutes a vital environmental matrix and it is a significant part of baseline
environmental studies. Physically soil is composed of fundamental mineral induced particles
referred to as Clay, Silt, Silica and Gravel; whereas chemically it is composed essentially of air,
water, mineral matter and some organic matter. Diverse distributions of fundamental particles
in soil determine the soil character. Soil is highly amenable to contamination of various types
and degrees caused primarily by anthropogenic activities; whereas natural contaminations are
from rare to none.
Soil invariably consisting of diversity layers or Horizons in which the topmost layer also
referred to as “A Horizon” is significantly affected. Soil pollution is occurred when the
productive layer of soil is contaminated by the human induced chemicals which results in
altering the natural properties and productivity of the soil. This can severely affect the flora and
fauna on the earth cover, groundwater regimes and including the human health.
Criteria monitoring parameters including pH, electrical conductivity, sodium adsorption ratio
(SAR) ,total soluble salts, Phosphorous, Nitrogen Compounds, Potassium, Calcium (Ca),
Magnesium (Mg), Chloride, Sulphate and pollutant parameters including Oil & Grease,
Phenols, heavy metals including Boron , Chromium (Cr), Manganese (Mn), Molybdenum (Mo),
Zinc(Zn), Arsenic (As), Cadmium (Cd), Mercury (Hg), Lead (Pb) and Selenium (Se) were
monitored to determine the magnitude of these components at project sites.
Analysis pattern of these samples indicates its pH was lowest recorded 7.65 at Thatta (S2) and it
was highest recorded at 8.31 at Sujawal (S1) site of the project. pH primarily determines acidic
or caustic behaviour of soil on which all terrestrial life including human, aquatic biota soil
productivity & fertility depends on. It is found within reasonable limits that range from 6 to 7.5
as a productive soil character guideline. The diverse pH ranges and its general characters are
depicted below:
• pH of: 5.5 and less = Strongly Acidic
• pH of 5.5 - 5.9 = Medium Acidic
• pH of 6.0 – 6.4 = Slightly Acidic
• pH of 6.5 – 6.9 = Very Slightly Acidic
• pH of 7.0 = Neutral
• pH of 7.1 – 7.5 = Very Slightly Alkaline
• pH of 7.6 – 8.0 = Slightly Alkaline
• pH more than 8.0 = Very Alkaline
Chapter 06 7 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Elevated pH figures from neutrality of pH=7.00 do not support general plant growth and life;
although, there are some classes of vegetation which even grow and propagate at extremes of
pH.
Physical tests on E. Conductivity indicate that all the samples consisting viable amount of
soluble salts that are mainly derived from widespread distribution of alkali and alkaline earth
materials include Na, K, Ca, Mg, Chlorides and Sulfates etc. These are regarded as vital and
major nutrients for soil...The total soluble salt contents were found increasingly high at both the
locations of the project with recorded value of 118965mg/kg at Thatta (S2) and 41679mg/kg at
Sujawal (S1).
Soil invariably is heterogeneous mixture of air, water, mineral matter and some organic matter
in which air is penetrated deep to a considerable depth and constituting about 35% of the total
chemical mixture. Above earth cover, dead and waste vegetation and animals remains
contribute substantial part of organic matter to the soil ecosystem which later on converted to
soluble nitrate through series of chemical and bio-chemical reactions; and hence increase the
soil fertility.
Amounts of Phosphorous, Nitrogen Compounds and Potassium were determined to assess its
fertility character. Analyses figures of these components depicted as under:
• Total Phosphorous Min 114 ppm, Max 518 ppm
• Nitrogen, TKN Min 921 ppm, Max 994 ppm
• Nitrogen Ammonia Min 736 ppm, Max 902 ppm
• Nitrogen Nitrite Min 2.48 ppm, Max 56 ppm
• Nitrogen Nitrate Min 45 ppm, Max 438 ppm
• Potassium Min 2550 ppm, Max 5400 ppm
Minimum nutrient figures were found in fertile land of Thatta district; whereas highest figures
were recorded in Barren land of Sujawal District.
Organic derived pollutants including Oil & Grease and Phenols were found below reporting
limit of 10 & 1.0 mg/kg respectively, posturing no alarm to soil environment.
Oil and greases are regarded significant pollutants in soil ecosystem; that only originates from
anthropogenic activities.
Heavy metals including B, Mn, Mo, and Zn were determined to assess its respective magnitude
because at trace level they contribute micronutrients for soil through biological induced activity;
but at large concentration they behave as obligate contaminants for soil environment.
Respective concentrations of each of these metals are depicted in the above Table 6.1 which
indicates that these metals are recorded at sufficiently low level. Strictly defined toxic heavy
metals including As, Cd, Cr, Hg, Pb and Se were also analyzed to assess its significant impacts
on soil ecosystem. Analyses trend of 3 heavy metals As, Cd, and Se indicates that they were
Chapter 06 8 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
found below reporting limit; whereas Hg, Cd were found at some elevated figures and might
cause disregard to the soil ecology of the project site; Chromium was also noticed at lower level
of 11mg/kg and 19mg/kg at Thatta (S2) & Sujawal(S1) respectively.
c) Conclusion:
Both soil samples S1 and S2 indicates the soil of project site is eco-friendly and is found free
from noxious pollutants that can cause any damage to soil cover of the project corridor. Organic
pollutants including Oil & Grease and Phenolic compounds were mostly found at levels below
reporting limit; whereas inorganic pollutants were also registered at such low levels to cause
any sort of environmental disturbance to soil environment of the project site.
6.1.4 CLIMATOLOGY AND METEOROLOGY
Climatically Sindh lies between two monsoons; the Southwest monsoon from the Indian Ocean
and the Northeast or retreating monsoon deflected towards it by the Himalayan Mountains,
and thus escapes the influence of both. The strong Southwest monsoon period prevails from
May to September while the weak northeast monsoon period is restricted to the period between
Decembers to January. The period between the two monsoons is considered to be transitional or
calm period with winds of variable speed and direction. Weather during the inter-monsoon
periods is uncertain and short spells of dust storms, dry weather, or a humid cool breeze may
prevail for short durations.
The average rainfall in Sindh is only 6-7 inch (15-18 cm) per year. The regions scarcity of rainfall
is compensated by the inundation of the Indus twice a year, caused by the spring and summer
melting of Himalayan snow and by rainfall in the monsoon season. These natural patterns have
recently changed somewhat with the construction of dams and barrages on the Indus River.
The climatic conditions of Sindh differ in the upper, middle and lower regions. The project area
falls in lower coastal region. The winding coastline in lower Sindh affects the climate of the area
to some extent. The coastal and deltaic regions are naturally damper, with smaller ranges of
temperature and pressure. The prevailing air currents are the southwest winds in summer and
northeast winds in winter. Rainfall at times is a little lower here than in middle Sindh.
Humidity is the greatest and temperatures are moderate throughout the year. High humidity
causes muggy or oppressive weather in summer and the climate is classified as maritime.
(Sindh State of Environment and Development, IUCN, 2004)
The climate of Thatta and Sujawal district is moderate. The mean maximum and minimum
temperature recorded about 40°C and 25°C respectively. The sea breeze blows for eight months
of the year, from March to October, making the hot weather comparatively cool. As a result
there is an immediate fall in temperature. January is the coldest month. The annual average
rainfall of the district is about 200 mm.
The project area has a tropical climate, in winter there is much more rainfall than summer. The
average annual temperature in project area is 26.4 °C and about 221 mm of precipitation falls
annually. Metrological data of Thatta has been obtained from Pakistan Meteorological
Chapter 06 9 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Department and has been used as a data source of the project area for the following
metrological parameter.
• Mean Monthly Precipitation
• Mean Monthly Maximum Temperature
• Mean Monthly Minimum Temperature
• Mean Monthly Wind Velocity
• Mean Monthly Relative Humidity
a) Rainfall
The annual rain fall in the macro-environment area varies from minimum 0.65 mm in 2013 till
maximum of 415.7 mm rainfall experienced during the year 2010. The monthly amount of rain
fall data recorded at Thatta Metrological Station of Pakistan Metrological Department is
summarized in Table 6.2 whereas annual rainfall data of last six year is presented in Figure 6.1.
The recorded heavy rainfall in the project corridor is during the monsoon season from July to
September.
Table 6.2: Monthly Amount of Precipitation (mm)
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual
2008 1.6 11.6 0 0 0 0 58.2 40.2 0 0 0 17.4 129
2009 0 0 0 0 0 10.8 142.4 83.6 41.2 0 0 0 278
2010 0 0 0 0 0 54.4 181.1 130.5 32.1 14.6 3 0 415.7
2011 0 11.8 0 0 0 0 0 170.9 116.4 0 0 0 299.1
2012 2.2 3 0 0 0 0 0 34.2 159.4 0 0 6.8 205.6
2013 0.1 0.1 0.1 0.1 0.2 0.9 2.8 1.13 1 0.1 0 1.3 0.65
Figure 6.1: Annual Rain Fall in Thatta
Chapter 06 10 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
b) Temperature
Meteorological data on mean monthly minimum temperature indicates that it was minimum
registered 10.5 °C in the month of January, 2008 whereas it was highest recorded 28.3 °C during
the month of Jun, 2008. In addition mean of monthly minimum temperature was found 23 °C in
January, 2008 while it was recorded maximum at 39.2 °C during the month of May, 2013. Last
six years mean monthly minimum and maximum temperature data is presented in Table 6.3 &
Table 6.4.
The maximum annual temperature was found 34.8 °C in 2013; and it was minimum registered
20.8 °C during the year 2011. Figure 6.2 present the graphical summary of mean annual
minimum & maximum temperature.
Table 6.3: Mean Monthly Minimum Temperature (ºC)
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual
2008 10.5 12.3 20.4 23.6 26.7 28.3 27.4 26.3 26.3 24.3 18.7 15.6 21.7
2009 14.6 16.9 21.2 23.4 26.9 28.1 27.8 27.2 26.2 23.7 18.9 14.7 22.5
2010 12.6 14.5 20.9 23.5 26.6 27.2 27.2 26.6 25.3 23.7 18.5 11.9 21.5
2011 10.7 14.5 19 22.2 26 27.2 26.5 25.2 24.5 21.5 20 12.7 20.8
2012 10.4 11.3 22.5 23.3 26 27 26.9 25.5 24.8 22.5 18.4 12.7 20.9
2013 13 14.3 19 23.6 27 27.6 26.3 43.3 24.3 19.3 12 9.3 21.5
Table 6.4: Mean Monthly Maximum Temperature (ºC)
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual
2008 23 27 35.1 35.6 34.5 36.1 33.7 32.1 34.4 35.5 31.9 25.5 32
2009 25.2 29.5 33.7 36.9 38.1 36.8 34.5 33.5 32.5 35.7 31.4 27.3 32.9
2010 26.1 28.8 35.3 37.1 37.5 35.4 35.2 33.1 34.1 36 31 26.6 33
2011 25 27.6 33 36.3 35.4 35.8 34.7 33.2 32.1 34.3 32.1 26.8 32.2
2012 24.6 26.1 32.7 36 36 35 33.9 32.9 33.1 34.7 32.5 26.9 32
2013 29.2 29.6 35.6 39 39.2 37 34.3 53.3 34.3 34.3 28.6 24.3 34.8
Figure 6.2: Annual Maximum & Minimum Temperature in Thatta
Chapter 06 11 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
c) Wind Speed
Mean monthly wind speed trend in the macro environment of project corridor was lowest
recorded at 0.3 knots during the month of November & December; 2009 and it was highest
recorded 15.9 knots during the month of May, 2008. Five years mean monthly wind speed data
is presented in Table 6.5 while Figure 6.3 shows mean annual wind speed.
Table 6.5: Mean Monthly Wind Speed
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual
2008 8 6.3 9.5 13.1 15.9 11.4 13 13.5 11.4 9.2 6.1 7.5 10.4
2009 8.5 0.7 1 1.1 1.1 9.3 1 0.8 0.6 0.4 0.3 0.3 2.1
2010 4.6 5.4 7.5 8.9 12.9 11.1 9 6 4.3 4.3 4.8 3.2 6.8
2011 4.2 4.1 8 8.1 1.5 13.1 10.2 8 2.8 2.8 2.1 2.3 5.6
2012 3.1 3.2 5.1 7 10 10.5 11 7.7 3.9 2.3 1.9 2.6 5.7
2013 9 4.3 8.3 8.3 7.3 6.3 7 5.3 6.6 5.3 2.6 1.3 5.9
Figure 6.3: Mean Annual Wind Speed in Thatta
d) Humidity
The relative humidity in project region varies from 23 to 91 % in morning and afternoon hours
respectively. Relative humidity was lowest registered 40.6% in the month of March, 2013; and it
was highest recorded 91 % during the month of May, July and September 2012. Six years (2008-
2013) mean monthly relative humidity is presented in Tables 6.6.
The maximum annual relative humidity was found 83.4 % in 2012; and it was minimum
registered 58.8 % during the year 2013. Figure 6.4 present the graphical summary of mean
annual relative humidity.
Chapter 06 12 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 6.6: Mean Monthly Relative Humidity (%)
Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Annual
2008 67 69 74 80 85 82 80 85 81 82 65 79 77.4
2009 69 75 79 72 84 84 86 88 89 85 70 63 78.7
2010 75 75 83 84 87 87 88 90 86 86 71 75 82.3
2011 74 77 77 78 87 85 84 88 91 81 84 72 81.5
2012 72 63 80 85 91 90 91 89 91 89 86 74 83.4
2013 72 56.3 40.6 47.3 59.6 57.3 62.6 71.7 63.3 60.6 60.6 54.6 58.8
Figure 6.4: Mean Annual Relative Humidity in Thatta during 2008- 2013
6.1.5 WATER RESOURCES
a) Surface Water
Indus is the only river passing through the macroenvironment and microenvironment of the
project site. The total available freshwater flow in the Indus is about 180 billion m3, carrying
with it some 400 million tonnes of silt (Mendel and Qureshi 1993). Over the last 60 years a series
of dams, barrages and irrigation schemes have been built in upstream parts of the River Indus.
It is estimated that up to 60% of the Indus water is used to feed Pakistan’s irrigation networks,
and that the Indus watershed irrigates up to 80% of Pakistan’s farmland (Iftikhar 2002).
Besides Indus, the district Thatta/ Sujawal has numerous water courses which drain from the
hills and are known as Nais. The important Nais in the district is Gagar and Ranpathani.
There are many lakes in the district. The famous are Kalri and Haleji. Kalri is a picturesque lake,
situated about 19 km south of Thatta. It was formed by the combination of two lakes Kinjhar
and Sonehri, and takes its present name from the main canal Kair-Bagha feeder, from which it is
feed at present. This lake acts as a great reservoir for feeding canals of Thatta sub-division.
In the microenvironment, there is a canal coming from river Indus used by local community
residing nearby project area. This sweet water is available about 3-4 km away from the
Chapter 06 13 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
community and the dwellers have to travel there in order to procure water as it is the only
available source of water.
In addition to Indus River, the project north eastern & western boundaries have numerous
water courses (channels) which drain the northern hills during monsoon season and are
referred to as Nais .There exists violent water inflow torrents following monsoon precipitation
but it quickly dries up when the rainy season ceases. Most important among them is Nai-Baran
which originates from Kirthar range of heights.
b) Irrigation/Canal System
The Irrigation System of Pakistan is the largest integrated network in the world, serving 42
million acres of cultivated land. In the Sindh province, fertile lands are in the Indus basin,
irrigated through canal system. The system is fed by the waters of Indus River and its
tributaries. Diversion of river waters into off taking canals is made through barrages, which are
gated diversion weirs. The main canals in turn deliver water to branch canals, distributaries and
minors. The watercourses get their share of water through outlets in the irrigated channels.
Proposed project area lies in left and right bank of Indus River in which different canals,
branches and minors were observed during field visit. Major canals in the project area are Darro
Branch, Pinyari. In both branches different water courses distributed water in project area i.e.
Mir Khan Mori, Baygannah Mori, Pir Patho Mori 103, Budho Talpur Minor,Khizar Minor, Mirzo
Mori and Bhagar Mori etc.
c) Wetlands
In project area natural and manmade wetlands exist where rain or flood and irrigated waste
water are stored. These wetlands are commonly called Dhands. Wetlands have different
mechanism to provide shelter to different animals, reptiles, and fish and birds species. During
interview with local community, people said natural wetlands are destroyed due to floods,
mixing of agriculture runoff and manmade fish farm system and storage of water for
agriculture purpose. During field visit different dhands were visited to collect baseline data of
the project area i.e. Kari, Bhabra, Machol, Chach Sakhro, Sumar, Mol, Sovan Waro, Saitari
Dhand.
d) Ground Water
Ground water is available in the project area for domestic and drinking purpose. Ground water
quality varies from one place to another. In villages ground water is mostly saline in nature.
Main sources of recharging ground water are Indus River and irrigation system while ground
water table in the project area varies from 20 ft to 60 ft in depth.
In order to assess the water quality of the project surrounding area, water samples were
collected during site visit. Total of 09 criteria chemical tests were performed to characterize
water quality in terms of its initial baseline. Table 6.7 shows the summary of the water results.
Chapter 06 14 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 6.7: Raw Water Analysis
Parameters Methods Units Ldl Test Results
G.W1 G.W2 G.W3 S.W4 S.W5
pH at 25 ° APHA 4500 H+ - - 7.71 7.43 07.37 8.00 7.73
Conductivity,
Electrical APHA 2510 B µS/cm 0.01 2680.00 1640.00 2003.00 1953.00 1010.00
Total Suspended
Solid (TSS) APHA 2540 D mg/L 5.00 7.50 < 5.00 < 5.00 14.00 16.50
Total Dissolved
Solid (TDS) APHA 2540 C mg/L 5.00 1892.0 1124.0 1424.0 1352.0 712.0
Hardness, Total
as CaCo3 APHA 2340 B mg/L 0.05 656.98 431.38 593.35 377.69 173.56
Chloride (Cl) APHA 4500 Cl- B mg/L 5.00 646.16 232.03 301.19 350.22 143.59
Sulphate (So4) APHA 4500 So4 C mg/L 5.00 182.30 157.20 208.22 250.20 5173.23
Iron (Fe) APHA 3120 B mg/L 0.005 0.815 0.376 0.489 8.066 2.824
Manganese (Mn) APHA 3120 B mg/L 0.005 0.171 0.235 0.286 0.170 <0.005
Zinc(Zn) APHA 3120 B mg/L 0.005 0.015 <0.005 <0.005 <0.005 <0.005
GW: Ground Water. SW. Surface Water
Five water samples of varying matrix were collected under standard procedures and protocols
to determine and assess the extent of its natural essential components and any suspected
pollution caused by biological and non-biological contaminants. Details of these samples are
depicted bellow;
• Ground Water: 3 samples
• Surface Water: 2 Samples
Total 12 physiochemical parameters including 3 heavy metal tests were conducted to assess the
sanitary quality of these water resources.
Physical analyses trend on these water resources indicates its pH is lingering minimum at 7.37
and it was highest recorded 8.00 in stagnant water of sample 3; and has shown suspension
interference in sample 1, 3 and 5 respectively; and is found to possess brackish character except
sample 5 of canal water. Its TDS was recorded lowest at 712 in canal water and it was highest
found 1892 mg/l in ground water of sample 1 respectively.
Its total hardness figures were registered lowest at 173 mg/l in canal water of sample 5 and were
highest recorded 656 mg/l in ground water of sample 1 respectively. The recorded figures of
major anions Sulphate & Chloride were found lowest at 143 & 157 mg/l and were highest
Chapter 06 15 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
recorded 250 & 646 mg/l respectively in stagnant water & ground waters of sample 3 & 1
respectively; the recorded figures of oil & grease remained below reporting limit of 0.01mg/l in
all 5 samples.
Among heavy metal contaminants, Iron was lowest recorded 0.376mg/l in ground water sample
2 and was highest found at 8.05mg/l in stagnant water sample 3; Manganese was lowest
recorded 0˂.005mg/l in ground water sample 2 and was highest found at 0.286mg/l in ground
water sample 4; and Zinc was lowest recorded 0˂.005mg/l in 4 samples and was highest
registered at 0.015mg/l in ground water sample 1.
e) Conclusion:
Physical and chemical analyses trend on these samples indicate that 4 samples (Samples 1
through 4) possessing mild to mild brackish character, can viably be utilised for drinking
application after mild desalination process including RO or Thermal treatment; whereas canal
water of sample 5 can be inexpensively treated by simple physical treatment including
sedimentation and finally by disinfection, can yield water for drinking applications.
6.1.6 AIR QUALITY
In the absence of acute industrial units and mobile vehicular traffic there is no pollution in the
project corridor. The air quality in the area is generally good, with negligible sources of
pollution like emissions from vehicular traffic which cause smoke and dust emissions with
localized effect.
Ambient air quality monitored at three locations result is given in Table 6.8.
Table. 6.8. Ambient Air Quality Monitoring (8 hour) of Project Area
Parameter CO NO NO2 SOX TSP PM2.5 PM10
NEQS Limit 120 40 80 120 500 35 150
Sujawal City 3.2 7.1 7.4 7.4 345 30 80.5
Mirpur Sakhro 7.9 13.5 13.8 7.9 354 24 125
GhulamUllah 3.4 8.8 9.2 3.4 299 23.7 123
Jati Chowk 2.9 9.6 9.7 3.4 265 22 133
Mir Khan Mori 1.8 9.3 9.6 1.3 480 118 441
6.1.7 NOISE
Elevated noise is viably absent in the project proximities due to acute absence of noise causing
equipments in the project corridors. Generally, significant sources of noise emanation are
triggered by vehicular movement at road side and noise induced by human population which is
assumed falling extremely short. Noise Level monitoring results given in Table.6.9. Figure 6.5
Environmental Monitoring Location Map.
Chapter 06 16 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table.6.9 Average Noise Monitoring Result Of Project Area
Sample location Noise Level NEQS Limits
dB (Residential Area)
Day time 55. Night time 45
(Silence Area)
Day time 50. Night time 45
Sujawal City 58
Mirpur Sakhro 57
GhulamUllah 61.5
Mir Khan Mori 61
Jati Chowk 59
Chapter 06 17 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Pictorial Presentation of Environmental Monitoring of Project Area
A view of Surface water sampling at Project
Water
A view of ground water sampling at Project
Water
A view of noise monitoring at Study Area A view of ambient monitoring at Study Area
View of ambient air monitoring at `Project Area A view of soil sampling at Study Area
Chapter 06 18 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.5. Environmental Monitoring Location Map
Chapter 06 19 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.2 VULNERABILITY TO NATURAL DISASTER/ CYCLONES & FLOODS
The macroenvironment of the project site i.e. district Thatta and Sujawal is vulnerable to a
number of natural disasters such as frequent cyclones, floods, and droughts. A chronology of
disasters over the last five decades reveals that the area has remained in the grip of an
uninterrupted cycle of disasters in one form or the other. Cyclones, heavy rainfall, droughts
and floods follow each other with short-lived intervals. However, earthquake seems to be a rare
phenomenon proving to be less disastrous in its effects in comparison to other hazards
experienced by the communities at risk. Major disaster history is given in Table 6.10.
There are two hydro-climatic factors which cause occurrences of floods in the Indus River
Basin. The first factor is the melting of snow which accumulates in the mountainous north of
Pakistan during winter. This snow cover starts melting in March-April, and reaches its
maximum in July. Since 1868 the annual maximum snowmelt flows in the Indus River ranges
between 150,000 cusecs and 500,000 cusecs. The second most important factor is the occurrence
of southwest monsoon rain during the summer season, which falls over the whole Indus River
Basin. The two factors are coincident on each other.
The Meteorological Department of Pakistan classifies floods intensity on the basis of water
discharge in rivers. Discharge of water below 200,000 cusecs is categorized as low level flood,
between 200,000 and 400,000 cusec is categorized as medium level flood and between 400,000
and 600,000 cusec is considered as high level flood. Discharges of water over 600,000 cusec is
categorized as exceptional flood. The maximum discharge in the Indus River had been ever
recorded during 100 years of flood history is about 1,100,000 cusecs.
The coastal belt of Thatta district is 107 km in which, Tehsils Jati, Kharochhan, Keti bander,
Shahbander, Ghorabari and Sakro were affected during the Cyclone of 1999. The cyclone which
was travelling at about 120 miles per hour was very severe and caused huge losses to life and
property. The worst affected tehsils of district Thatta were Tehsil Jati, Shah Bunder, Keti
Bunder and Kharochan.
Due to its geographical position, the district Thatta Indus has been subjected to sea intrusion,
cyclones, worst rain and river floods. Being in the tail and having large (Kohistan) areas, it has
also gone through painful sufferings of drought due to meagre rainfalls and shortage of water.
Cyclones in the Arabian Sea are mostly from May till June and then from September till
October, monsoon season plays a vital role for the formation of cyclone in this basin. Tropical
storms that hit Pakistan are mostly remnants by the time reach Pakistan or make landfall in
south eastern Sindh which constitute the deltaic region and is not very much populated and
rarely move towards the Balochistan coast.
Each year before the onset of monsoon that is 15 April to 15 July and also after its withdrawal
that is 15 September to 15 December, there is always a distinct possibility of the cyclonic storm
to develop in the north Arabian Sea. There is a 98 per cent chance of cyclones to turn towards
the Indian state of Gujarat, one per cent chance of moving towards the Gulf and one per cent
Chapter 06 20 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
chance of moving towards the Pakistani coast (Pakistan Weather Portal). List of wettest
cyclones/ depressions in the coastal areas of Pakistan is presented in Table 6.11. Cyclones that
effect Sindh and Pakistan lose much of their intensity by the time they reach country’s coastline.
Following are the deadliest cyclones in Pakistan’s history; these cyclones caused fatalities
greater than 100.
a) Indus Valley Cyclone 1964
It made landfall in Tharparkar and Hyderabad district in Sindh province on 12 June. However
it caused a great loss of life and property in the province. It killed 450 people and left some
400,000 people homeless.
b) Karachi Cyclone 1965
Not much is known about this cyclone but it was the deadliest tropical storm in the history of
Pakistan as it caused 10,000 casualties in Karachi on 15 December.
c) Pak-Indo Cyclone 1993
In 1993, a category 1 hurricane weakened over the sea near Sindh-Gujarat border due to high
wind shear. However it caused massive rainfall and flooding in Karachi but Thatta and Badin
districts of Sindh were the worst affected where the cyclone killed 609 people and displaced
some 200,000 others.
d) Cyclone 2A 1999
This cyclone was the strongest and most intense cyclone in the history of Pakistan. It was a
category 3 hurricane and killed 6200 people in the country and made landfall in Shah Bandar
(district Thatta) at peak intensity on 20 May near Karachi city in Sindh province.
e) Cyclone Yemyin
It killed 200 people alone in Karachi city on 23 June due to heavy rainfall and intense
windstorms of 70 mph. It made landfall near the towns of Ormara and Pasni in the Balochistan
province on 26 June where it killed 300 people. Overall it killed 730 people and affected the
lives of 2 million people in Pakistan making it the third deadliest cyclone in the history of the
country.
Table 6.10: Major Disaster History
Type of Disaster Year Severity Areas Most Effected (Tehsils)
Cyclone 1964 Medium Keti Bandar, Shah Bandar, Karochan
Heavy Rainfall 1973 High Whole district
Flood 1976 Medium Thatta, Sujawal, Karochan, Shah Bandar, Jati
Heavy Rainfall 1994 High Whole district
Cyclone A2 1999 High Keti Bandar, Shah Bandar, Karochan, Jati
Chapter 06 21 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Earth Quake 2001 Low Thatta, Sakro, Keti Bandar, Karochan,
Flood 2003 Medium Whole district
Tsunami 2005 High Keti Bandar, Shah Bandar, Karochan, Jati
Drought 20015 Low Thatta
Table 6.11: List of Wettest Cyclones/ Depressions in the Coastal Areas of Pakistan
Precipitation
Storm Name Measurement Station Rank (mm) (in)
1 370 14.57 Cyclone Phet 2010 Gwadar
2 285 11.22 Cyclone 2A 1999 Shah Bandar
3 245 9.64 Depression 2009 Karachi
4 191 7.51 Deep depression 2007 Karachi
5 145 5.71 Cyclone Onil 2004 Thatta
6 110 3.94 Cyclone Yemyin 2007 Karachi
7 43 1.69 Deep depression(2007) Karachi
8 18 0.70 Depression(2009) Karachi
Chapter 06 22 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Pictorial Presentation of Physical Environment of the Project Area
A view of soil characteristic of Project Area
A view of dhand (stagnant water) at Project Area
A view of metallic road at Study Area View of Bacho Band near Dum Dama Stop
Canal within `Project Area Agriculture Field within `Project Area
Chapter 06 23 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.3 BIOLOGICAL ENVIRONMENT
The project area (PA) falls in Thatta and Sujawal Districts. A number of reserve forests and
wildlife protected areas are located in the PA.
6.3.1 METHODOLOGY
The field surveys were undertaken in October, 2014 and data were collected on project area’s
biodiversity (fauna and flora) from both primary and secondary sources. The sampling was
done in the entire area ensuring that the representative locations were sampled from each
habitat and the maximum possible number of species belonging to each habitat was recorded.
Secondary data were collected through information obtained from the local communities. Some
information was also available about the fauna of the area collected during various faunal
studies conducted previously in the area.
The vegetation surveys were carried out by laying 20’ x 20’ quadrates within the study area to
determine the plant communities of various habitats. .
Standard direct and indirect methods were applied to record the occurrence, distribution, and
status of the species in the area which included Line Transect Method, Point Count Method,
roadside counts and track/sign counts.
6.3.2 ECOLOGY OF MICROENVIRONMENT OF the PROJECT AREA
The project area was visited with a team of
experts in collaboration with the technical
team of Sindh Wildlife and Sindh Forest
department. The team witnessed a number of
species of avifauna, animal foot print,
dropping and other associated flora growing
in different portion of Sujawal Block. The
block has been occupied by agricultural
settlements comprising of sugarcane, cotton,
wheat, tomato, banana plantations, poultry
farms and also growing seasonal vegetables.
Main habitats of above mentioned floral and
faunal species are discussed as under.
a) Habitats
Main habitats within the project area include:
• Agricultural fields and settlements.
• Waterlogged marshy area and fish farms.
• Barren /Fallow land/ Waste land.
Chapter 06 24 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Description of these habitats along with the flora and fauna attributes is as follows:
b) Agricultural fields and Settlements
This habitat is occupied by those species which have adapted to survive in altered habitats, i.e.
farmlands and human settlements.
The macroenvironment along the North East and North West part of the project area is
occupied, mainly by agricultural fields and human settlements. The agricultural grounds are
spread over both sides of the road leading to major and minor settlements in the area. Mirpur
Sakhro Game Reserve area has been degraded and now it does not support Grey Partridges or
water birds habitat.
Canal system is well developed in the project area for irrigation purposes. These canals are
important in being host to freshwater turtles, lessymys punctate or commonly known as soft
shelled turtle is common in the area and is often seen crossing the roads. They are an important
component of the food chain of the ecosystem and are categorized as indicator species.
In reptiles’ species, turtles have been observed on road side. Although the habitat is least
favourable for wildlife but species associated with human settlement can be seen in the area.
Grey partridges, long tailed grass warbler, little are seen or heard very close to agricultural
fields and villages and often can be sighted at roadside in the evening. Bank myna and
Common myna were seen in abundance in addition to house crow and sparrows. Indian roller,
Black Drongo, Collared dove and little brown dove were commonly seen roosting on power
lines and trees close to human habitations. In areas where there were bees, the little bee eater
was also present.
Asiatic jackal and foxes live a nocturnal life and comes out from their habitat during night for
predation on domestic fowl. Wild boar is considered an agricultural pest and visits the
agriculture areas during night while diurnal activities are limited to being hidden in thickets
like Typha or sugarcane crops during the day.
Rodents are also common in these areas as they get shelter in warehouses and other
unoccupied structures. The commonly found rodent in the households, warehouses is the
musculas, commonly known as domestic mouse. Rodent activity varies with the habitat type
e.g. in agricultural area. Indian Gerbil or Indian Desert Gerbil dominate and often observed at
night in the project area as well, however their populations usually dislocate and relocate with
the ongoing cultivation in the agricultural fields. In addition to natural flora , which were
noticed in un-disturbed area like graveyards etc. anthropocor plant species (trees) introduced
by the farmers for their use in daily life were also observed along irrigation channels and
agricultural fields. Common species of this habitat include Calotropis procera, Capparis
decidua, Prosopis juliflora and Tamarix Indica.
Chapter 06 25 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
c) Waterlogged marshy Areas (dhands) And Fish Farms
The project site is waterlogged and
flood plain area with different small
and large stagnant water pond
(dhands). Fish farms were also seen
during field visit. These wetland and
marshy areas have ecological
importance to provide shelter to birds
and reptiles species. Rain water and
agriculture waste water are the major
source to maintain the wetland
ecosystem. Artificial fish farm business
is also rapidly increasing in the project
area for alternate income source as a
result of natural wetlands degraded in
the project area.
The macroenvironment of the study area encompasses of a flat terrestrial land consist of
agriculture holdings; natural vegetation, River Indus and southern deltaic region of River Indus
containing number of creeks. Indus delta is assessed to be the seventh largest delta in the
world. Indus delta presently comprises of 18 major creeks, namely Korangi, Phitti, Waddi -
khuddi, Khai, Paitiani, Dabbo, Chann, Hajamro, Turshian, Khobar / Jhangi River (present
mouth of Indus), Qalandri, Gahbbar, Khar, Kharak, Pakhar, Kajhar, Sir / Seer and Kori; and
numerous minor creeks, mudflats, sandy areas and tidal zones that are lined with dense to
sparse mangroves. In microenvironment Mirpur Sakhro comes under delta region in which
Paitiani and Gharo creek exist. But due to sea direction change or low fresh water flow and
drought, Delta was arged to maintain healthy natural ecosystem. Reduction in fresh water flow
has had tangible impacts on mangrove ecology on fish population that rely on them for
breeding and habitat. A large population of fish and crustaceans spend at least part of their life
cycle in mangrove or depend on food web originating there (Mendel and Qureshi 1993). In
project area deltic region is used for agriculture and shrimp farming by Sindh Fisheries
Department.
d) Barren/ Fallow land/ Waste Land
In Sindh fresh water resources are used both for domestic and agriculture purposes. Water
resources are constantly depleting and crops yield suffer a lot due to steady increase in soil
salinity. Most of the area falls in this category due to lack of water. Such areas are overgrown
with mesquites, prosopis juliflora.
View of Dhand at Mirpur Sakhro
Chapter 06 26 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.3.3 PROTECTED AREAS
The protected areas in the PA include: Gullel Khori (WS), Marho Kotri (WS), and Deh Khalifa
(GR) in Ghorabari Tehsil, Mirpur Sakro (GR), and Khadi Forest (WS) in Mirpur Bathoro Tehsil.
Table 6.12 shows protected area covered by the proposed project.
Table: 6.12 Protected Area covered by the proposed project
Protected Area Area (km2) IUCN Category
Marho Kotri 810 IV
Cut Munarki Chach 3 UA
Mirpur Sakro 10 IV
Total 823
The project area is located on the eastern and western
side of the River Indus. There are a number of Reserve
Forests in the area including Gharko, Ali Bahar, Chhach,
Kathor, Hazari, Panhwar, Hayat, Cut Munarki and
Sadnani. The Central Asian Flyway (CAF) passes over the
Indus to the Rann of Kutch which has now become the
principal wintering ground for a significant number of
water birds.
Current Status
Although this biodiversity has been heavily degraded, and more than 85 percent of the habitat
has been destroyed, there are still several patches of ecological habitat where the natural
environment is undisturbed. The area has three protected zones that cover about 820 square
kilometres (km2), or sixteen percent of the ecoregion (table 6.12), but even these protected zones
are degraded.
6.3.4 FLORA
The area is characterized by low rainfall, high summer temperatures, high velocity winds, poor
soil and low diversity of plant species. This type of climatic conditions hardly supports any
appreciable vegetation. Hence, the vegetation is sparse and mainly consists of stunted or thorny
shrubs and perennial herbs capable to sustain harsh climatic conditions in both summer and
winter seasons. Ephemeral vegetation appears during rainy season, completing their life cycle
before summer approaches. Plant communities in the project area are also faced the threats of
livestock grazing and wood cutting for fuel.
View of riverine forest
Chapter 06 27 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The vegetation of this area is greatly influenced
by monsoon rains (during July-September).
Most of the ephemerals grow in this period and
complete their life cycle in short time.
However, the vegetation close to seasonal
water bodies persist for longer period and
some survive throughout the year.
In general the native vegetation of the project
area is xerophytic, sparse and of low economic
value. The primary natural influence on the
vegetation is the low rainfall. Mostly the
rainfall is confined to the summer monsoon
period and is also scanty and meagre. Due to
climatic factors most species complete their life
cycle during the rainy season. Most species of
shrubs also flower and set seeds during the
same period. Plants shed their leaves in winter
and remain leafless during most of the year.
Most shrubs are in dome shaped structures to
reduce water losses and maintain a relatively
low temperature inside the domes.
The project area is located on the eastern and
western side of the Indus River. There are a
number of reserve forests and one major forest
type that falls within the study area is riverine forest along the river Indus banks. Total reserve
forest area falls in the project area is approximately 570.23 km2. Major species of riverine forest
are Babul or Kiker (Acacia nilotica), Kandi (Prosopis cineraria) Bahun (Prosopis euphartica) and
Lai (Tamarix Spp.) Acacia nilotica is the most common specie in the project area. The decline of
outback flows capable of flooding significant area of forest, following the construction of
various major storage and water diversion structures on the river is significant. Before the
regulation of river, outback flow could be expected on an average of 8 in 10 years, whereas now
it only occurs on an average of 4 in 10 years. The young Acacia seeding are now less able to
develop their substantial taproots that enable them to exploit the sub surface moisture and
survive the prolonged periods of no inundation. Acacia nilotica is now being replaced by the
deeper rooted and faster growing Prosopis Spp. However these species do not produce good
quality of timber as compared to A. nilotica but are mainly exploited as a source of firewood
since they coppice well.
The degradation of riverine forests has accelerated mainly due to ever increasing population.
Although all the components of riverine ecosystem have been affected due to population
View of exotic plant species of the
project area
View of Populated and Agriculture
land at Project Area
Chapter 06 28 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
pressure, the trees are badly affected. Since the requirement of domestic fuel wood as well as
livelihood needs is met from indiscriminate tree cutting, the entire ecosystem has been
disturbed. People have also encroached upon forestland for agriculture purposes. The study
reveals that more than 40,000 ha of riverine forests of Sindh have been encroached. The impact
of this action has emerged in the form of overall degradation of the riverine ecosystem by
destruction of wildlife habitat, disappearance of associated fauna and flora, reduction in gene
pool, degradation of soil; change of micro climate and over all environment of the region. This
has resulted in reducing the vertical and horizontal structures of riverine ecosystem.
Riverine forests were used to be the major source of livestock grazing. The Babul pods and
leaves are nutritious and favourable fodder particularly for goat and sheep. Besides, abundant
grasses, wild herbs, shrubs, etc. growing after floods and rainfall are source of fodder for the
livestock and wild animals.
Another setback received by the forestry resource, was that of changing polices regarding
leases for agricultural purposes in the forest areas. There has been pressure from influential
people for cultivation of agricultural crops on much relaxed terms during the last two decades.
There have been many changes in the government policies on forest leases for cultivation
dictated by the influential persons. Riverine forest areas and List of floral species of project area
are given in Table. 6.13 Forest maps provided by Sindh Forest Department given in
Figure 6.6A to 6.6E
Table: 6.13 List of Forests in Project Area
S/No Name of Riverine Forest Project Area
1 Cut Munarki /Sadnani Thatta
2 Hayat Gaho/ Gullel/ Kathore Ghora Bari
3 Mahro Kotri Ghora Bari
4 Ali baber Sujawal
5 Chach Keti/ Munarki Sujawal
6 Khanani Ghora Bari
7 Marli Ghora Bari
8 Bijura Thatta
9 Phawar Sujawal
10 Khirsar Sujawal
11 Sujrani Sujawal
12 Hazari Sujawal
Chapter 06 29 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.6A Khirsar Forest Map
Figure 6.6B Ali Bahar Forest Map
Chapter 06 30 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.6C Munarki & Chach Keti Forest Map
Figure 6.6D Surjani Forest Map
Chapter 06 31 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.6E Panhwar Forest Map
Table: 6.13 List of floral Species of Project Area
S.# Plant Species Name Local Name Family Name Life Form Life Span
01 Aerva javanica Booh Amaranthaceae Shrub Perennial
02 Xanthium indicum Bhurt Asteraceae Shrub Annual
03 Pluchea lanceolata Phaar Buti Asteraceae Shrub Perennial
04 Launaea procumbens Bhattar Asteraceae Herb Perennial
05 Calotropis procera Ak Asclepiadaceae Shrub Annual
06 Leptadenia pyrotechnica Khip Asclepiadaceae Shrub Perennial
07 Oxystlema esculentum Phuli Asclepiadaceae Climbing shrub Perennial
08 Capparis deciduas Kirar Capparidaceae Shrub Perennial
09 DDipterygium glaucum Phair Capparidaceae Bushy subshrub Perennial
10 Cressa cretica Oin Convolvulaceae Herb Perennial
11 Cusuta chinensis Bepari Cuscutaceae Stem parasite Annual
12 Cyperus arenarius Moniah Gaah Cyperaceae Sedge Perennial
13 Cyperus rotundus Kabah Cyperaceae Sedge Perennial
14 Suaeda fruticosa Lani Chenopodiaceae Sub-shrub Semi-perennial
Chapter 06 32 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
15 Albaji maurorum Kandero Fabaceae Sub-Shrub Perennial
16 Crotolaria burbia Chag Fabaceae Sub-shrub Semi-perennial
17 Indigofera argentae Lathio Fabaceae Herb Annual
18 TTephrosia falciformis - Fabaceae Herb Annual
19 Acacia jacquemontii Banwar Mimosaceae Shrub Perennial
20 Acacia nilotica Sindhi babur Mimosaceae Tree Perennial
21 Prosopis juliflora Devi Mimosaceae Shrub Perennial
22 Eucalyptus spp. - Myrtaceae Tree Perennial
23 Boerbavia procumbens Dakhri/Sana
wari Nyctaginaceae Herb Annual
24 Cynodon dactylon Chhabar Poaceae Grass Perennial
25 Cymbopogon
jawarancusa Kattan Poaceae Grass Annual
26 Desmostachya
bipinnata Drabh Poaceae Grass Perennial
27 Panicum turgidum Sewan Poaceae Grass Perennial
28 Pbragmites karka Nar/Naro Poaceae Grass Perennial
29 Saccharum bengalense Booro Poaceae Grass Perennial
30 Lasiurus sindicus Booro Poaceae Grass Perennial
31 Aristida Funiculata Lumb Gah Poaceae Grass Annual
32 Calligonum
polygonoides Phog Plogonaceae Shrub Perennial
33 Zizyphus nummularia Jhangoori Ber Rhamnaceae Shrub Perennial
34 Salvadora oleoides Khabbar Saolvadoraceae Tree Perennial
35 Datura metel Charyo
Dhatooro Solanaceae Herb Perennial
36 Solanum nigrum Kanwal Buti Solanaceae Herb Annual
37 Solanum surattense Kanderi Wal Solanaceae Sub-shrub Annual
38 Withania somnifera Akri Solanaceae Shrub Perennial
39 Tamarix aphylla Lao Tamaricaceae Tree Perennial
40 Tamarix indica Lai Tamaricaceae Shrub Perennial
41 Typha elehantina Pan Typhacea Shrub Perennial
Chapter 06 33 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.3.5 FAUNA
a) Mammals
Status of large mammals especially ungulates
and carnivores has declined over the past three
decades during which the area had to face
sub-critical situations resulting from increase in
human and livestock population, habitat
deterioration, hunting and man-made
interventions in the name of development. The
population of small mammals has, however,
remained abundant in the area.
The field survey was undertaken at the onset of
the migratory season, hence majority of the
species of birds recorded comprised of resident
species. Most of the birds were localized near to
the well-watered areas and agriculture fields.
The common and widespread species of birds
included:
Common Myna, Bank Myna, Common Kite,
House Crow, House Sparrow, White-cheeked
Bulbul, Ring Dove and Little Brown Dove.
Reptiles are quite few in the project area. Only
Common Tree Lizard, Brilliant Agama, Blue tail
Sand Lizard and House Gecko are common.
Indian Spiny-tailed Lizard and Monitors are less
common. Black Cobra and Saw-scaled Viper are
frequent.
During field visit, 18 mammals, 41 birds and 14
reptile’s species were reported/ observed in
project area. Most of the mammals observed in
the macroenvironment are common in nature and have survived despite being close to human
presence. The number of Indian desert cat recorded is comparatively rare. The list of mammal
species reported/ observed during site visit of project area is presented in Table 6.14. A brief
description of few mammal species observed in the project area is given below.
Jungle Cat
Indian Bush Rat
Indian Jackal
Chapter 06 34 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table: 6.14: List of Mammals
a) A
s
i
a
t
i
c
J
a
c
k
a
l
b) The Asiatic Jackal
Asiatic Jackal (Canis aureus) is a common species distributed throughout Pakistan (Roberts,
1997). It is listed as Low Risk on the IUCN Red List and is included in Appendix III of CITES. It
is well adapted to dry, open country and particularly frequents rural villages and smaller
towns where food wastes and garbage are attractants to them (Roberts, 1997). Bulk of their food
comprises rodents (principally gerbils and jirds) and reptiles supplemented by insects and
refuse (Schaller, 1977). They normally hunt singly, but are social in habits and invariably call to
each other as they emerge in the evening.
The Jackals are hunted for their fur; they are trapped and killed for game by local hunters. The
Jackals are not welcome in settlements and are met with violence. The red list data shows that
S.# Order Family Scientific name Common Name
01 Insectivora Erinaceidae Hemiechinus collaris Longeared or Desert
Hedgehog
02 Carnivora Canidae Canis aureus Indian Jackal
03 Carnivora Canidae Vulpes vulpes Desert Fox
04 Carnivora Canidae Vulpes bengalensis Indian Fox
05 Carnivora Herpestidae Herpestes edwardsi Common Mongoose
06 Carnivora Herpestidae Herpestes javanicus Small Indian Mongoose
07 Carnivora Felidae Felis silvestris Desert Cat
08 Artiodactyla Suidae Sus scrofa Indian Wild Boar
09 Lagomorpha Leporidae Lepus nigricollis Indian Hare
10 Rodentia Sciuridae Funambulus pennant Five Striped Palm Squirrel
11 Rodentia Hystricidae Hystrix indica Indian Crested Porcupine
12 Rodentia Muridae Rattus rattus Roof Rat
13 Rodentia Muridae Mus musculus House Mouse
14 Rodentia Muridae Mus booduga Little Indian Filed Mouse
15 Rodentia Muridae Golunda ellioti Indian Bush Rat
16 Rodentia Muridae Nesokia indica Short-Tailed Mole Rat
17 Rodentia Muridae Tatera indica Indian Gerbil
18 Rodentia Muridae Meriones hurrianae Indian Desert Gerbil
Chapter 06 35 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
the status is least concerned. Foot prints and scats were observed during the survey while
direct sightings were also recorded.
c) Common Red Fox
The Common red fox (Vulpes vulpes) widely distributed throughout Pakistan is found in any
type of open country (Schaller, 1977; Roberts, 1997). This specie lives singly and is not social in
its hunting habits (Roberts, 1997). They are largely nocturnal and feed on hares, rodents,
reptiles and occasionally on small birds, insects and fruits (Schaller, 1977; Roberts, 1997). They
breed only once in a year (Roberts, 1997). They are hunted for their skin and are considered as
Data Deficient in the IUCN Red List and are included in Appendix III of the CITES. The red fox
is a predator and stands at the top of the food chain in this particular habitat and food chain. Its
presence in the area helps to keep the population of rodents in check.
d) Indian desert cat
The Indian desert cat (Felis silvestris) is comparatively rare and local in distribution in Pakistan.
It is however, relatively common in Thatta, Tharparkar, Dadu and Larkana districts of Sindh. It
is adapted to semi-desert regions and areas of barren low hills. It shelters by burrowing and
feeds on rodents, reptiles and insects. Dens are often excavated under bushes growing on
mounds and commonly have three openings. It also takes refuge in Euphorbia when in danger
it hides in this plant. The desert cat is an extremely fast runner and runs up and down the
dunes in seconds. It is smaller than a jungle and fishing cat, almost equivalent to a domestic cat.
It is also on top of the food chain and remains an integral part of the ecosystem for balance
check of populations on which it predates.
The Indian desert cat is included in Appendix II of CITES. During field visit for this Project,
footprints and scats of Indian desert cat were observed from a number of locations.
e) Black napped hare
The Black napped/Indian hare (Lepus nigricollis) is found mostly in croplands, sandy hilly
deserts ascending into low rocky hills and uncultivated tracts of riverine zones with grassy
habitats mostly Sacchrum sp. The black napped hare are hunted by man and they falls prey to
the Jackal and the Fox. The hare is an herbivorous animal and is often found in agricultural
areas where grass species are in abundance. The hare is an important part of the ecosystem as it
feeds on grass and weeds of the area.
f) Indian crested porcupine
The Indian crested porcupine (Hystrix indica) is remarkably adaptable ecologically, and is
found in most parts of Pakistan. It is a serious pest of forests and agricultural crops and is
nocturnal in habit and a very cautious and shy rodent. Its status is least concerned in the IUCN
red list as its population is stable, however it holds significance in the food chain and acts as a
cleaning agent.
Chapter 06 36 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Footprints, droppings and dens of this species were recorded from many locations within the
project area.
g) Small Indian Mongoose
The small Indian Mongoose is very closely related with the Grey Indian Mongoose but can
easily be distinguished by its size. The mongoose has biological importance in the ecosystem as
it predates on snakes and keeps its population under control; however these animals rarely
feed on rats they are still found near agricultural areas and water canals.
h) Birds
The riverine forest and coastal areas are mainly marshy
areas present within the project area. They are famous
for their richness in bird species during winter season.
A number of resident and migratory birds can be found
in the area during the winter migration.
Total of 42 bird species were reported and many of
them were observed during Field visit conducted for
this project. The observations were also recorded and
issues and threats were identified. Most of the resident
and migratory bird’s species are visible during the field
visits.
The microenvironment of the study area includes e
riverine forest, agriculture land, marshy land, canal,
wetlands (dhand) and fish farm. These areas however
have different potentials for staging migratory birds.
Most of the birds in this particular area are found to be
in roosting positions whereas some parts of the lake
birds are utilizing the lagoon for feeding purposes.
Similarly, in areas with dense termite population, Grey
partridges were recorded in greater numbers than in
any other area. Furthermore, the agriculture area
provides food and refuge to species of birds which have
adapted to the human settlements. These include
common and bank myna, doves, black drongo, Indian
roller, and cattle egret.
The common/forest birds of the area are black drongo,
blue rock pigeon, cattle egret, common babbler, jungle
babbler, striated babbler, common moorhen, common
and bank myna, crested lark, desert lark, desert warbler,
great grey shrike, hoopoe, house crow, house sparrow,
Little Egret
Black winged Stilt
Green Bee-eater
Chapter 06 37 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Indian roller, common egret, and pond heron. Resident birds of the area are black and grey
partridges, tawny Eagle, common sandpiper and white breasted kingfisher, Indian robin and
cattle egret, collard and little brown dove, white cheeked and red vented bulbul.
A small number of migrant species of birds was recorded from the area. The following 08
species were recorded: Common Kestrel, Common Sandpiper, Pale Crag Martin, Common
Swallow, Common Chiffchaff, Black Redstart, White Wagtail and Yellow Wagtail. The bird
species observed/reported during site visit in summer are given in Table 6.15.
Table-6.15: List of Birds
S.# Order Family Scientific Name Common Name Status
01 Pelecaniformes Phalacrocoracidae Phalacrocorax niger Little Cormorant R
02 Ciconiiformes Ardeidae Egretta garzetta R
03 Falconiformes Accipitridae Milvus migrans Black Kite R
04 Falconiformes Accipitridae Haliastur Indus Brahminy Kite R
05 Falconiformes Accipitridae Aquila rapax Tawny Eagle R
06 Falconiformes Accipitridae Circus aeruginosus Marsh Harrier WV
07 Falconiformes Falconidae Falco tinnunculus Kestrel R/WV
08 Charadriiformes Charadriidae Vanellus indicus Red Wattled
Lapwing R
09 Charadriiformes Scolopacidae Tringa hypoleucos Common Sandpiper WV
10 Charadriiformes Recurvirostridae Himantopus himantopus R
11 Columbiformes Columbidae Columba livia Blue Rock Pigeon R
12 Columbiformes Columbidae Streptopelia decaocto Ring Dove R
13 Columbiformes Columbidae Streptopelia senegalensis Little Brown or
Senegal Dove R
14 Strigiformes Strigidae Athene brama Northern Spotted
Owlet R
15 Galliformes Phasianidae Francolinus
pondicerianus Grey Partridge R
16 Coraciiformes Alcedinidae Halcyon smyrensis White breasted
Kingfisher R
17 Coraciiformes Meropidae Merops orientalis R
18 Passeriformes Alaudidae Eremopterix nigriceps Blackcrowked
Finch-Lark R
19 Passeriformes Alaudidae Ammomanes deserti Indian Desert Finch-
Lark R
20 Passeriformes Hirundinidae Riparia paludicola Grey throated R
Chapter 06 38 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Indian Sand Martin
21 Passeriformes Hirundinidae Ptyonoprogne fuligula Pale Crag Martin R
22 Passeriformes Hirundinidae Hirundo rustica Common Swallow WV
23 Passeriformes Lanidae Lanius isabellinus Rufous-tailed or
lsabelline Shrike PM
24 Passeriformes Lanidae Lanius vittatus Baybacked Shrike R
25 Passeriformes Dicruridae Dicrurus adsimilis Black Drongo or
King Crow R
26 Passeriformes Sturnidae Acridotheres
ginginianus Bank Myna R
27 Passeriformes Corvidae Corvus splendens Sind House Crow R
28 Passeriformes Pyconotidae Pycnonotus leucogenys White-eared Bulbul R
29 Passeriformes Timaliidae Turdoides caudatus Common Babbler R
30 Passeriformes Timaliidae Turdoides striatus Sind Jungle Babbler R
31 Passeriformes Sylviidae Prinia gracilis
Indian Streaked
Wren-Warbler /
Long tailed Warbler
R
32 Passeriformes Sylviidae Prinia burnesii Long tailed Grass
Warbler R
33 Passeriformes Sylviidae Sylvia communis Commom White
throat M
34 Passeriformes Sylviidae Phylloscopus collybita Chiffchaff WV
35 Passeriformes Turdidae Phoenicurus ochruros Black Redstart WV
36 Passeriformes Turdidae Saxicoloides fulicata Indian Robin R
37 Passeriformes Motacilliidae Motacilla flava Yellow Wagtail PM
38 Passeriformes Motacilliidae Motacilla alba White or Pied
Wagtail WV
39 Passeriformes Nectariniidae Nectarinia asiatica Purple Sunbird R
40 Passeriformes Passeridae Passer domesticus House Sparrow R
41 Passeriformes Passeridae Passer pyrrhonotus Sind Jungle
Sparrow R
42 Passeriformes Estrildidae Lonchura malabarica Common Silverbill R
Chapter 06 39 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
i) Threats
All the migratory birds face the problem of security in the area. The habitats have been
degraded to the extreme as forests are converted into agriculture land. The decreased or no
freshwater flow in Indus River leaves the delta, the dhands and the coastline dry when the
birds start to arrive. The ecosystem thrives only during the monsoon rains.
The sugar mills situated in the microenvironment remained closed in the last two years i.e. 2010
and 2011; therefore effluents from industries were low in volume. Industrial pollution is one of
the main reasons that cause degradation of ecosystem for migratory birds. The migratory birds
therefore could not stay on and had to leave much earlier than scheduled.
Mainly due to increased hunting pressure with the advent of birds in the area, coupled with
problems of pollution, their population has declined and soon the wetlands will become
wastelands.
j) Reptiles
Total of 14 reptile species were reported and few of
them were observed in the area during field visit for
the EIA study. The desert area in the
microenvironment provides a favourable habitat for
many reptile species especially the common tree
lizard; common field agama, yellow sand gecko. The
desert monitor inhabits mostly the desert areas
while the Indian monitor was found in areas close to
the irrigation system and water bodies. Riverine
forest provides a habitat for snake, viper and other
reptile species and also noted during field visit. The
important snake species in the project area are
Saw-scaled viper, Indian cobra, these all are highly
poisonous snakes. The non-poisonous snakes
include Eastern diadem snake, and Pakistan ribbon
snake.
Fresh water ponds and canals of project area are
important in being host to freshwater turtles.
Lessymys punctate known as soft shelled turtle is
common in the area and is often seen crossing the
roads. They are an important component of the food
chain of the ecosystem and are categorized as
indicator species. List of reptiles observed/ reported
during the field visit is given in Table 6.16.
Monitor Lizard
Turtle crossing road at Project Area
Chapter 06 40 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 6.16 List of Reptiles
S.# Order Family Scientific Name Common Name Status
01 Squamata Agamidae Calotes versicolor C
02 Squamata Agamidae Trapelus agilis Common Field Agama
/ Brilliant Agama L.C
03 Squamata Gekkonidae Crossobamon
orientalis
Yellow-tailed Sand
Gecko L.C
04 Squamata Gekkonidae Hemidactylus
brookii Spotted Barn Gecko C
05 Squamata Gekkonidae Hemidactylus
flaviviridis
Yellow-belly Common
House Gecko
06 Squamata Lacertidae Acanthodactylus
cantoris Blue-tail Sand Lizard C
07 Squamata Scincidae Ophiomorus
tridactylus 3-toed Sand Swimmer C
08 Squamata Uromastycidae Saara hardwickii Spiny-tail Ground
Lizard
09 Squamata Varanidae Varanus
bengalensis Bengal Monitor L.C
10 Squamata Varanidae Varanus griseus C
11 Squamata Colurbridae Ptyas mucosus Rope Snake/ Dhaman
12 Squamata Colurbridae Spalerosophis
arenarius
Red-spotted Diadem
Snake
13 Squamata Elapidae Naja naja Black Cobra L.C
14 Squamata Viperidae Echis carinatus Saw-scaled Viper C
15 Testudines Geoemydidae Geoclemys
hamiltoni) Black spotted turtle VU
16 Testudines Trionychidae Lessymys
punctate soft shelled turtle VU
k) Fish / shrimp Fauna
Fresh water fish’s fauna of Pakistan is represented by a
minimum of 193 fish species. These species belong to
class Actinopterygii Sub class Teleostei, 3 cohorts 6
super orders. 14 orders, 30 families and 86 genera
(Rafique, 2007; Rafqiue and Mian, 2013). The diversity
also includes the exotic species introduced in wild or
fish farming system of Pakistan, 86 species (8 exotic
and 78 indigenous) have been identified as “Species of
special importance” (Table.) on the basis of endemism. Catla Catla
Chapter 06 41 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Among the indigenous species of special importance 43
species have been identified as endemic to Pakistan. Among
the species of special importance in Pakistan at least 31
species are economically important .Major component of
the economically important species belong to warm water
fish fauna are found in the Indus Plain. In project Area most
common species of fresh water fishes are Labeo rohita,
cyprinus Caprio, Ctenopharyngodon idella, Silver crap,
Tilapia nilotica, Catla Catla. Sindh fisheries department has
introduced shrimp farming of P.merguiensis (Banana shrimp) P.indicus, P.vannamei and
P.monodon for economical growth of the area. List of fish and shrimps are given in Table 6.17.
Table: 6.17 List of Fish and Shrimps
Shrimps
S.No Scientific Name Common Name
1 Penaeus indicus Indian white prawn
2 Penaeus merguiensis Banana shrimp
3 Penaeus vannamei Whiteleg shrimp
4 Penaeus monodon Tiger shrimp
Fishes
S.No Seicentific Name Common name
1 Salmophasia punjabensis Punjab razorbelly minnow
2 Barilius Pakistanicus Pakistani baril
3 Labeo caeruleus Blue rahu
4 Labeo nigripinnis Days'labeo
5 Puntius punjabensis Punjab barb
6 Ompok Sindhensis Sindh catfish
7 Tor putitora (Hamilton, 1822) Golden mahasheer
8 Ompok bimaculatus (Bloch, Butter catfish
9 Ompok pabda (Hamilton, Pabdah catfish
10 Wallago attu Freshwater shark
11 Ailia coila (Hamilton Gangetic allia
12 Chitala chitala (Hamilton, Humped featherback
Penaeus indicus
Chapter 06 42 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
13 Bagarius bagarius Gangetic goonch
14 Oreochromis mossambicus (Peters, 1852) Mozambique tilapia
15 Cyprinus carpio (Linnaeus, Common carp
16 Tenualosa ilisha (Hamilton, 1822) Hilsa Shad
17 Cirrhinus mrigala (Hamilton, Mrigal
18 Gibelion catla (Hamilton, Calla
19 Labeo dyocheilus pakistanicus Thicklip labeo
20 Labeo calbasu (Hamilton, 1822) Orangefin labeo
21 Labeo gonius Kuria labeo
22 Labeo rohita Rahu
23 Carassius auratus Goldfish
24 Ctenopharyngodon idellus Grass carp
25 Aristichthys nobilis Bighead carp
26 Hypophthalmichthys molitrix Silver carp
27 Rita rita (Hamilton Rita catfish
28 Clupisoma qerue Garua bachcha
29 Channa merulius Great snakehead
30 Mastacembelus armatus Zig-zag eel
31 Danio rerio Zebra fish
32 Megarasbora elonga Bengala barb
33 Schizopygopsis stoliczkai Ladakh snowtrout
34 Triplophysa stoliczkai Stoliczka triplophysaloach
35 Sisor rabdophorus Whiptail Catfish
36 Nandus nandus Gangetic leaf fish
37 8adis badis Chameleon fish
38 Monopterus cuchia Gangetic mud eel
39 Macrognathus aral One-stripe spiny eel
Indus River is known to be second largest delta in the World. It has historic background and
source for the high production of the Arabian Sea due to discharge of sediments brought by
river currents from Tibet, the ultimate origin of Indus. In the historical days the delta was a hub
of fishing, navigation and other activities for major countries along the Arabian Gulf. With the
Chapter 06 43 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
establishment and modernization of several dams considerably reduced the size of delta and
simultaneously low sediment discharge in the sea. As reported by NIO scientists zero
discharged is observed during the most part of the year while from June to September fresh
water reached deltaic region quite infrequently. The river thus contributing hardly into the
delta and almost no sediments are brought to the sea and sea water ascends the vast area. The
impact of such conditions (no freshwater and intrusion of sea) are understandable by the loss of
ecological features, loss of agriculture, loss of fisheries economic destruction resulting mass
migration of population.
The matter is difficult to find solution however efforts should be focused towards efficient
development of the water system so that proper fresh water flow is maintained. The biggest
city close to the Keti Bunder is Karachi where growing population is causing extension and
establishment of new ventures that hamper the environment and cause ecological disorder.
Fishing is the major source of livelihood in the region and has been under great pressure which
becomes more devastating by the use of illegal nets that render losses for fish population. These
illegal nets are installed at fixed selected areas of the delta creating ecological imbalance
eventually producing permanent loss of resources.
To control over fishing, there is a need to implement the rules and laws with close surveillance
and monitoring practices. The more effective means would be to develop close coordination
among fishermen, their societies and fisheries managers. Use of illegal nets in any part of creek
should be prohibited by developing strategies relating to awareness among stakeholders.
There is scarcity of knowledge on the biological and ecological status of such significant
ecosystem. Available data is either old or based on inadequate short term sampling efforts
made by agencies. Compliance of environmental standards while conducting any
developmental work is envisage and a close monitoring mechanism is proposed during the
activity period to assess the level of damage and to propose immediate remedy to address the
damage. Biological survey map given in Figure 6.7.
Chapter 06 44 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.7. Biological Survey Map
Chapter 06 45 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.4 SOCIO-ECONOMIC ENVIRONMENT
This chapter provides baseline information and
description of the socio-economic and cultural
environment of the proposed exploration activities
carried out by MPCL in Sujawal block (EL-2467-11).
The Government of Pakistan has granted petroleum
exploration license to MPCL for Sujawal block
covering an area of approximately 2,416 square
kilometer (sq. km). The block lies in Thatta and
Sujawal districts of the Sindh Province.
This section presents information on the project
area’s location, population distribution, socio-economic conditions, and livelihood activities,
state of education and health facilities.
Both primary and secondary data sources were used to develop the socioeconomic baseline of
the area. A detailed socioeconomic survey was also carried out in the project area. The purpose
of this socio-economic survey was to gather first hand information about the generic
characteristics of the nearby communities, their socio-economic status, cultural conditions,
social issues and religious affiliations. It also presents the public consultation outcomes during
the field survey. A detailed description of the socio-economic environment and some major
findings is presented below in this section.
6.4.1 DATA COLLECTION STRATEGY
SGS team along with sociologist carried out the
study of socio-economic and cultural
environment. The approach and methodologies
used during data gathering were interviews, focus
group discussions and participatory rural
appraisal techniques to qualitative data collection.
Socio-economic and cultural data were collected
through semi structured questionnaire and focus
group interviews with all the major stakeholders
including local community members (male and
female) and key informants including district
government officers, village heads, landowners, NGOs and teachers in the project area.
6.5 DESCRIPTION OF THE PROJECT AREA
The project area lies in two districts i.e., Thatta and Sujawal of Sindh province, Pakistan.
Thatta district is situated from 23' 43' to 25' 26' north latitude and 67' 50' to 68' 45' east longitude
with a total geographical area of 10,020 square kilometers. It is located in the southern area,
A Potter at Work
Public Consultation with Locals
Chapter 06 46 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
locally called Laar, of province of Sindh,
Pakistan, which is about 98 km (61 mi)
east of Karachi. According to the 1998
census of Pakistan, it had a population of
1,113,194. It is home to a large necropolis
of Makli. Once Thatta served as capital
of Sindh and as a center for Islamic arts.
Since the 14th century four Muslim
dynasties ruled Sindh from Thatta, but in
1739 the capital was moved elsewhere
and Thatta declined. It was believed that
this was the place where Alexander the
Great rested his legions after their long march.
Sujawal district is located at 24°36'23" of North and 68°4'19" of East and is bordered in the
northwest by the Indus River which separates it from Thatta District. The district has an area of
7335 km².
The districts are rich in natural resources having diverse and productive habitats, ecosystems
and natural resources. These include forests (mangroves, riverine and irrigated), variety of fish
and wildlife species, agriculture and livestock and a wetlands complex, having Jabbo lagoon
which is internationally recognised Ramsar site.
The area has enjoyed a rich history and economic opulence in the past but after the upstream
construction of Tarbella Dam in 1977, the coastal ecosystem of Indus delta is under stress from
seawater intrusion and an increase in salinity and water- logging consequently, the cultivation
of field and historical crops like red rice and commercial fish farming has declined drastically.
Potable water has become scarce.
It is also the hazard prone area. It has experienced six natural disasters in recent years; namely ,
a cyclone in 1999, drought in 2000, earthquake in 2001, drought followed by floods in 2003,
Super Flood of 2010 and the flash- floods of 2011. Disaster affected families have never been
appropriately assisted through affective recovery and rehabilitation programs.
6.6 SOCIO-CULTURAL ASPECTS
Administrative Setup: Sujawal block falls in six talukas of district Thatta and newly established
(on 13 October 2013) district Sujawal, namely: Sujawal, Sakro, Jati, Ghorabari, Thatta and
Mirpur Bathoro.
The capital of Thatta district is Thatta and Sujawal of Sujawal district.
Sujawal District is subdivided into four talukas Jaati, Bathoro, Shah Bandar and Sujawal and 30
Union Councils, out of which three talukas are included in our project area. There are two
Provincial Assembly seats Constituency PS-86 and Constituency PS-87 and one National
Assembly seat Constituency NA-238 in newly formed district Sujawal; whereas Thatta district
District Boundary Map
Chapter 06 47 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
now have one National Assembly NA-237 seat and three provincial assembly seats PS-84, PS-
85 and PS- 88.
6.6.1 DEMOGRAPHY/COMMUNITY STRUCTURE
The population of Thatta district according to the 1998 Census was 1.113 million i.e., 1113,194
persons, with Urban population of 11 percent (i.e., 124,739 persons) and rural population 89
percent (i.e., 988,455). Current population (2014) of the both the districts is estimated to be 1.6
million (i.e., 1593887 persons). The estimated population density is 92 per sq. km.
The economically active population is 25 percent. A high unemployment rate of 18 percent was
recorded in 1998. Two third of the total employed persons is engaged in primary occupation
namely agriculture, forestry, fishing and hunting.
Minimum household size is four members and the maximum size about 10 members whereas
the average household size in project area is 7 members.
According to the 1998 census of Pakistan, the population of the newly formed districts Sujawal
was 80,000 of which 8.93% lived in urban environments.
6.6.2 ETHNICITY/TRIBES
Sindhi is the most spoken language of the district. People of different castes dwell in the project
area. It includes Shora, Khaskheli, Panhwar, Khuwaja, Baloch, Chandia, Alwani, Otha, Awan,
Lashari, Kalmati, Jokhia, Dul, Sayyed, Jat, Samo, Mallah, Mirbahar, Soho, Rind, Khalifa, Lothya,
Halayo, Burfat, Memon, Shaikh, Nahiyo, Zangiani, Gaho, Sheedi, Palari and Solangi. Majority
are Muslims and Sindhi speaking; while a few non- Muslims specially scheduled castes of
Hindus are also found.
6.6.3 ENERGY SUPPLIES
Most of the visited project villages had electricity for
lighting purposes in households. Solar energy has
been provided mainly through Sindh Coastal
Community Development Project (SCCDP) by
National Rural Support Program (NRSP) to the
selected coastal villages of the area. Wind energy has
also been harnessed in a few villages of the project
area. For cooking purpose, fuel wood is used in most
of the houses.
6.6.4 INFRASTRUCTURE
It was recorded that some villages were connected with blacktop roads while most of the roads
and streets in the villages were katcha. A few streets were brick paved.
Wood use as a fuel in project area
Chapter 06 48 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Most of the housing units are one or two room
houses and are made up of katcha structure. People
of same caste or two castes live together in the
shape of hamlets.
Relatively bigger villages have mosques followed
by graveyards. Eid Gah (for Eid congregation /
prayers) was also found in a few big villages, where
people from other nearby villages were also
reported to be coming for the Eid prayers.
Most of the villages have kiryana or grocery stores. Some of the villages have cabins with beetle
nut, cigarettes and other general supplies. A few villages have small hotels serving tea.
6.6.5 TRANSPORTATION & COMMUNICATION
A higher proportion of households had motor cycle
indicating that the use of motorcycle is increasing as a
fast mode of transport.
There is negligible public transport system. People face
severe issues like unavailability of proper transport
and high cost to access the health faculties in
emergencies. Males and females wait for longer hours
for the transport at main roads or city centers to reach
at their destiny. The taxi motorbikes under government
Rozgar scheme seem overwhelming as a cheap source of transport.
Now- a -days, the mobile network has been increased tremendously. It has improved the
communication.
6.7 COMMUNITY WELL BEING
The most common notion of well being focuses on a desirable mental and physical state for
individual and community.
The primary data on well being parameters were collected through qualitative and quantitative
survey methods. These elements of community well being is described as follows:
• Livelihood;
• Health and education;
• Water (drinking as well as for other uses);
• Gender Equity.
All these parameters have been discussed in subsequent paragraphs individually.
House Infrastructure in project area
View of Market
Chapter 06 49 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.7.1 LIVELIHOOD
Almost all male members of a household in the project area are involved in full time, part time
and/or casual work in one or the other agricultural activities including livestock for their
livelihood. Although agriculture and livestock still remains the main occupation but it is
insufficient to provide for the livelihood of families, thus necessitating for the village men to
engage in fishing, poultry, wage labor and wood cutting etc. Women are mainly involved in
agriculture, livestock rearing, agricultural wage labor and handicraft.
6.7.2 AGRICULTURE & LIVESTOCK
The main crops produced in Thatta and
Sujawal districts during Rabi are wheat,
barley, gram and oil seeds (mainly
sunflower) and during Kharif are rice,
sugarcane, maize, millet and jowar. The
project area also produces high value
vegetables and some fruits like papaya and
watermelon etc.
Thatta Sugar Mill, Laar Sugar Mill and
Dewan Sugar Mill are the big mills where a
considerable local people are employed as
wage labors. Besides, a few small mills like
rice mills, flour mills, and cotton factory are
also observed in the project area.
The key constraints in coastal agriculture
include shortage of irrigation water, water
logging and salinity, lack of marketing and
storage facilities, lack of tractors and other
farm facilities, lack of improved seed and
chemical fertilizers and of course
unsupportive price policy of the
government.
Along with agriculture, livestock is also the main source of livelihood. The various types of
livestock found in the area including buffaloes, cows, goats, sheep, donkey and camel. Some
villages have the modern poultry and fish farms, owned by landlords or wealthy outsider
people but look after by locals.
6.7.3 FISHING
Marine (coastal) fisheries accounts for about 79 percent of the country's total fish catch. Out of
overall coastal fisheries the contribution of Sindh coast/ Indus Delta is higher than Baluchistan,
despite Sindh coast being smaller (350 kms). The products being caught from this region are
Locals Working in Agriculture Field
Cattles Grassing in Project Area
Chapter 06 50 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
sent to Karachi for onwards distribution and consumption. Few of the items are also exported
and are an important source of Pakistan economy. Most of the people who live on agricultural
land in coastal villages cannot be considered to be the full time fishers. Some people in the
project area are also involved in fishing. The fish is the favourite food of the people of project
area.
The production of fisheries has depicted a decreasing trend during the last decade, mainly due
to the sea intrusion and lack of fresh water flow.
There is a great potential of brackish water aquaculture in the project area and surroundings. A
good number of fish farms found in the area.
6.7.4 OTHER OCCUPATIONS:
A vast majority is engaged in agriculture and livestock rearing. Due to increasing level of
unemployment and poverty, the people are also engaged in labor on daily wages. The
industrial base of the area needs to be improved. Some people are working in existing mills and
factories. A few are the government servants. The bazaars of Thatta and Sujawal are known for
hand-printed fabrics, glass bangles and Sindhi embroidery work in laid with tinny mirrors, one
of the more world known handicrafts of Pakistan.
6.7.5 HEALTH
Water borne diseases, fever, Malaria, skin diseases and allergies are the commonly reported
diseases in the project area. According to Health Facility Assessment, District Thatta and
Sujawal 2012, total health facilities in both the districts are 85. These health facilities are
sufficient for only 27% of the estimated 2014 population of the districts. Table 1.5.1 shows the
details of health facilities in the area. Table 6.18 shows list of heath facility in the project area.
Table: 6.18 List of Health Facility
S# Health Facility Number
1 District Head Quarter Hospital ( In Thatta only) 01
2 Taluka Head Quarter Hospital 04
3 Rural Health Centre (RHC) 08
4 Basic Health Centre (BHU) 49
5 Govt. Rural Dispensary/ Clinic 23
6 Maternity Home -
7 MCH Centre -
Source: Situational Analysis report of Thatta- USAID
Chapter 06 51 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
There is a dearth of qualified doctors with almost unavailability of lady doctors. It is estimated
that most of the health facilities in rural areas or disaster prone areas are destroyed by last
floods or extreme weather conditions. A particular problem of access to health services is the
unavailability of health facilities with qualified doctors and other medical facilities. Thus,
people rush to the city centers or big cities from villages in case of emergencies which cost very
high. Most of the poor people are indebted due to health emergencies and utilize all their
credits or loans taken by NGOs under microcredit schemes for livelihood for health
emergencies.
6.7.6 EDUCATION
Literacy rate in Thatta district was reported to be
22.14 percent in 1998. There is wider gap not
only in males and females but also in urban and
rural areas. The recent (2013-14) literacy rate for
both the districts is 36 percent, having 48 percent
for males and 23 percent for females. The total
number of schools in both districts is 3217, out of
which most are Government Boys Primary
Schools. Besides, a few private schools run by
Roopali Foundation or TCF schools or one in
Sathiani Shareef by a lady philanthropist or
school of Dewan Sugar Mill are found to be the quality education schools.
The following table shows taluka - wise number of schools in the project area, including GBPS,
GGPS & GBLSS, out of which almost 50 percent are closed due to the absence of teachers:
Table 6.19 shows list of education facility in the project area.
Table 6.19 Show list of education facility
Taluka Schools (Number)
Thatta 642
MirPur Sakro 504
GhoraBari 298
Sujawal 419
Mirpur Bathoro 582
Jati 431
Total 2876
Source: Education Department
View of School in Project Area
Chapter 06 52 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
6.7.7 WATER
Each village in the project area uses more than one source of drinking water. Hand pumps,
whether sweet or brackish, are the predominant source of drinking water. Water ponds are also
available in some villages. During Kharif season the nearby canals/ distributaries become the
main source of drinking water for most of the villages. It is generally not available in non-
perennial canals in Rabi season.
Most of the communities buy water tankers for drinking water. It was reported that an amount
of Rs.4000 to Rs.7000 monthly is spent by each household to purchase the drinking water.
6.8 WOMEN STATUS & GENDER EQUITY
Marriages and Gender Based Violence (GBV): The
ratio of early child marriages, unmatched
marriages (having big age difference) and divorce
ratio is negligible in the area. Mostly the females
get married in accordance with the prevailing
tradition whereby their parents made the choice of
pairs. The preference is given to the exchange
marriages.
Occasional domestic violence is faced by women,
mostly the married women by husbands.
Health: There are poor mother and child health care conditions in the area. Mostly the delivery
cases are handled by untrained Traditional Birth Attendants (TBAs) or Dais. Family planning
facilities are missing in the villages of coastal area of the districts. The high infant and maternal
mortalities have been recorded in the project areas i.e., infant mortality rate is 81/1,000 live
births, under 5 mortality rate is 101/1,000 live births and mother mortality ratio 314/100,000 live
births.
Decision Making: Exclusive decision making role of women in matrimonial matters, property
ownership, health issues and out- of - village employment is negligible. For livestock
management, they are free to make suitable decisions at some extent. Social survey map given
in Figure 6.8.
6.9 LOCAL COMMUNITY INSTITUTIONS
There is a considerable number of NGOs working in the area. These organizations have all kind
of interventions ranging from relief and rehabilitation, welfare, social sector, livelihoods
improvement, development of economic infrastructure, provision of microfinance, advocacy
and awareness raising and mobilization. Two main government sponsored NGOs include
National Rural Support Program (NRSP) and the Pakistan Poverty Alleviation Fund (PPAF) are
obvious in the project area. Besides, SCOPE, SPO, SAFWCO, Roopali Foundation (Education),
Local Community of Project Area
Chapter 06 53 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Pakistan Fisherfolk Forum (PFF) for advocacy and a few communities based organizations
found in the area. Socioeconomic matrix is given in Annexure VII.
6.10 ARCHEOLOGICAL SITES
Thatta is famous for its necropolis, which covers
10 km2 (3.9 sq mi) on the Makli Hill, which
assumed its quasi-sacred character during Jam
Nizamu-d Din's rule. The site became closely
interlinked with the lives of the people. Every
year thousands perform pilgrimage to this site to
commemorate the saints buried here. The graves
testify to a period of four centuries when Thatta
was a thriving center of trade, religion and
scholarly pursuits and the capital of Sindh. Many
of the mausoleums and graves are dilapidated;
many are still exquisite architectural examples with fine stone carving and glazed tile
decoration. The town is dominated by the Great Mosque built by the Moghul Emperor
Shahjahan which has been carefully restored to its original condition. Besides, the project area
covers the main architectural site of Pir Patho. Syed Sakhi Jamil Gurnari (died 1244 AD) and the
other one of Shah Hussain Aplani (died 1268 AD) also known as Pir Patho Debali or just Pir
Patho. The latter is considered the patron saint of boatmen, who invoked his blessings as they
set out in the crocodile-infested Indus delta. Interestingly, Hindus too revered him for the same
reasons, but as an incarnation of ‘Raja Gopichand’ - a somebody in their man-god pantheon.
Seventeenth century’s Muhammad bin Qasim’s Mosque and Tower complex is also found
nearby.
There are several other cultural, historic and scenic sites in the project area. Selected list of such
sites is presented under here:
• Pir Ghulam Ali Shah Surkh ( Girnar)
• Dargah of Hazrat Nawaz Shah Jilani
• Hazrat Ibrahim Shah Ghot ( Qudosani Dargah)
• Dargah Hazrat Baba Shah Karim
• Sathiani Sharif
View of Pir Patho Tomb
Chapter 06 54 of 54
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Figure 6.8. Social Survey Map
Chapter 07 1 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
7. STAKEHOLDER CONSULTATION
Stakeholders are peoples or group of people who are somehow get affected by a project, as well
as those who may have interests in a project and/or the ability to influence its outcome, either
positively or negatively. Stakeholders may include locally affected communities or individuals
and their formal and informal representatives, national or local government authorities,
politicians, religious leaders, civil society organizations and groups with special interest, the
academic community, or other businesses.
The participation of project stakeholders in project planning, designing and implementation is
now universally recognized as an integral part of environmental impact assessment. The Sindh
Environmental Protection Act 2014 (Section 17 (3)) highlights that: “Every review of an
environmental impact assessment shall be carried out with public participation”.
United Nations Conference on Environment and Development (UNCED) in 1992 endorsed the
process of stakeholder participation and consultation as one of the key documents of the
conference-Agenda 21. Agenda 21 is a comprehensive strategy for global action on sustainable
development and deals with issues regarding human interaction with the environment. It
emphasizes the role of public participation in environmental decision-making for the
achievement of sustainable development.
Stakeholder consultation is a continuous process that does not stop with the submission or
approval of the EIA but continues into the project execution stage by involving communities
and all other stakeholders’ values, recognizing the stakeholder’s right to inform about the
project, as well as their right to voice their views and concerns. In keeping with this belief,
consultations were conducted in the project area not only to satisfy the legal requirements of the
EIA process in Pakistan but also to improve and enhance the social and environmental design
of the project.
This section of the report outlines the stakeholder consultation approach adopted for this EIA
study, identifies the concerned groups of stakeholders, and describes the consultation process
carried out as part of this study.
7.1 OBJECTIVE OF STAKEHOLDER CONSULTATION
The overall objectives of the consultation process were as follows:
• To provide information related to proposed project activities to stakeholders;
• To facilitate and maintain dialogue and gain the consent of all stakeholders on carrying out
project activities in the area;
• To seek participation of all interested parties and identify stakeholder interests and issues;
Chapter 07 2 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• To create solutions for addressing these concerns and integrating them into project design,
operations, and management;
• To enhance the project by learning from, and incorporating, the expertise of individuals,
professionals, communities and organizations; and to encourage transparency and
inculcate trust among various stakeholders to promote cooperation and partnership with
the communities, local leadership, and NGOs.
Various steps involved in the consultation process are presented in following sections.
7.2 IDENTIFICATION OF STAKEHOLDERS
The identification of stakeholder is important for the sustainability of a development project.
Stakeholder will be identified as the people who may directly or indirectly affected by the
project activities. This will be helpful in predication and assessment of project impacts at an
early stage; and accordingly appropriate mitigation measures can be suggested. The
stakeholders that are likely to be influenced by the project activities or would like to participate
in the project will include the following:
• Communities in the project or surrounding area;
• Government Departments;
• Non-Governmental Organizations (NGO) and community Based Organizations;
7.3 CLASSIFICATION OF STAKEHOLDERS
Stakeholders can be classified as primary and secondary stakeholders depending on the
influence of the project activities on them. The individuals and organizations that may be
directly affected by project activities have been termed as Primary Stakeholders. The term
secondary stakeholders refer to individuals and organizations that will not be directly affected
by project implementation, but that do have an influence on, or an interest in, the area. Primary
stakeholders were limited to affected persons, local communities and local government
functionaries. The Secondary stakeholders mainly included national as well as international
Non Governmental Organizations (NGOs), government representatives and regulators, and
other such organizations. The public consultation process and the outcomes presented in this
section cover both the primary and secondary stakeholders.
List of stakeholders being identified and consulted is given in Table 7.1.
Table 7.1: List of Stakeholders
S. No. Stakeholder Name Organization Designation
1. Local communities
2. Arif Khatak Government of Sindh Asst. Commissioner Sujawal
3. Manzoor Ahmad Taluka Municipal office
Thatta Accountant
Chapter 07 3 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
4. Mr. Zafar Wasan Sindh Forest Department Chief Conservator
5. Mr. Arif Khokar Sindh Forest Department Division Forest Officer
6. Suleman Khaskhaili Sindh Forest Department Forest Officer
7. Raja Peraim Sindh Forest Department Forest Officer
8. Sharjeel Memon Sindh Forest Department Forest Officer
9. Mr. Ghulam
Muhammad Mahar
Sindh Fisheries
Department Director General
10. Mr. Athar Mian
Ishaqi
Sindh Fisheries
Department Director
11. Mr. Saleem Akhtar Sindh Fisheries
Department Deputy Director Fisheries
12. Mr. Javed Mahar Sindh Wildlife
Department Conservator Wildlife Sindh
13. Dara Munir Qazi Sindh Wildlife
Department Asst. Conservator
14. Mr. Imran Sabir Sindh Environmental
Protection Agency EIA Expert
15. Mr. Ahga
Shahnawaz Babar Provincial Government
Deputy Commissioner,
Thatta
16. Mr. Muhammad
Moazzam Khan WWF-Pakistan Technical Advisor
17. Dr. Dr. Muhammad
Dawood Halayo
Health Department,
Thatta
Deputy Taluka Health
Officer, Thatta
18. Dr. Dureshahwar Provincial Coordinator
Provincial Coordinator EPI
program of Government of
Sindh
19. Dr. Nabeela Chief of Party John Snow Institute (JSI)
20. Zahir Ud Din Shar Curator, Department of
Archaeology Director (Makli)
21. Mr. Ghulam Asghar
Memon
Education Department,
Thatta
District Education Officer
(EDO), Thatta
22. Mr. Asif Qureshi Education Department,
Thatta
DO HQ, Education
department, Thatta
23. Mr. Haroon Loohar Education Department,
Thatta
Admin Officer, Education
department, Thatta
24. Mr. Khada Bux
Bahrani
Social Welfare
Department Thatta Social Welfare Officer
25. Mr. Basher Anjum Social sector specialist Rural Support Program
Chapter 07 4 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Network (RSPN)
26. Mr. Ayaz Kaka District Program Officer,
Thatta
National Rural Support
Program (NRSP)
27. Dr. Akash Abbasi Project Manager NRSP
28. Ms. Noureen
Memon
District Coordinator,
Sujawal NRSP
29. Mr. Ameer Bux Jat President Coastal Community
Development Organization
30. Mr. Muhammad
Hassan Rind Project Manager
Sindh Agriculture and
Forestry Workers
Coordinating Organization
(SAFWCO)
31. Mr. Muhammad
Usman Shaikh Caretakers Pir Patho dargah
32. Mr. Huzoor Bux
Khaskheli District Officer
Sindh Education
Management Information
System
7.4 METHODOLOGY FOR STAKEHOLDER CONSULTATION
Stakeholder consultation is a two-way flow of information and dialogue between the project
proponent and stakeholders, specifically aimed at developing ideas that can help shape project
design, resolve conflicts at an early stage assist in implementing solutions and monitor ongoing
activities. Various techniques are used worldwide to carry out the stakeholder consultation that
includes discussions, meetings and field visits. Both primary and secondary stakeholders were
extensively consulted during the consultation process.
Primary Stakeholders
Concerns of the primary stakeholders of the proposed project were solicited and collected in the
following manner:
• A field visit was arranged to contact the communities in and around the project area.
• A meeting(s) was arranged with those government functionaries who were directly
influenced by project activities; and the physical area of the project falls directly under their
jurisdiction. The EIA study area falls in Riverine reserve forest and wildlife sanctuaries;
therefore, Sindh Forest Department (SFD) and Sindh Wildlife Department (SWD) has been
identified as government functionary and consulted.
• A brief description of the project was provided verbally to the stakeholders. Map was also
shown in detail for better understanding of the project area. They were asked to express
their concerns regarding the proposed project.
• Concerns, complaints and suggestions were recorded in the written form.
Chapter 07 5 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Field visits were also arranged accompanied by the representative of SFD and SWD for
field data collection.
Secondary Stakeholders
Concerns of the secondary stakeholders of the proposed project were solicited and collected in
the following manner:
• Meetings were arranged with the secondary stakeholders e.g. district administration and
other government departments, in order to obtain their concerns.
• NGOs/community based organizations were also contacted.
• A brief description of the proposed project was provided verbally. Map was also shown in
detail for better understanding of the project area. They were asked to express their
concerns regarding the proposed project.
• Concerns, complaints and suggestions were recorded in the written form.
7.5 CONSULTATION WITH COMMUNITIES
Communities were consulted during informal and formal meetings held in the project area. The
consultation process was carried out in the Sindhi language. The socioeconomic team, assisted
by sociologist initiated the sessions. During these meetings a simple, non-technical and pictorial
description of the project was given, with an overview of the project’s likely positive and
negative impacts. This was followed by an open discussion allowing participants to voice their
concerns and opinions. The feedback and immediate needs were also identified and
documented during the consultation. This process enable consultant to reach out to a wider
segment of the population of the area.
About 30 villages and two small towns were approached, as mentioned earlier, and discussions
were arranged in order to cover the identified study area and consulted with men and women
from all relevant tribes. List of consulted villages is provided in Table 7.2. Meetings with men
are generally informal while female of the project area were formally consulted with Sindhi
speaking woman sociologist. Meetings were organized separately for the groups of men and
women representing these villages. The responses from male and female were carefully
screened and separately recorded.
Participants were given a brief introduction to the project and the objectives of the meeting.
After listening to a description of various elements of the project—the campsite, construction of
access tracks, and the installation of a rig for the oil & gas exploration from the area—aided by
picture and maps, participants were asked to voice their perceptions of the company and
provide feedback on past project activities, if any had been conducted in the area. Their
feedback regarding specific issues was particularly solicited and suggestions for potential
mitigation measures discussed and documented. A list of selected questions was used to guide
these discussions.
Chapter 07 6 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The women did not foresee any negative impact if they start any work. In fact, they hoped for
increased of prosperity in their village. As their employment rate is drastically low so they
expect some chance of employment for their young children.
Table 7.2: List of Consulted Villages
S. No. Name of Consulted Villages/Town
1. Village Ramazan Puhawar
2. Village Rasool Solungi
3. Village Darya Khan Dairi
4. Village Yaqub Munara
5. Village Haji MirMuhammad Hinjorju
6. Village Haji Lakha Dino Hinjorju
7. Village Ladha Mallah
8. Village Nabi Buxh Puhawar
9. Sher Muhammad Jut
10. Bacho Jutt
11. Haju Sumar Jut
12. Sathyani Shareef
13. Village Muhammad Dablo
14. Village Siddique Karo Dablo
15. Village Ahmad Nawaz
16. Village Ali Soho
17. Village Ahmad Soho
18. Khalifa Ahmad
19. Mirzo Lagari
20. Haji Buxh Lagari
21. Haji Muhammad Ali Soho
22. Haji Mullah Buxh
23. Goth Suati Mori
24. Sakhi Sultan Shah Pir Patho
25. Ghulam Ullah City
26. Allah Dino Molvi
Chapter 07 7 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
27. Haji Ali Muhammad Kiryu
28. Ali Muhammad Dars
29. Ahmad Nahyo
7.5.1 COMMUNITY ISSUES AND EXPECTATIONS
The main concerns and expectations which were identified during consultation with local
community are as follows:
• The community is expected that preference will be given to locals by implanting an
appropriate mechanism for local workforce to take part in the activity;
• Unavailability of drinking water, educational and health facilities are also identified by the
locals;
• During consultation community identified the potential of installation of Hand pumps and
Tube wells to resolve the water issue;
• Waste management should be proper to avoid any mishandling and open
dumping/burning of solid waste in the project area;
• In case of any damage to land or agriculture field compensation should be paid;
• Privacy of working women should not be compromised because a large number of
outsiders will come to the area;
• There should not be any interference/disturbance to women for fetching water from wells,
collecting firewood, grazing livestock and working in the fields;
• Existing metalled roads of the project area damaged due to movement of machinery and
heavy equipments should be repaired by the company;
• All project activities should be done with safe distance from communities;
• Route alignment should be selected in such a way that no or a minimum number of
structures, trees, tomb, graveyard and other assets will be affected;
• The noise level should be kept to the minimal so that the local livestock do not get
frightened and run away.
7.6 CONSULTATION WITH OTHER STAKEHOLDER
In addition to consultation meetings with communities, other stakeholders were also consulted
includes Assistant Commission Sujawal, Taluka Municpal Officer Thatta, Sindh Forest
department, Sindh Wildlife Department, Sindh Fisheries Department, Sindh Environmental
Protection Agency, , District Health Officer Thatta, Deputy Taluka Health Officer Thatta,
Admin Officer Education department, Archaeological Department District Education Officer,
District Program Officer National Rural Support Program (NRSP) Thatta, Project manager
NRSP, M&E Officer NRSP, WWF Pakistan ,and a Social Activist.
Chapter 07 8 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
All the stakeholders were given maximum project information verbally and were shown map of
the area in detail. Their concerns and suggestions were heard which are reproduced below.
7.6.1 CHIEF CONSERVATOR SINDH FOREST DEPARTMENT
As stated earlier, the project area falls in riverine reserved forest area, a designated protected
forest governed by the regulations laid out in the Sindh Forest act, 1927, and managed by the
SFD. The SFD is, therefore, a key stakeholder and was included in the consultation process. SGS
team met with Chief Conservator Forest Sindh Mr. Zafar Wasan. The project and the activities
involved were explained to him with the help of map. He appreciated the efforts of SGS team
for conducting stakeholder consultation meeting. Their views and recommendations were
sought in the analysis of impacts and development of mitigation measures. He expressed some
concerns and suggested following actions, which are discussed below;
• He recommended MPCL should inform forest department during project activities to
maintain the habitat of the project area.
• Efficient technology should be used for seismic operations to avoid any land disturbance in
the project area
• Vegetation loss/ forest cutting in the project area should be compensated through re-
vegetation plan and re-vegetation plan should also be shared with forest department.
• Invasive species should be preferred for re-plantation in the project area.
• He supported development activities, however he emphasized that development projects
should follow the principle of sustainable development with true spirit.
• As the data pertaining to the area is limited, therefore physical, biological and
socioeconomic aspects of the project area should be appropriately covered in detail in the
report.
• Independent Monitoring Consultants (IMC) should monitor the activities during the
execution of the project and report EMP non-conformances to SEPA.
7.6.2 DIRECTOR SINDH FISHERIES DEPARTMENT
As mentioned in the earlier sections of the report that the project area comprised of significant
sizeable riverine area of Indus River having fishing activities within Thatta, Sujawal and Mirpur
Sakhro areas, governed by the regulations laid out in the Sindh fisheries act, 1972, and managed
by the Sindh Fisheries Department. The Sindh Fisheries Department is therefore identified a key
stakeholder and was included in the consultation process. SGS team met with Director General
Sindh Fisheries Department Mr. Ghulam Muhammad Mahar, Director Athar Mian Ishaqi and
Deputy Director Saleem Akhtar. The project and the activities involved were explained to him
with the help of map. He appreciated the efforts of SGS team for conducting stakeholder
consultation meetings. Their views and recommendations were sought in the analysis of
Chapter 07 9 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
impacts and development of mitigation measures. He expressed few concerns and suggested
following actions, which are rephrased below;
• He recommended MPCL should designed integrated waste management plan including
spill contingency plan to avoid any surface water contamination in the project area. SGS
team briefed him that project activities will be carried out with all safety and
environmental measures to avoid any worst case scenario. it was also informed that
proponent has a comprehensive spill response and emergency response plan to handle any
emergency situation on time.
• The need of a practical mechanism of coordination is strongly recommended to avoid
inconvenience or loss of livelihoods to the fisherman community.
• He appreciated proposed project will be fruitful to minimized the energy crises in Pakistan.
• He appreciated the appointment of IMC in order to ensure the compliance of
recommendations of EIA.
7.6.3 CONSERVATOR SINDH WILDLIFE DEPARTMENT
As stated earlier, the project area falls within Keti Bandar North and Keti Bandar South wildlife
sanctuaries, a designated wildlife sanctuary governed by the regulations laid out in the Sindh
Wildlife Protection Ordinance, 1972, and managed by the SWD. The SWD is, therefore, a key
stakeholder and was included in the consultation process. SGS team met with Conservator
Wildlife Sindh Mr. Javed Mehar, Asst. Conservator Dara Sahab and Game officer Mr. Rasheed
Sahab. The project and the activities involved were explained to him with the help of map. He
appreciated the efforts of SGS team for conducting stakeholder consultation meetings. Their
views and recommendations were sought in the analysis of impacts and development of
mitigation measures. He expressed some concerns and suggested following actions, which are
discussed below;
• Representative of the wildlife department should accompany the EIA team during the field
survey to identify any protected habitat(s) and/or species.
• Seismic activities should be carried out carefully to avoid any disturbance during migration
season of water birds.
• As the data pertaining to the area is limited, therefore physical, biological and
socioeconomic aspects of the project area should be covered in detail in the EIA report.
• Independent Monitoring Consultants (IMC) should monitor the activities during the
execution of the project and report EMP non-conformances to SEPA.
7.6.4 SINDH ENVIRONMENTAL PROTECTION AGENCY
Sindh Environmental Protection Agency (SEPA) was contacted through formal letter for
consultation. Director General SEPA nominated Mr. Imran Sabir for consultation meeting to
discuss the environmental issues related to the proposed project.
Chapter 07 10 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
During the meeting, the SGS team briefed them regarding the proposed operation, its location
and the environmental issues pertaining to the proposed exploration activities.
He showed great interest in the briefings and discussions and provided very valuable
suggestions mentioned below.
• The EIA report should cover the detailed methodology adopted to collect baseline data on
floral and faunal attributes.
• Wildlife of the project area should be documented with great care.
• Care should be taken during project activities to minimize the impacts on wildlife and
floral species.
• Independent Monitoring Consultants should be hired in order to monitor the project
activities and compliance of EMP.
• Consultation should be conducted with concerned stakeholders.
• Specific drilling technique should be given in EIA report.
7.6.5 ASSISTANT COMMISSIONER (AC) SUJAWAL
SGS team met with Mr. Arif Raheem Khtatak, AC Sujawal. He was informed about the project
activities proposed by MPCL. AC Sujawal though appreciated the move and said that by the
intervention of such large companies, the undeveloped areas will be developed and of course
the communities will get the benefit of it. He appreciated the participatory approach of the
consultant (SGS) for the betterment of the poor people and the back ward areas of one of the
largest districts of Sindh. He showed great interest in the briefings and discussions and
provided very valuable suggestions mentioned below.
• Best engineering practices should be adopted to avoid any disturbance in the project area.
• Aesthetic look should be maintained by planting trees at road side of the project area
• Waste management should be properly handle to avoid any land and soil contamination
• As per CRS policy in Kareja Primary School furniture should be provided.
7.6.6 MUNICIPAL COMMITTEE THATTA, DISTRICT THATTA
A meeting was held with Mr. Manzoor Ahmad Accountant. Mr. Manzoor hinted at a few
important issues that needed special attention during the project execution. All these issues
(listed below) have been incorporated in impact mitigation plan.
He appreciated the efforts made by the MPCL in terms of creation of a number of direct and
indirect employments leading to economic growth in the area and he also appreciated the
MPCL efforts towards the environment and social well being of the area.
• MPCL should prepare water conservation strategy for the proposed project because water
scarcity is common in the project area
Chapter 07 11 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Improper disposal of solid waste can deteriorate the aesthetic look of area and would be
the outbreak for malaria and other diseases in the project area.
• Waste disposal contractor should be hired to collect solid waste on daily bases.
• Employment opportunities will be provided to local community of the project area.
• MPCL should consider welfare work as per CSR policy for local community especially
water supply and drainage system in the project area
7.6.7 TECHNICAL ADVISOR -WWF PAKISTAN
A meeting was conducted with Mr. Moazzam khan, Technical Advisor WWF Pakistan. He was
also accompanied by Mr. Umair Shahid, representing WWF Marine program. They were
informed about the project activities. He showed their satisfaction on the process of stakeholder
consultation and put forwarded couple of findings presented as under.
• They mentioned the importance of biodiversity and its role in the livelihood of the
surrounding area. They place a word of caution while documenting the biological baseline
of the project area, so that any important factor could not be missed out; they also shared
couple of references of the database which were appropriately incorporated in the relevant
sections of this report.
• Mr. Moazzam also suggested that keeping in view the presence of sensitive wildlife
especially birds species in and around the project area, stringent mitigation measures
should be adhered during project activities.
• He stressed taking special care, while gathering information on flora and fauna of the area
and keeping in view of the livelihood aspect of the communities living in the surroundings.
7.6.8 HEALTH DEPARTMENT
The consultation was done with Mr. Dr. Muhammad Dawood Halayo, District Health Officer
(DHO) Thatta and focal person of Sindh Government’s Program of EPI of Thatta District and an
NGO John Snow Institute (working for health) to:
• Know the major health issues of the project area.
• Know the major concerns regarding health in case of seismic and drilling activities.
• Get the set of recommendations.
Following are the key points of the discussion:
The major health issues of the project area of Thatta and Sujawal districts are:
• Water borne diseases due to shortage of water, lack of potable drinking water and use of
saline water.
• Malnutrition due to poverty and un-awareness about balanced diet.
• High MMR and IMR due to the accessibility and lack of medical facilities.
Chapter 07 12 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Skin diseases due to rough weather and use of saline water.
• Snake bites.
• Excessive use of pan, ghutka and chalia.
They show the following concerns regarding the seismic and drilling activities:
We are appreciated the efforts made by the MPCL to exploration activities in Thatta Sujawal
districts which will be play important role to minimize the energy crisis in country by utilizing
own natural resource;
• MPCL should properly develop and implement waste management plan as improper
waste disposal can multiply the population of nuisance scavengers & predators in the
project area.
They give the following recommendations:
• By coming such companies in backward areas will generate the employment to the locals
and hence enhance their skills.
• Most of the Rural Health Centre (RHCs) and other health facilities in the project area have
no lady doctors, medicines and the medical equipments. If the company will support the
RHCs to overcome these shortfalls, then it will help to control the high rates of MMR and
IMR.
7.6.9 EDUCATION DEPARTMENT
Consultation was made with Mr. Ghulam Asghar Memon, District Education Officer along with
its team including admin officer. They shared their view point on the proposed development
activities.
• Literacy rate is drastically low in the project area due to low income resources of people in
project area as well as lack of department funds, improper infrastructure condition of
schools and unavailability of teachers are major crises faced by education Department.
They made the following recommendations:
• MPCL through its CSR activities help the local community for the improvement of
educational infrastructure in the project area.
• MPCL through its CSR activities help the local community to conduct vocational training
programs, so they can generate new income resources and improve their livelihood.
• Environmental laws and regulation and other national and other applicable law, regulation
and guidelines should be implemented during all project activities;
• Environmental quality of project area should be strictly monitored to avoid any damage to
environmental, and community’s disturbance in project area.
Chapter 07 13 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
7.6.10 SOCIAL WELFARE DEPARTMENT
• A detailed discussion was made with the social welfare officer of the social welfare
department Thatta. He has the additional charge of District Disaster Management
Coordinator. According to him cyclones, floods and other disasters are the major issues of
the coastal area.
• Poor people are committing suicides due to unemployment, which is the major issue of this
area. Locals must be given the priority for jobs.
• The land is degraded due to the sea intrusion and hence the agricultural and livestock
rearing activities of the area are badly affected. Thus there is need to introduce the
livelihood alternates for males as well as for females.
7.6.11 ARCHAEOLOGY DEPARTMENT
The consultation was made with the Curator of Archaeology Department based at Makli
Graveyard. The curator suggested to take extra care whiles the seismic and drilling activities in
order to avoid any damage to them. In case, if any such heritage will be found by the company
during the activities, they should report to the concern department immediately.
7.6.12 NATIONAL RURAL SUPPORT PROGRAM
National Rural Support Program is worth mentioning NGO working in the area. They are
involved in several projects of infrastructure development, education and health. They raised
some concerns on communities' behalf and give some recommendations as well:
• Most of the companies don't believe in community participation approach and work in
isolation. By such approach, the community's needs never addressed and hence the
interventions may result into failure. Thus, any community development initiative must
ensure the community participation at each and every level.
• To ensure the community ownership for any project there is need to launch social
mobilization program.
• The companies should take care of the local norms and cultural values and must be gender
sensitized.
• Neither district HQ nor talukas have the facilities of library. If the company will take such
initiative then it may help in developing the literary environment and enhance the quality
education.
7.6.13 COASTAL COMMUNITY DEVELOPMENT DEPARTMENT
Coastal Community Development Organization is a lobbying and advocacy based fisher-folk
community organization, working in the project area. A detailed consultation was carried out
with the president, who is a senior social worker of the area as well.
The concerns and suggestion expressed and response provided is as follows.
Chapter 07 14 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• MPCL should develop a mechanism with the involvement of local communities under
their CSR to take some initiatives for the development of local community.
• MPCL should give preferences to locals for unskilled jobs.
7.6.14 SAFWCO
A detailed meeting was organized with Project Manager of SAFWCO, who is focusing on
education in the project area. The concerns and suggestion expressed and response provided is
as follows.
• As per the latest education survey, the overall literacy ratio of the area is about 36%, which
is not enough. .
• There is need to organize public awareness workshops and focus on village leaders to
enhance the education ratio of the area.
• There is need to develop the long term Community Development Program with the
integrated participatory approach with communities in order to avoid the conflicts.
7.6.15 CARE TAKERS OF PIR PATHO DARGAH
The detailed consultation was made with the care takers of Pir Patho dargah. The concerns and
suggestion expressed by the representatives are as follows.
• They appreciated MPCL interventions which may benefit the project area and ensured full
cooperation for the project.
• Their main concern was the proper compensation of land to the land owners and the
priority to the locals in the employment.
• Accordingly to them the major issue of the area is no gas availability for household
consumption and they showed the concern as MPCL is working in the area, benefit should
be given to local community in terms of gas supply. .
• MPCL should help the local community for safe drinking water through their CSR
activities. .
Chapter 07 15 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Photographs of Consultation with Government Officials and NGO’s
Consultation with Conservator Sindh
Wildlife Department - Mr. Javed Mehar
Consultation with Sindh Environmental
Protection Agency - Mr. Imran Sabir
Consultation with Director General Sindh
Fisheries-Mr. Ghulam Muhammad Mahar
Consultation with Director WWF General
Sindh Fisheries - Mr. Athar Mian Ishaqi
Consultation with Director Archaeological
Department WWF Sindh - Mr. Zaheer Ud Din
Consultation with Education Department -
Mr. Aghar Memon and Mr. Nazar
Chapter 07 16 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Photographs of Consultation with Government Officials and NGO’s
Consultation with District Health Officer
Thatta - Mr. Dr. Muhammad Dawood Halayo
Consultation with Technical Advisor WWF
Pak – Mr. Moazzam Ali Khan
Consultation with TMO Thatta SGS Team in Consultation with Local NGO
Representative Ms. Noureen Memon
Consultation with Conservator forest
department
Consultation with Assistant Commissioner
Chapter 07 17 of 17
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Photographs of Consultation with Local Communities
Chapter 08 1 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8 IMPACT PREDICTION, EVALUATION AND
MITIGATION MEASURES
This chapter discusses the potential environmental and social impacts of the proposed activities,
predicts the magnitude of the impacts and assesses its significance. The proposed mitigation
measures to minimize adverse impacts are also discussed in subsequent sections of this chapter.
Screening of the project activities in different phases of project cycle have been carried out for
identification of adverse environmental impacts. Project phases which can pose environmental
and social impacts are divided into three broad categories:
1) Design phase
2) Construction phase
3) Drilling/operation phase
The environmental issues associated with above mentioned project phases are identified and
their impacts are examined. These impacts are broadly examined under following categories;
• Impacts on physical environment including soil, water, noise and air;
• Impacts on biological environment including flora, fauna, and aquatic fauna; and
• Impacts on socioeconomic and cultural environment.
A detailed assessment of the environmental issues for each impact has been carried out. In
order to minimize or avoid impacts identified during the study, mitigation measures have been
recommended to reduce the consequence or likelihood of occurrence of an impact.
8.1 IDENTIFICATION OF POTENTIAL IMPACTS
In the first step, potential impacts of the project are identified by desktop screening exercise,
using checklist during field visits for collection of baseline data, professional judgment,
published literature on environmental impact of similar projects and standard environmental
guidelines. A critical step in identifying potential impacts was in discussion with project
proponent, consultation with stakeholders and community to identify their concern. Public
consultation was carried out to identify the concerns of primary and secondary stakeholders.
The following aspects may be potentially impacted due to project activities and needs to be
addressed:
• Topography and soil
• Water resources
• Ambient air quality
Chapter 08 2 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Waste Generation
• Noise
• Vehicular movement
• Biological receptors (flora, fauna and aquatic fauna)
• Socio-economic receptors and
• Archaeology
8.2 IMPACT ASSESSMENT CRITERIA
Identified potential impacts are evaluated on the basis of following criteria:
• The present baseline conditions, the change in environmental parameters likely to be
effected by proposed project related activities;
• To check whether there is an impact that could possibly breach the environmental
standards applicable to the project such as the National Environmental Quality Standards
(NEQS);
• To check whether there is a high risk of a permanent, irreversible, and significant change to
environmental conditions due to the particular project activity. Some impacts are
transitory; they last until the activity lasts. Others are persistent and may last much longer
than the activity. After a long period the environmental parameter may or may not revert
back to its natural state;
• To determine if the community expresses any concern about the project;
Identification of the monitoring requirements:
The last step in the assessment process is the identification of the minimum monitoring
requirements. The scope and frequency of the monitoring depends upon the legal requirements.
The purpose of monitoring is to confirm that the impact is within the predicted limits and to
provide timely information if an unacceptable impact takes place. An environmental
management plan (EMP) will be developed with identification of monitoring requirements.
This is discussed in the subsequent chapter.
8.3 IMPACT ASSESSMENT METHODOLOGY
The impacts have been assessed following standard international guidelines and best available
practices. The method defines three levels of consequence (or severity) and likelihood (or
probability of occurrence) - High, Medium or Low - of an impact. A standard risk based
approach has been used in which;
the significance of an impact is determined on the basis of the level of consequence and
likelihood of the impact e.g. an impact of medium severity is assigned a low significance if the
Chapter 08 3 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
likelihood of occurrence of the impact is low and high significance if the likelihood of
occurrence is high or almost certain. The definition of consequence and likelihood is illustrated
in Table 8.1 and impact significant matrix is provided in Table 8.2.
Table 8.1: Definitions for Consequence and Likelihood of Impacts
Level Consequence (Severity of Impact) Likelihood
High
• Serious/catastrophic damage to
environment
• Direct legislative requirement
• Corporate requirement
• Serious threat to corporate
reputation/profitability/ability to do
business
• High likelihood of
occurrence during lifetime of
operation
• Regular/continuous part of
operations
Medium
• Measurable damage to the
environment
• Subject to potential future legislation
• Potential to affect reputation/cost
• Implication/reduced efficiency
• Moderate possibility of
occurrence during lifetime of
operation
• Periodic/occasional part of
operations
Low
• Negligible damage to the
environment
• No risk to business
• Unlikely to occur during
lifetime of operation
Table 8.2: Impact Significant Matrix
Likelihood
Consequence High Medium Low
High High High Medium
Medium High Medium Low
Low Medium Low Low
• The prediction of impacts also include the duration of impacts (in terms of long-medium
and short-term), nature of impact, geographical location of the impact and reversibility of
Chapter 08 4 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
the impact. Impact assessment criteria for the above mention parameters are illustrated in
Table 8.3.
Table 8.3: Impact Assessment Criteria
Impact
Characteristics Categories
Nature of the Impact
Direct: The environmental parameter is directly changed by the
project.
Indirect: The environmental parameter changes as a result of change
in another parameter.
Duration of the
impact
Short term: Lasting only till the duration of the project such as noise
from the construction activities.
Medium term: Lasting for a period of few months to a year after the
project before naturally reverting to the original condition such as
contamination of soil or water by fuels or oil.
Long term: Lasting for a period much greater than medium term
impacts before naturally reverting to the original condition such as
loss of soil due to soil erosion.
Geographical
Location of the
impact
Local: Within the area of project i.e. operation site and access road.
Regional: Within the boundaries of the project area.
National: Within the boundaries of the country.
Reversibility of the
impact
Reversible: When a receptor resumes its pre-project condition.
Irreversible: When a receptor cannot resume its pre-project condition.
• Identification of the mitigation measures: Mitigation measures will be suggested after the
assessment of the impact. There is a range of mitigation measures depends on significance
of the impact that can be applied to reduce impacts.
• Identification of the monitoring requirements: The last step in the assessment process is
identification of the minimum monitoring requirements. The purpose of monitoring is to
confirm that the impact is within the predicted limits and to provide timely information if
unacceptable impact is taking place. An environmental management plan (EMP) will be
developed with identification of monitoring requirements. This is discussed in next
chapter.
• Table 8.4 below summarize the assessment of environmental and social impacts of
proposed project activities with their significance.
Chapter 08 5 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 8.4: Impact Assessment Matrix
Environmental
Aspects Principal Impacts
Project
Phases
Severity of
Impacts
Likelihood
of Impacts
Significance
of Impact
Topography &
Soil
Soil erosion,
scaring of
landscape &
contamination
S,C, D Low Medium Low
Water Resources
Over usage/
exploitation of
water for locals
and contamination
S,C,D
Medium
Low
Low
Ambient Air
Quality
Stack emission,
dust & fugitive
emission
S,C,D Low Medium Low
Noise and
Vibration
Disturbance to
community,
migration of
wildlife
S,C,D Medium Medium Medium
Waste
Generation
Liquid Waste:
Surface, ground
water, soil
contaminating
C,D Medium Low Low
Solid Waste:
Odour, aesthetic
and health
hazards
S,C,D Medium Low Low
Vehicular
Movement
Disturbance to
community and
wildlife
S,C,D Low Medium Low
Biological
Receptors-
Vegetation
Vegetation
clearing S,C,D Medium Medium Medium
Biological Disturbance of S,C,D Low Medium Low
Chapter 08 6 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.4 IMPACTS ASSESSMENT FOR DESIGN PHASE
8.4.1 PROJECT DESIGNING
The design phase of the proposed project mainly comprises of selection of seismic data
acquisition technique as per geographical location, civil work design, well design, and other
technical and financial studies.
During this phase of the project, there will be no major physical activity other than desktop
studies. However, site visit may require soil investigation in order to examine the soil
characteristics for well drilling and other civil work activities.
Most part of this phase does not require an extensive physical interference in the project area.
Therefore no significant environmental and socio-economic impacts have been identified
during this phase of the project.
8.5 IMPACTS ASSESSMENT FOR SEISMIC AND DRILLING PHASE
In this section, environmental issues associated with seismic survey, construction and
operations/drilling phases of proposed project are identified and their impacts are examined.
These impacts are broadly examined under following categories;
• Impacts on physical environment including soil, water, noise, air etc.
• Impacts on biological environment including flora, fauna and aquatic; and
Receptors-
Wildlife and
Habitat
faunal community
and their habitat
Socioeconomic
Receptors
Land acquisition
and compensation S,C,D High High High
Occupational &
Communal Safety S,C,D Medium High High
Local Employment S,C,D
High
(Direct/Indirect
employment)
High High (Positive
impact)
Archaeological
Site S,C,D Low Medium Low
S Seismic
C Construction
D Drilling
Chapter 08 7 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Impacts on socioeconomic and cultural environment.
8.6 IMPACTS ON PHYSICAL ENVIRONMENT
8.6.1 TOPOGRAPHY & SOIL
a) Environmental Issues
Construction of well sites, camp sites, access roads, and other project facilities could cause
topographic changes, soil erosion and contamination. Environmental aspects of proposed
project activities related to landscape and soil are:
• Clearing and levelling during seismic data acquisition, campsite and well site construction
and access track improvement;
• Physical disturbance as a result of project activities;
• Storage of chemicals, oil, fuel or waste;
Likely impacts of these activities can include:
• Physical scarring of the landscape;
• Increased risk of land slippage;
• Accelerated soil erosion;
• Alteration of soil quality by loss of topsoil;
• Soil and water contamination resulting from spillage, leakage or improper waste disposal;
• Aquatic ecology may disturb due to soil erosion.
b) Assessment of Potential Impacts
Clearing and levelling during seismic data acquisition, well site and access road construction,
camp site (both for seismic and drilling operations), could lead physical scarring, may cause
alteration of soil quality by removal of topsoil, loss of plant cover and limited soil erosion
induced by disturbance to native soil.
Two techniques will be used for seismic data acquisition; vibroseis in terrain with gentle slopes
and flat sandy areas; dynamite within agricultural lands, tidal flats/coastal areas, shallow
waters (less than 2m depth) and all other areas where access and working of the vibroseis will
be difficult. Clearing of 4.5 m seismic line will be done at the time of vibroseis.
The project area lies in agricultural land, marshy areas (dhands) in project surrounding which
encompasses riverine forest. Within the project area, operation of dynamite and vibroseis will
be used during seismic activities as per physical condition of project site.
For dense forest patches (if found to lie within the area of operation) dynamite technique will be
alternatively used which will minimise/eliminate chances of vegetation clearing. Similarly for
Chapter 08 8 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
seismic lines in agricultural lands deep holes will be drilled for which no line clearing will be
required. At selected location upholes will be done in which also no significant land clearing
will be required. If clearing of forest vegetation required, it shall be done with prior
consultation with Forest department and be compensated as per rules and regulations of Forest
department.
The seismic and rig campsites should preferably be located outside the protected areas (if
possible), within levelled land and existing clearing to avoid any disturbance to soil or
vegetation. However, land clearing for access road, well and camp sites may also be required,
for seismic and drilling operations. It is expected that the project crew will use existing roads for
transportation of goods, wherever possible. Construction should follow good industry practices
to avoid unnecessary clearing outside of the work corridors and likelihood of soil erosion along
or across natural drainage paths.
Loss of topsoil may take place during seismic data acquisition and camp site and drilling site
establishment. Erosion is likely to occur, mainly during the rainy season, if excavated top soil is
not appropriately stockpiled and appropriate erosion measures are not put in place.
The removal of topsoil will potentially change the soil structure (i.e. the natural sequence of soil
horizons and a reduction in organic carbon content and fertility) and may degrade the soil
quality as a result of erosion by storm water or surface water run-off. Soil erosion may also
increase siltation of the nearby tributaries which may impact directly on the aquatic fauna and
flora relying on the water bodies or sources. However, initially disturbed soil will be sealed or
compacted by engineering means, therefore it can be assessed that soil erosion will not be a
significant issue.
Soil of the area may also be affected from project activities if proper management of waste will
not be carried out. Moreover, improper waste management practices can favour waste
accumulation in nearby environment and deteriorate the aesthetic look. Spillage and leakage of
fuels, oils, and other chemicals may also lead to soil contamination. Possible contaminant
sources include fuel, lubricant oil, and chemical storage areas at well sites, and all project
vehicles. Provision of secondary containment, spill response and waste management plan will
reduce the significance of this impact.
Considering the limited vegetation clearance and land area requirement for the development of
a well site, camp site and for other construction work, any topographical changes are very
limited and for short time period, hence insignificant.
We conclude that soil erosion and contamination is not expected to occur. For the purpose of
risk assessment the likelihood on the basis of assessment has been assessed as moderate with
negligible consequence. This impact is therefore assigned minor significance. Implementation of
suggested mitigation measures will ensure the impacts are remains acceptable.
Chapter 08 9 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
c) Mitigation Measures
The proposed mitigation measures to reduce the impacts on geology, topography, and soil
during the proposed construction and drilling activity are given below:
• The project area where seismic line cutting is a requirement, the activity will be carried out
in a way that would minimize disturbance to natural topography and soils.
• Width of seismic line will be restricted to 4.5m in order to avoid unnecessary cutting of
vegetation and soil removal.
• Unnecessary clearing of vegetation will be strictly prohibited;
• Any loss of dense patches of riverine forest will be compensated by
plantation/replantation. The number of trees to be planted against the number removed
will be determined in consultation with the line department (SFD) and International
organisation like IUCN;
• The camp site and well site should preferably be located outside the protected areas (if
possible) and will preferably be located in existing clearing and levelled land.
• Monitoring of all activities related to removal of plantation and the compliance of
appropriate compensatory mechanism should be done.
• The number of access tracks will be specific and kept to minimum levels.
• The number of routes will be kept to a minimum.
• Vehicle speeds will be regulated and monitored to avoid excessive dust emissions;
• Water sprinkling should be carried out to minimize dust emissions due vehicular
movement and other construction activities;
• Off-road travel should be avoided and observance of this should be monitored during the
operation;
• Periodic trainings will be provided to drivers on mitigation measures related to off-road
travel and speeds limits;
• During seismic survey, construction of seismic camp and well site; movement of
equipment will be restricted to work areas only to avoid unnecessary disturbance to soils in
the project area;
• Total land uptake by the well site, camps, and access road to the well site will be kept to the
minimum required;
• The access track to the well site will be selected to utilize existing tracks as much as
possible;
• The well site and camp site will preferably be located in existing clearing and levelled land;
Chapter 08 10 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Open soil should be covered especially during monsoon season;
• The construction activities will be planned keeping in view minimum disturbances to soil;
• Movement of construction equipments will be restricted to avoid unnecessary disturbance
to soil;
• Areas along the access track will be visually monitored and any area showing signs of soil
erosion will be compacted as necessary;
• Good engineering practices will be adopted during construction activities to ensure that
soil erosion is minimized;
• All fuel tanks will be properly marked to highlight their contents;
• Fuel and oil storage areas will have secondary containment in the form of sand bunds and
impervious linings.
• Fuels tanks will be daily checked for leaks and all such leaks will be plugged immediately;
• A spill prevention and contingency plan will be prepared to deal with spills;
• Photographs will be taken before project activities to record the conditions of seismic lines
campsite, well site and access tracks at locations that are likely to undergo soil erosion.
Similar photographs will be taken after restoration, where applicable.
8.6.2 WATER RESOURCES
a) Environmental Issues
The proposed project may utilize ground water or water will be supplied through tankers.
There may be a probability of use of surface water. Use of water from local surface or ground
water resources for the project resulting in decreased availability of water for local users.
Proposed seismic and drilling activities could affect the area’s water resources in two ways:
• Reduction from use/overuse for locals, and
• Contamination
b) Assessment of Potential Impacts
The use of tanker water may not pose any quantitative impact on local water resources of the
project area. Ground water can be used from existing wells with the permission of local well
owners/community.
In order to ensure that effect on local wells will not be significant enough to cause any localized
depletion of aquifers or effects on local water requirement, the local water wells will only be
used after ensuring that they have the excess capacity to supply the water requirement and
water levels/discharges will be monitored to ensure that any effects remain negligible. In case;
new water well is installed by MPCL, only water from deep aquifer will be tapped.
Chapter 08 11 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
In case of utilization of surface water, formal approval will be required from concerned
department. In this case change management statement will be essential prior to use of surface
water; otherwise surface water usage for project activities will not be allowed. This statement
should be developed by MPCL and issued to seismic, drilling contractor in which additional
mitigation will be clearly mentioned. If utilization of water from existing wells will be required,
only those will be considered which will at least 500 meters away from nearest community.
Therefore, impact on local water resources is not significant.
Surface water quality may deteriorate if waste disposal is not carried out properly and mixed
with surface runoff during rain which leads to contamination of water resources in the vicinity.
Potential sources of impact may include:
• Domestic effluent (i.e. grey and black waters);
• Sediments from altered land surface (well and camp sites, new tracks);
• Spilled fuel, oil and other chemicals;
Fuel Storage, Transfer and Use: There is a chance of release of fuel, oil and chemical by leakage
or spill during project activities from loading/unloading and transfer operations. From a
management perspective these have been categorized as minor, moderate or major and must be
dealt according to their impact severity.
All fuel/oil storage, transfer and use activities will be carried out according to well-established
operational procedures. Additional measures, such as implementation of the oil spill
contingency plan, will be implemented to achieve specific objectives of operational safety. The
contingency plans will also identify various organizations and their focal person so that in case
of any accident appropriate resources can be mobilized to control and manage releases.
On the basis of above, it is concluded that the consequences of the impact would be medium
and its likelihood would be low. The impact is therefore assessed to be of low significance.
Suggested mitigation measures will further reduce any impact.
Domestic Waste: Waste such as plastic products, cans, glass, paper, cans and metals will be
stored in designated areas for proper disposal.
Moreover, surface or ground water in the vicinity of the study area may also be affected from
project activities if proper management of waste will not be carried out. Improper waste
management practices can favour waste accumulation in nearby environment and deteriorate
the aesthetic look. Environmental condition may worst if any waste will dispose directly into
water bodies or due to leachate which may lead to ground water contamination, especially in
rainy season. This may adversely affect the community/workers health, cause soil
contamination, and deteriorate the surface and groundwater quality. However, implementation
of comprehensive waste management plan will reduce the probability of occurrence of this
impact. Therefore, the impact is assigned minor significance.
Chapter 08 12 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
c) Mitigation Measures
The mitigation measures described below will ensure that the project area’s surface and ground
water resources are not significantly affected by the project activities.
• The water extraction will be kept at minimum;
• The water used during project activities (construction and drilling) will be kept to the
minimum required by taking cautious on site measures related to water conservation;
• Water conservation strategies will be developed to avoid over consumption or depletion of
water resource in the project area;
• In case; new water well is installed by MPCL, this shall be drilled in deep aquifer and at
least 500 m away from nearest community water well;
• Water from public sources i.e. surface or ground water will only be abstracted after getting
formal permission from the concerned department and fulfilling the requirements of the
EIA and EMP;
• Follow good housekeeping practices with all machinery that may potentially discharge into
wastewater pit;
• Septic tanks and soak pits will be emptied periodically to ensure that effluent does not
overflow into surrounding areas;
• Sumps will remain covered all the time and measures will be taken to prevent rainwater
entry;
• Septic tanks and wastewater pits will be designed so that runoff does not flow into them;
• At the time of restoration, septic tanks and soak pits will be backfilled;
• Develop and follow a project-specific spill contingency plan following MPCL internal
procedures;
• Waste storage area should be properly covered, isolated and lined with tarpaulin or other
appropriate material to avoid ground water contamination from leachate.
• Fuels and lubricants will be stored in areas with impervious floors and bunds that can
contain spills. The volume of the containment area should be equal to 110% of the total
volume of largest tank;
• All areas containing potentially hazardous materials will be hydrologically isolated from
the remaining site;
• All fuel tanks will be properly marked to highlight their contents;
• Fuels tanks will be daily checked for leaks and all such leaks will be plugged immediately;
Chapter 08 13 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• To minimize the impacts on aquifer due to each well to be drilled, which could cause
aquifer contamination and aquifer cross-contamination, following mitigation measures will
be taken into consideration;
o Ensure a thorough understanding of aquifer formations;
o Ensure an adequate cementing and casing program to provide isolation between the
aquifer and the well bore, when crossing aquifers;
o When crossing aquifer and where technically feasible, minimize mud overpressure to
aquifer pressure to minimize infiltrations.
8.6.3 AMBIENT AIR QUALITY
a) Environmental Issues
Impacts on air quality as a result of project activities may arise from the liberation of dust
during excavation, vehicular movement and exhaust emissions from vehicles, generators and
burning of combustible wastes. Moreover, during drilling phase there is a potential of
emissions from flare during well testing and release of hydrogen sulphide gas above safe
acceptable limits in case of any emergency.
b) Assessment of Potential Impacts
Dust generated during the excavation activities should be limited to the civil work. However,
with the increased vehicular activity and construction of access tracks, the impact of dust may
become more extensive. The dust associated with seismic activity, site clearance and
excavations will be limited to the duration of the civil works and may exaggerate if this activity
is undertaken during the dry season. The impact is expected to be limited only during project
activities and considered to be low by applying below mentioned mitigation measures.
Vehicular and exhaust emissions generally emit particulate matters in the form of smoke,
carbon dioxide (CO2), oxides of nitrogen (NOX), sulphur dioxide (SO2), carbon monoxide (CO)
and volatile organic compounds (VOCs) are principal atmospheric pollutants from above
mentioned sources.CO2 is the principal greenhouse gas (GHG) among these pollutants. The
environmental impacts of stated pollutants are summarized as following.
Type of Emission Environmental Impact
Particulate matters May cause lungs/respiratory, visibility/haze problem etc.
Carbon dioxide (CO2) A GHG that is believed to contribute to climate change.
Carbon monoxide (CO) Enhances low level ozone production, indirectly contributing
to climate change.
Oxides of nitrogen (NOX)
Contributes to acid deposition (e.g. acid rain). May also
enhance ground ozone when mixed with VOCs in sunlight
level.
Chapter 08 14 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Sulphur dioxide (SO2) Contributes to acid deposition (e.g. acid rain). Toxic gas.
Improper tuning of generators and vehicles may lead to deteriorate the air quality of project
area. However, MPCL will monitor all emission sources during project activities through IMC.
Emissions in the form of oxides of carbon, nitrogen and sulphur will be produced during
flaring. Flaring is a much better environmental option than venting. As the flare will be kept
downwind of the well site and at least 500 m away from any community, hence no impact on
communities or workers will occur. In the unlikely event of any release of hydrogen sulphide
emissions, emergency response procedures will be adopted.
Above mentioned assessment shows that the sources of emission during seismic and drilling
operations will not be significant enough to alter the ambient air quality and the impact is
assessed to be of low significance due to medium likelihood and low severity to alter ambient
air quality due to project activities.
c) Mitigation Measures
The mitigation measures given below will further reduce their impact, and ensure that they
remain within acceptable limits.
• All equipment, generators, and vehicles used during the project will be properly tuned and
maintained in good working condition in order to minimize exhaust emissions;
• All project vehicles will be checked regularly to ensure that engines are in sound working
condition and are not emitting smoke;
• Well site and campsite will be located at least 500 m away from communities;
• Access track to access well sites and camp site will maintain a practical distance from
communities in order to avoid dust impacts on nearby communities;
• Dust emissions during construction activities will be minimised by good management
practices such as locating stock piles out of the wind direction, keeping the height of the
stock piles to a minimum, keeping earthwork areas damp etc.;
• Imposing speed limits and encouraging more efficient journey management will reduce the
dust emissions produced by vehicular traffic;
• Water sprinkling should be carried out to minimize dust emissions in order to minimum
deterioration of ambient air quality;
• To minimize the impact of flaring during well testing, following mitigation measures will
be considered and implemented:
o A flared test will be carried out only if deemed necessary from preliminary
evaluation;
Chapter 08 15 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
o Should a flared test be deemed necessary, its duration will be defined on technical
parameters;
o Flare pit will be kept downwind of the well site and at least 500 m away from the
nearest community;
8.6.4 NOISE POLLUTION AND VIBRATION
a) Environmental Issues
Potential sources of noise and vibration will include operation of seismic survey activities,
generators, machinery, drilling rig, construction equipment, and vehicles. The maximum
disturbance may occur along the roads, seismic lines and well site(s). Generally different types
of vehicles like, 4x4 DD IMV, cranes, lifter, loader, cars, mobile welding plants etc. will be used
during the various project activities.
Likely impacts of these activities can include:
• Local community and exposed personal disturbance;
• Migration of wildlife and bird from the area;
Assessment of Potential Impacts
There is no continuous major source of noise and vibration observed during site visit of project
area. Although intermittent sources of noise include road traffic on different roads inside the
project boundary was observed.
The noise and vibration during seismic and drilling activities would affect the exposed
personnel and may cause nuisance or hearing impacts on workers associated with these
activities. In addition, elevated noise levels due to project activities can be a source of nuisance
for locals and a source of disturbance to wildlife.
Noise monitoring of 08 hours were conducted at different locations of the project area. The
results show that noise levels slightly above from NEQS level. Similarly noise levels during
project activities generally attenuated as the distance from the source and the receiver increases.
As the project facilities will maintain appropriate distances from human settlements, impact of
noise on communities will significantly attenuated. Likewise impact of noise emission on
communities will not be significant when the access tracks are at safe distance.
In addition, it is expected that detonation of dynamite may produce higher noise levels.
However, detonation of dynamite will only be heard at the surface like a muffled thud, and it
will not scare any wildlife in nearby areas. Moreover, as seismic operation will preferably be
planned before or after the migratory season, anticipated impacts on birds are assessed to be
insignificant
The overall impact level will be localized as it will be limited to the immediate project corridor
and short term as the impact will take place as long as the project activities carried out.
Chapter 08 16 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Although the impacts will be localized and short term, for risk assessment point of view; both
likelihood and consequence of the impact would be assessed as medium and therefore assigned
medium significance. The impacts on exposed worker and wildlife will be minimized by
implementation of following suggested mitigation measures.
b) Mitigation Measures
• Proper engineering control will be applied to noise producing sources like generator
(Canopy, muffler and enclosure will be installed/provided to reduce the noise impact on
the surroundings and nearby communities)
• The seismic activities will be completed in limited times as possible.
• It will be ensured that generators, vehicles and other potentially noisy equipment used are
in good condition.
• Noise from generators, vehicles and other equipment and machinery will be kept to the
minimum through regular maintenance.
• The use of horns by project vehicles will be minimised. The use of pressure horns will not
be allowed.
• Well site and campsite will be located at a distance mentioned in this EIA report in order to
minimize the noise impacts on nearby communities.
• All on-site personnel will use required personal protective equipment (PPE) in high noise
areas that will be clearly marked.
• Ambient noise levels (intermittently) will be monitored during construction activities.
8.6.5 WASTE GENERATION
a) Environmental Issues
Proposed seismic and drilling activities will generate different types of waste. This includes
domestic garbage, packaging waste, paper waste, glass, metals; concrete waste, oil waste,
spilled chemicals and oil, kitchen waste, medical, drilling mud and cutting, produced water
waste effluent i.e. grey water and black water etc.
Likely impacts of improper waste management generated from project activities can include;
• Surface and ground water contamination
• Soil contamination
• Odour
• Health hazards
• Aesthetic issues
Chapter 08 17 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
b) Assessment of Potential Impacts
Improper waste management practices can favour waste accumulation in nearby environment
and deteriorate the aesthetic look. Environmental condition of the project area can be impacted
due to leachate formation which may lead to ground water contamination, especially in rainy
season. This may adversely affect the community/workers health, cause soil contamination, and
deteriorate the surface and groundwater quality. However, a comprehensive waste
management plan has been developed by MPCL and all the waste generated during seismic
and drilling operations will be disposed off through the waste management plan.
Domestic Wastewater (Grey and Black Water)
Black water from the camp site will go into an impermeable septic tank. Treated water will pass
from the septic tank into evaporation pit and into the air. The impermeable septic tank will
prevent untreated sewage from polluting surface water. Regular decanting of the evaporation
pit may be required to manage the level. However, grey water will be used for sprinkling on
Katcha track.
Recyclable and Non-recyclable Waste
Recyclable/reusable waste such as paper, card board, textiles, glass, plastics, tin and aluminium
cans etc. will be sold to recycling vender (recyclable/reusable waste contractor). Non-recyclable
waste will be stored separately and sent to nearest domestic contractor for final disposal.
Leftover food waste can be buried onsite, if appropriate or sent to waste contractor.
Medical Waste
Medical waste - including Syringes, glass bottles, soiled bandages, expired drugs, dressings etc
will be stored separately from other wastes and sent to an approved waste incineration facility.
Spilled Fuel and Oil
Leakage or spill of oil and/or chemical during seismic, construction and drilling phases can
result in contamination of soil and water resources. Consequently spill containment will be
used for storage areas. From a management perspective these have been categorized as minor,
moderate or major and will be remediated as soon as reasonably practical according to their
impact severity.
Produced Water
Produced water will also obtain during drilling operation. Produced formation fluids will be
flared along with the gas or collected inside the lined produced water pit at the well sites.
Drilling Mud and Cuttings
Water based mud will be used during drilling operations. HDPE lined mud waste collection pit
will be constructed for the collection of drilling mud and cuttings. The pits will be of larger
dimension than the expected volume of mud to accommodate overflows. After water
Chapter 08 18 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
evaporation, pit will be backfilled. These pits will be closed by providing a top-soil cover at the
time of site restoration. As the mud and cuttings are non-hazardous, impacts on soil or
groundwater are expected to be insignificant.
After assessment of all above mentioned waste categories, it is concluded that likelihood of the
impact would be low due to implementation of waste management plan and consequence
would be moderate (in case waste management plan will not follow), therefore the impact is
measured to be of low significance.
c) Mitigation Measures
• Black water (sewage water) should be disposed through septic system comprising of soak
pits and septic tanks;
• Grey water (washing water, kitchen water etc.) should be disposed through soak pits and
where required should be sprinkled on access tracks;
• Soak pits and septic tanks should be constructed and designed to accommodate domestic
sewage i.e. black and grey water;
• Soak pits and septic tanks will be confined with a buffer area in order to stop any entrance
or its exposure to outer environment;
• At the time of restoration, septic tanks and soak pits should be dismantled and backfilled
with at least 1m of topsoil cover above the surrounding surface level;
• Solid residue from the septic tanks should be transported to municipal sewage treatment
facilities in any nearby city;
• All project related vehicles should be daily checked for fuel or oil leaks. Vehicles with leaks
should not be allowed to operate until repaired;
• Chemical and fuel storage areas should be clearly identified by marking;
• All chemicals and fuels will be stored in confined buffered areas;
• Chemical and fuel storage drums/cans should be clearly labelled with safety signs;
• All chemical and fuel storage areas are equipped with secondary containment in the form
of concrete or brick masonry dykes/bunds;
• Spill response kit should be available at chemical and fuel storage areas. In addition to this,
ensure the availability of shovels, plastic bags, and absorbent material for the spill
management;
• Solid waste disposal in the field should not be allowed;
• The recyclable waste should be sent to waste contractors/ vender or any other recycling
facility for reused;
Chapter 08 19 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Medical waste should be sent to an approved incineration facility Non-recyclable debris
and domestic garbage should be stored separately and sent to nearest domestic contractor
for final disposal;
• Waste management procedures and activities should be monitored by an IMC;
• A waste management plan should be developed before the start of the project activities.
Key elements of the waste management system should be the following:
On-site handling
o The recyclable waste should be sent to waste contractors/ vendor or any other
recycling facility for reused.
o Non-recyclable debris and domestic garbage should be stored separately and sent to
nearest domestic contractor for final disposal.
o Waste bins should be placed inside the boundary. All waste removed from the site
should be handled by waste contractors.
o All hazardous waste will be separated from other waste and incinerated through
waste contractors.
Records
o Records of all waste generated during the project activity period should be
maintained. Quantities of waste disposed, recycled, or reused should be logged on a
waste tracking register.
Disposal
o All non-hazardous waste material that cannot be recycled or reused should be
disposed of as per waste management plan;
o Depending on the nature and quantity of the hazardous waste, it should be disposed
of by licensed hazardous waste contractors as per the waste management plan;
Drill Cutting Management
o Water Based mud should be reused and recycle.
o No drilling mud should be deliberately discharged into an uncontrolled
environment. All the mud will be contained.
o The drill cuttings and mud should be disposed off at the well site within HDPE lined
mud waste collection pit.
o The mud waste collection pit design should be based on volumes and type of
cuttings and should also be designed to suit the topography of the area. This will
prevent the risks of transfer of contaminated material from the pit to the
environment.
Chapter 08 20 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
o The mud waste collection pit should be located away from local runoff and should be
designed with enough spare capacity to contain spent mud discharged during
drilling and water produced during testing.
o Prior to pit backfilling, the mud waste collection pit should be adequately marked
and fenced to avoid any intrusion by humans or animals.
o Once deemed dry, the mud waste collection pit should be adequately sealed and
backfilled to avoid subsequent airborne dispersion.
o These pits should be closed by providing a top-soil cover at the time of site
restoration.
Other Management Measures
o Training should be provided to personnel for identification, segregation, and
management of waste;
o An emergency response plan should be developed for the hazardous waste (and
substances)
o All containers of hazardous waste should be appropriate labelled;
o Equipment and material containing asbestos, poly-chlorinated biphenyls (PCBs), and
ozone depleting substances (ODSs) should not be used.
8.6.6 VEHICULAR MOVEMENT
a) Environmental Issues
Proposed project seismic/drilling activities will involve movement of earth moving, seismic and
drilling equipments which includes cranes, lifter, loader, cars, double cabin and single cabin
pick up etc. Potential impacts of vehicular movement are;
• Disturbance to local community due to
o Dust generation
o Elevated noise
o Vehicular emissions
o Accidents due to vehicular movement.
• Disturbance to wildlife
b) Assessment of Potential Impacts
Vehicular movement is not a continuous activity which poses continuous impacts on local
community and wildlife. However, unsafe driving practices can cause damage to the wildlife
and threat to local community of the project area. As the project facilities will maintain
appropriate distances from human settlements, disturbance to local community due to dust,
noise and accident will be minor. Likewise impact of noise and vehicular emission on
communities will also minor when the access tracks will be maintained a safe distance.
Chapter 08 21 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Moreover vehicular emissions during project activities will not be significant enough to alter the
ambient air quality as discussed above.
Traffic management plan to avoid/minimize night time movement of vehicles will reduce the
disturbance to community and wildlife.
On the basis of above assessment, we conclude that likelihood of occurrence would be moderate
whereas its consequence would be low. Therefore severity of the impact is assigned as low
significance. Implementation of following mitigation measures will further reduce any
anticipated impact.
c) Mitigation Measures
Traffic management plan to avoid/minimize night time movement of vehicles will reduce the
disturbance to wildlife. Implementation of following mitigation measures will further reduce
any anticipated impact.
• Noise from all type of vehicles will be kept to the minimum through regular maintenance;
• The use of horns by project vehicles will be minimised. The use of pressure horns will not
be allowed;
• Well site and campsite will be located at least 500 m away from communities;
• Access track to access well sites and camp site will maintain a practical distance from
communities in order to avoid dust impacts on nearby communities;
• Dust emissions during construction activities will be minimised by good management
practices such as locating stock piles out of the wind direction, keeping the height of the
stock piles to a minimum, keeping earthwork areas damp etc.;
• Where required, water sprinkling will be carried out to minimize dust emissions due to
vehicular movement and other activities;
• Imposing speed limits prescribed by MPCL, drivers will receive specific direction on this
requirement;
• Encourage more efficient journey management will reduce the probability of accidents and
dust emissions produced by vehicular traffic;
Chapter 08 22 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.7 IMPACTS ON BIOLOGICAL ENVIRONMENT
8.7.1 VEGETATION
a) Environmental Issues
During the seismic and drilling operations vegetation minimal clearing may be occur along
seismic lines; well site and camp site area, and access tracks (new tracks prepared during
seismic operation and the track prepared to access the well site locations). Minimal damage to
plant species and loss of habitat during road travel may also occur. In addition, clearing of
vegetation may also be envisaged due to project activities.
b) Assessment of Potential Impacts
All the major activities, except seismic transect and drilling for exploratory well, in case seismic
data identified the particular location, will be carried out in land area of the Sujawal block.
The proposed project area consists of a flat terrestrial land comprising of agriculture holdings,
natural vegetation and 15% western deltaic region mainly comprising of barren land creek area
The major area of project utilized for agriculture purpose. Most of riverine forest land also used
for agriculture, fish farming and livestock grazing purpose because population of project area
increasing day by day and they have limited sources for income generation; hence it is
envisaged that there will be limited damage on agriculture holdings causing marginal or
negligible impact.
As the project activities occupy small areas relative to the overall habitat in which they are
located. Unless any sensitive or endemic species are cleared, the amount of vegetation cleared
from the area represents a very small percentage of the total habitat and the associated impacts
would therefore be of no major significance. It was noted during site visit that similar type of
vegetation communities are distributed in other areas of the block over large geographical areas
so the loss of vegetation, if required, from a small area will not result in extinction of any
vegetation community. Due to sparse vegetation cover, major clearing may not be involved.
Due to construction activities, the impact of vegetation clearing and loss of habitat is less
significant because campsite will be constructed at cleared land and dense patches of vegetation
will not be removed and new tracks will be avoided as much as possible.
During project activities, dust will be generated which may accumulate on vegetation and may
possibly hinder the vegetation growth. However, the EIA study area is relatively high wind
area with high percentage of humidity especially in night which cause dew formation. This will
naturally reduce any impact of dust on vegetation cover.
The Indus River is mainly identified by presence of reserve riverine forest which is growing
naturally. The project identifies the importance of this identical vegetation and proposed to
adopt the strategy of offset, wherever possible; however, even the avoidance is inevitable then a
Chapter 08 23 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
strategy of minimal destruction will be opted. Further to oversee the process, a close
coordination with the relevant line department, which in this case the Forest department has
also been suggested.
Assessment of impacts on vegetation conclude that, although there is a possibility of occurrence
of vegetation clearing during project activities however resultant damage is expected to be
moderate. Below mentioned recommended mitigation measures will ensure that the impacts
are kept to the minimum.
c) Mitigation Measures
• Vegetation clearing during seismic activities and construction of well sites and camp sites
will be kept to a minimum;
• Impact of project including construction activities to be carried out in areas with sensitive
vegetation species or communities will be minimized by selecting alternate areas with
reduced sensitivities, where possible;
• Preference will be given to those areas for camp site, well site and access tracks that are
already experiencing human interference;
• When developing new access roads, routes that minimum vegetation loss will be chosen,
avoiding unnecessary damage to vegetation;
• Off-road travelling will be minimized;
• Land requirement for each well site, campsite , and access road will be kept to the
minimum;
• Existing tracks will be utilized as much as possible;
• The access track to each well site will be properly compacted, maintained and sprinkled
with water throughout the construction and drilling operations;
• Use of local vegetation as fuel by project personnel will be prohibited;
• Vehicle speeds will be regulated and monitored to avoid excessive dust emissions, which
may impact on vegetation;
• Water sprinkling should be carried out to minimize dust emissions impacts on vegetation;
• Best available engineering practices will be adopted during construction activities;
• Clearing of dense vegetation shall be minimised by careful selection of camp site and
access track by providing off-site tracks;
• Clearing of vegetation/forest should be avoided and incase of any plant damaged it should
be replanted and monitored through IMC;
Chapter 08 24 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Trainings would be provided to drivers on mitigation measures related to off-road travel
and speeds limits;
8.7.2 WILDLIFE AND HABITATS
a) Environmental Issues
Loss of habitat may disturb the wildlife due to clearing of 4.5 m wide seismic lines for the
operation of vibroseis (if required), preparation of new access tracks; sensory disturbance due to
movement of vehicles and crew personnel; sitting and operation of camps; data acquisition
activities, shooting and recording. Likely impacts from proposed project activities can include:
• Habitat loss due to vegetation clearing
• Temporary disturbance/movement of some wildlife from the proposed project site due to:
o Elevated noise
o Sensory disturbance due to presence and movement of people and vehicles.
o Use of lights
o Improper waste disposal
The project area supports 18 mammals, 42 birds in summer and around 98 birds in winter as a
considerable area falls under famous Indus flyway for migratory birds. In addition, 16 reptile, 4
shrimps and 39 fish species were also reported/observed in the study area. The water bodies
and the forested areas are considered to be critical habitats due to the presence human
settlement and economic development activities (alternation of forest land into agriculture land,
wood cutting, fish farming and livestock grazing) are the major threat to wildlife in project area
b) Assessment of Potential Impacts
Many different wildlife species are found in project area, as discussed in detail in respective
section of the EIA report. Most of the animals in the project corridor are common along with
few sensitive wildlife species.
Potential impacts of project activities on wildlife and habitat could be sensory disturbance to the
species due to personnel movement and noise generated during seismic, construction, drilling
activities, lights used at the well and camp sites, noise and mortalities due to vehicular
movement.
The activities on seismic lines and access tracks will be carried out in series, one line after the
other or at the most two lines at a time. This will provide relief to wildlife species affected by
noise or human presence in neighbouring environment.
The site of the seismic camp will be selected away from the sensitive areas to minimise any
impacts of its operation on the wildlife. Similarly drilling and construction camps will be
preferably constructed away from the wildlife sensitive areas (Active borrows, wetlands, dense
vegetation patches etc.
Chapter 08 25 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Improper disposal of solid waste can disturb the ecology of the project area or may increase the
population of reptiles and rodents. However, implementation of waste management plan will
reduce the impact of improper waste disposal with respect to wildlife.
All the project activities will be properly monitored through IMC. This will avoid disturbance to
wildlife species may affected by noise or human presence in the neighbouring environment.
Impact Assessment on Large Mammals
The project area supports 18 mammals. These include Asiatic Jackal, Common Red Fox, Indian
desert cat, Black napped hare, and Indian crested porcupine, Small Indian mongoose etc.
Determining the effects of noise on wildlife is complicated because responses vary between
species and between individuals of a single population. These variable responses may be due to
characteristic of noise, season, and activity at the time of exposure, sex and age of the
individual, level of previous exposure. However, it has been observed that with continued
exposure to noise, animals show a decreased tendency to move away (Hompland, 1985).
The animals might tend to move away from the area where project activities to be conducted for
an initial period of time but can be expected to return to these areas once they have habituated
to the disturbance. This acclimatization with environment will lessen the significance of this
impact.
Impact Assessment on Birds
A total of 42 birds in summer and around 98 birds in winter as a considerable area fall under
famous Indus flyway for migratory birds. Birds have been categorized as residents and visitors
(summer & winter), a considerable number of avifauna in the area consist of winter visitors. As
the project area (Mirpur Sakhro) touched a part of Indus delta Ramsar site (wetlands of
international importance) exists in the vicinity of EIA study area, however; the disturbed habitat
including Indus delta for these species will be a little fraction of their total preferred habitat.
Moreover, birds are highly mobile and tend to avoid areas of disturbance. Therefore, except for
localised effects on behaviour due to sensory disturbance, a minor to moderate impact on these
bird species can be envisaged and are found to be least to moderate susceptible from the project
activities.
Impacts on Reptiles
A total of 16 reptiles were observed/ reported in the project area.
Potential direct impacts of the project activities on reptiles and small mammals are believed to
be loss of habitat; displacement from the immediate and adjacent areas from seismic lines, well
site, camp sites, and access track; and mortality during construction activities.
Clearing of seismic lines within study area will be minimised by avoiding/minimizing
unnecessary clearing of vegetation in order to limit the habitat loss of small mammals and
Chapter 08 26 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
reptiles. Loss of habitat due to construction of access track, well site and campsites will be only
a very small fraction of the total available habitat for these species.
In the absence of any mitigation, clearing of land and vegetation in areas with small mammal or
reptile holes can lead to mortality of these species. It is expected that at the start of construction
work in any area, small mammals and reptiles will flee from the area due to the vibrations and
noise of the construction machinery. As most of the species have developed an intricate
network of holes in the ground, these species will be able to find many escape routes.
For the purpose of risk assessment, we conclude that there is no potential of measurable threat
to the wildlife due to low possibility of occurrence and the impact is assessed to be of minor
significance.
c) Mitigation Measures
The following mitigation measures will reduce the adverse impacts on the wildlife of the project
area:
• Before start of any activity, awareness trainings will be provided to contractor’s
management and field crew related to wild life protection.
• No-hunting and no-trapping policy will be strictly enforced, unless human life is under
threat.
• Harassment of wildlife during project activities will be avoided;
• Areas with concentrated colonies of active burrows and dens will be avoided during the
seismic operation and access track improvement/construction;
• Prior to the improvement and construction works on the access tracks, areas with small
mammal and reptile holes will be identified. All live holes will be disturbed manually or by
other appropriate means so as to dislocate species residing in these holes.
• A high density of live small mammal and reptile holes will be re-routed during project
activities, if possible, to avoid disturbance to that section of the track.
• Project personnel or vehicles will not be allowed to access the ridges in order to minimize
disturbance to animals.
• Movement of project personnel and vehicles will be restricted to the seismic lines, access
tracks, well and camp site areas;
• Training should be provided to drivers and staff for safe driving practices to protect local
community and wildlife.
• Use of firearms will be clearly restricted;
• General awareness of the crew would be provided regarding the wildlife, through
environmental training, notice board postings, tool box talks etc;
Chapter 08 27 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• The project staff would be educated and morally trained to avoid killing, feeding or
harassment of wildlife;
• Physical disturbance to areas outside the work corridors will be avoided;
• The total duration of activities will be minimized by good management;
• Night travelling during project activities will be kept to a minimum;
• Lights used at the well sites and campsites will be kept to the minimum required;
• Noise generating equipments, machinery and vehicles should be properly tuned and
periodically inspected to minimize excessive noise generation within study area;
• Use of pressure horn will be prohibited at wildlife sensitive areas, especially in night time.
• Avoid unnecessary vehicular movement to minimize noise impacts on wildlife.
• Food wastes will not be disposed off in the open. Food wastes collected in waste
segregation units will be disposed off according to waste management plan;
• Construction work near areas which show reptile populations will commence after a soft
start up and will be randomly monitored;
• Vehicular speed will be monitored and controlled to avoid incidental mortalities of wild
animals;
• Project activities preferably should not be carried out in winter season which is the
migratory seasons of key winter visitors.
• Special care shall be taken if project activities will be executed in winter season especially
from November (when they have reached the desired destinations in warmer areas) to
February (when they back to their homelands).
• Independent Monitoring Consultant (IMC) shall be hired to ensure compliance with
mitigation measures and Environmental Management Plan (EMP) of this EIA report.
8.8 SOCIO ECONOMIC IMPACTS
The project activities will bring certain socio-economic changes in the project surrounding area.
Some of the impacts would be directly beneficial to the socio-economic environment due to
employment potential, improvement in infrastructural facilities, resource utilization from
nearby markets by the employees, whereas some of them would be of adverse nature.
The adverse impacts on community due to proposed project activities include invasion of
privacy; changes in demography; sharing of local resources; loss of standing crops in areas
where agriculture is being practiced; excessive dust emissions; improper disposal of waste;
damage to archaeological or cultural sites due to project activities; noise pollution, and
restriction of mobility of local women etc.
Chapter 08 28 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.8.1 LAND ACQUISITION AND COMPENSATION
As mentioned earlier, campsite will be constructed on existing clearing wherever possible.
Land might have to be leased for well site and campsites construction. MPCL has a procedure
for leasing of land and its compensation; following which the landowner will be paid a lease
amount for the land as per market rate and a compensation amount for the standing crop
affected at the time of the lease. In addition, the district administration should be involved
while disbursing the compensation amounts so that the rightful owners of the land are
compensated. Any delays in disbursement of compensation amounts should also be avoided so
that the already marginalized communities of the area are not affected.
Mitigation Measures
• A generous compensation will be granted to land owner as per prevailing market rates (if
land acquired)
• In case of acquisition of land, ensure all amounts for leased land will be disbursed in an
equitable and transparent manner.
• Compensation amount should be disbursed in time to avoid any conflicts between
proponent and local community.
• Agricultural, archaeological, religious or otherwise valuable land will not be used for
seismic and exploratory drilling activities without consent of respective authorities.
8.8.2 COMMUNITY DISTURBANCE
The local communities may be disturbed by the noise, dust, vehicular movement, and improper
disposal of waste due to proposed exploration activities... Seismic data acquisition and access
tracks lying close to the settlement will also result in disturbance and annoyance to the local.
Moreover, sharing of local resources may be the point of conflict between project proponent and
local community. All these impacts due to project activities will be temporary in nature and
only the communities adjacent to proposed site may be affected for a short period of time.
Following mitigation measure should be implemented to minimize the disturbance to the
community.
Mitigation Measures
• While deploying major noise generating equipment, it should be checked that all noise
abatement devices are in good working condition and proper measures have been taken to
minimize the noise levels.
• Communities will be informed about project activities and possible disturbance.
• Use alternate route, wherever possible, that passes away from community.
• Water sprinkling should be carried out on regular basis to minimize dust impacts on local
communities, if any.
Chapter 08 29 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Campsite will be selected away from the human settlements and maintain a minimum
distance of 500 m.
• Consent with local community and approval from respective local authority is mandatory
prior to use of local resources e.g. water.
• Holes, vibroseis and access track will be aligned at a safe and practical distance from
community settlements.
• All the mitigation measurements for the vehicles movement and waste management
mentioned above will be followed to avoid any disturbance to the community.
8.8.3 RESTRICTED MOBILITY
The project activities may affect mobility of local women. Project personnel will be given gender
sensitization briefings and will be instructed to respect local norms, the local culture,
particularly in relation to the womenfolk of the area.
Mitigation Measures
• Project staff should respect local cultural norms.
• Ensure there should be no interaction with the local womenfolk.
• Project crew should be restricted to work corridor.
• Limit the social interaction between the project team and local communities in order to
avoid disputes between the project team and locals;
8.8.4 COMMUNITY GRIEVANCES/COMPLAINTS
Community grievances/complaints related to project activities will be addressed by project
proponent (MPCL). Local complaints on dust, vegetation clearance, fishing farming, use of local
resources, elevated noise, waste from different project activities, spilled oil and chemicals,
hiring issues, invasion of privacy, damages to structures of locals etc. may provide basis for
conflict between the locals and project proponent.
Mitigation Measures
• Grievance handling system will be established on the basis of MPCL’s past experience to
address community grievance/complaints.
• A social complaint register will be maintained on site by MPCLL. All complaints received
from local communities will be noted in this register.
• Community complaints shall be duly addressed and appropriately resolved. The measures
taken to mitigate these concerns will also be noted in social complaint register.
• Mitigation measures related to all above mentioned concerns should be strictly
implemented in order to minimize community grievances.
Chapter 08 30 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.8.5 ARCHEOLOGICAL, CULTURAL AND RELIGIOUS SITES
Any archaeological, cultural or religious sites (as mentioned in guideline for protected areas)
are not found within project area nor any such site observed during site survey. Local cultural
sites, like Masjid, Mazar, and graveyards were found in the block during site visit. Access track
has been aligned by providing offset to the archaeological finds to avoid the impacts of
construction and drilling activities over the archaeological finds. Similarly, offset will be
provided to avoid damage of any site of historical importance during the course of project
activities. Seismic lines, well locations and camp sites should be located at safe distance (500 m)
from these sites to avoid any harm to the sites or the archaeological artefacts. On the basis of
this assessment, it is clear that project activities will be confined to the limited area therefore no
impacts on these sites will be anticipated. Implementation of following mitigation measures will
further minimize above mentioned impacts.
Mitigation Measures
• Ensure all project activities will be carried out away from any archaeological, cultural and
religious site, if any.
• For all other sites of local significance e.g. Masjids, graveyard etc. a safe distance
(determined after consultation with locals) will be maintained.
• Safe distance should be maintained to avoid any physical damage, change in aesthetic
value, or disrespect to any site of archaeological or religious importance.
• Contractor and MPCL staff will be trained in order to identify and recognize sites of
archaeological, cultural and religious importance. This will prevent any physical damage
and conflict between locals and project proponent.
• Any sudden discovery of any such site of archaeological, cultural and religious importance
during project activities shall be communicated to project proponent for further intimation
to relevant department.
8.8.6 COMMUNITY SAFETY
The proposed project activities may affect the safety of the inhabitants of the area, such as over
speeding, handling and storage of fuels/explosive and field equipments. These activities could
expose the local population to hazard if conducted in populated areas where local people
especially children are likely together to look the activity. Increased vehicular movement at
project site may expose the community towards accidental injuries.
Mitigation Measures
To minimize the safety & security risk following mitigation shall be adopted and monitored.
• Project vehicles should follow speed limits which will reduce road safety issues
significantly.
Chapter 08 31 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Safe driving practices will be adopted while passing through settlements.
• Explosives should be stored in an isolated and clearly marked area. The area should be
constructed keeping in view community and campsite safety.
• Night time travelling will be kept to minimum.
• Local peoples will be informed about project activities in order to keep locals especially
children away from project area.
• Field equipments should never be left unattended.
• Fire extinguishers and other relevant safety gadgets equipments should be provided.
8.8.7 SAFETY OF WORKERS
MPCL’s management must make sure that workers should use the Personnel Protective
Equipments (PPEs) during project activities specially working on heights, dealing with
explosives, working with machines/equipments, and working in dusty and noisy environment
etc.
Mitigation Measures
To ensure worker’s safety during project activities, following measures should be undertaken:
• Explosives should be stored in an isolated and clearly marked area. The area should be
constructed keeping in view community and campsite safety.
• Fire extinguishers and other relevant safety gadgets equipments should be provided at site.
• First Aid box should be placed on site.
• First Aid training should be provided to all supervisory staff.
• Contact addresses and numbers of local hospitals and other emergency organizations
should be available on site all the time.
8.8.8 EMERGENCIES AND ACCIDENTS
Project activities will increase the possibility of accidental injury or any other emergency
situation like fire, oil spill or any natural disaster may be happened which may impact project
staff and nearby communities as well. To handle this situation, MPCL has clearly defined, well
structured and dynamic Emergency Response Plan available to handle level 1 and level 2
emergencies.
Mitigation Measures
• Ensure emergency response plan should be developed and implemented to cater different
emergency situation as mentioned above.
• Ensure project related staffs are well aware and trained on emergency response plan.
• Ensure provision of first aid at site in case of any emergency.
Chapter 08 32 of 32
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
8.8.9 EMPLOYMENT
The distribution of employment during implementation of the project activities should be done
in a manner ensuring that the people likely to be affected by the project or the most vulnerable
groups of the community are given preference in employment opportunities.
Employment opportunities shall be created both for skilled and unskilled workers during the
project cycle. Skilled and trained work force is not expected to be available in the area.
However, project proponent will ensure to hire locals for unskilled jobs and wherever possible,
for skilled jobs.
Mitigation Measures
• MPCL and its contractors should employ local residents for semi skilled and unskilled
opportunities and wherever possible, for skilled jobs during the project cycle.
• Local residents living closest to the project location will be given priority in the
employment process.
• Labour from local communities will be recruited equitably among the tribes and the
employment procedures will be transparent.
8.8.10 LOCAL ECONOMY
It is envisaged that turnover of local businesses will be increased due to an increased demand
from project contractors and their employees. During the proposed project activities such as
construction material i.e. gravel, aggregate, steel, cement, sand etc. for camps and well site
construction will be procured preferably from local market. General supplies which include
camp supplies (food, etc.), fuels and oils etc. will also be procured preferably from local market.
This will be a positive impact on local economy. However, care should be taken to avoid heavy
burden on local resources.
• An increase in the income of locals may occur due to increase in employment opportunities
due to project activities.
• An increase in the income of locals may occur due to increased turnover of local businesses
and shops due to an increased demand from project contractors and their employees.
Chapter 09 1 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
9. ENVIRONMENTAL MANAGEMENT PLAN
9.1 INTRODUCTION
After the Environmental Assessment process of the proposed seismic and drilling activities, it is
essential to identify project specific actions to minimize the adverse environmental impacts
caused during project activities. These actions are compiled in the form of an Environment
Management Plan (EMP). Though most of the environmental impacts identified in the
proposed seismic and drilling activities are temporary and localized, project specific
recommendations further minimize these impacts.
The potential environmental impacts are identified from the planning stage of the proposed
project through the EIA process. The Environmental Management Plan (EMP) is a vital part of
overall planning and implementation of projects. EMP provides a structural framework and
logical approach for effective implementation of the mitigation measures related to health,
safety and environment, and environmental protection of the project area and it’s surrounding
throughout the project lifecycle.
The EMP is a tool that serves as to manage environmental impacts and specifically focuses on
implementation of mitigation measures in its true sense against likely environmental impacts.
Both negative and positive impacts at each stage of the project activity have been examined in
detail, in this EIA study.
9.2 SCOPE OF THE EMP
The scope of the EMP covers all construction and operational activities and ensures continual
compliance with National legislation, international standards and guidelines, and the MPCL
Health, Safety and Environment Policy.
The EMP covers a series of general and specific recommendations that, collectively, constitute
the basis of the management (mitigation of the impacts) and environmental control during the
project’s life cycle.
The EMP lists the obligations and responsibilities of each party involved in the project;
stipulates methods and procedures that will be followed; and outlines environmental
management actions that will be implemented, considering that the reference framework for the
environmental standards is avoiding negative impacts on the health and well-being of people
and the environment.
9.3 PURPOSE AND OBJECTIVES OF THE EMP
This EMP has been prepared based on the findings of the EIA study and describes management
measures designed to prevent or reduce potential environmental and social impacts of
proposed seismic and drilling activities.
Chapter 09 2 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
The purpose of EMP is to ensure the commitments made in this EIA report for effective
implementation of mitigation measures. The primary objectives of the EMP are to:
• Facilitate the implementation of the mitigation measures identified in the EIA.
• Achieve MPCL Health, Safety and Environmental (HSE) goals.
• Ensure compliance of the associated legislative requirements, guidelines, community
issues, if any, and best industry practices that apply to the project.
• Define roles and responsibilities of the project proponent and identify areas where these
roles and responsibilities can be shared with other stakeholders.
• Define a monitoring mechanism and identify monitoring parameters in order to:
� Ensure the complete implementation of all mitigation measures.
� Ensure the effectiveness of the mitigation measures.
• Define requirements for environmental monitoring and auditing;
• Provide a mechanism for taking timely action in case any unanticipated environmental
situation may arise.
• Identify training requirements at various levels.
9.4 METHODOLOGY
The basic approach to prepare this EMP mainly comprise of:
• A review of environmental legislation and guidelines
• A review of past environmental studies carried out in the Sujawal block
• On the basis of past experience gained during the monitoring of similar projects and
adjacent oil and gas Concessions Blocks
• Consultation with Stakeholders and community
9.5 COMPONENTS OF THE EMP
The EMP consists of the following:
• Legislation and guidelines
• Organizational structure and responsibilities
• Implementation Stages of EMP
• Change Management Plan
• Waste Management Plan
• Environmental Monitoring Plan
• Impacts Mitigation Plan
Chapter 09 3 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
9.6 LEGISLATION AND GUIDELINES
The EIA has discussed national and international legislation and guidelines that are relevant to
the project. MPCL will ensure that the project is conducted in conformance to MPCL Corporate
HSE policy and national legislations applicable to the project. MPCL will also ensure that its key
project management staff and all its assigned contractors are aware of these legislation and
guidelines prior to the start of project activities. All relevant laws and Regulations are discussed
in details in Chapter 2 of the report.
The NEQS specify standards for industrial and municipal effluents, gaseous emissions,
vehicular emissions, noise levels, ambient & noise level and drinking water quality are
discussed in chapter 2 and attached as Annexure IV.
9.7 ORGANIZATIONAL STRUCTURE AND RESPONSIBILITIES
This section provides an organizational structure for effective implementation of EMP during
seismic, construction and drilling phases of proposed project, and defines the roles and
responsibilities during the project phases. The proposed project includes the following
organizations:
• MPCL as the project proponent and owners of this EMP; and
• Seismic, construction and drilling contractors as the executors of the EMP.
• If the seismic, construction and drilling operation is carried out by MPCL itself, then MPCL
would become the executor of the EMP.
9.7.1 PROJECT PROPONENT
Being a project proponent and owner, MPCL will be responsible for ensuring the overall
implementation of the EMP. Manager Exploration, Senior Manager Designing and Construction
and Drilling specialist will be responsible for overall environmental performance of the project,
and implementation and compliance of the EMP. The QHSE Manager, will be responsible for
providing technical support in environment related issues, Contactor site HSE personal will be
responsible for ensuring implementation of the EMP and will ensure that the project is carried
out in accordance with governing legislation, MPCL’s Corporate Policies and the
recommendations laid down in this EIA.
In addition to that MPCL management will also ensure:
• Deploy a contractor Site HSE Coordinator to accompany field team throughout the
duration of the proposed project. HSE field monitor will also deploy by MPCL on call out
basis to monitor contractors site activities;
• All contracts of MPCL which will execute through contractors and sub-contractors comply
with environmental sensibilities and MPCL’s HSE Policy and guidelines;
Chapter 09 4 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• All HSE personnel will be authorized to implement the policies and requirements of the
environmental management plan;
MPCL will cooperate with regulatory agencies and other stakeholders who may intend to send
their own teams to monitor seismic, construction and drilling activities.
9.7.2 CONTRACTORS
For proposed project MPCL may acquire services for contractors for seismic, civil work and
drilling operations. Civil work contractor would be involved in development of access road,
well site and campsite, whereas, drilling contractor(s) would be involved in well drilling
operation. These contractors will nominate HSE representative / officer for their respective
activities. HSE Representative / Officer will be responsible for implementation of, or adherence
to, all provisions of the EMP and with any environmental and other codes of conduct required
by MPCL. Overall responsibility for environmental performance of the operation will rest with
the senior management of the contractors. Site In-charges of the contractors will be responsible
for the effective implementation of the EMP.
9.7.3 REGULATORS
Sindh Environmental Protection Agency (SEPA) will monitor compliance with the requirements
of EMP of the project and any additional mitigation measures provided in the NOC for the
project.
9.7.4 INDEPENDENT MONITORING CONSULTANT (IMC)
MPCL will be responsible for ensuring the overall implementation of the EMP. For this purpose
it is suggested that MPCL acquire services of Independent Monitoring Consultant (IMC) for
compliance and implementation of EMP. The responsibilities of IMC will include:
• Ensure that all environmental and social parameters/ provisions comply with the
applicable standards;
• Ensure that development and operational activities are carried out in an environmentally
sound and sustainable manner;
• Organize periodic environmental training programmes and workshops for the Contactor's
staff and Site staff in consultation with MPCL.
9.8 IMPLEMENTATION STAGES OF EMP
9.8.1 PLANNING AND DESIGN STAGE
Design and other details of the proposed project include the activities described in Chapter 4 of
this EIA report. Following approval of the EIA from SEPA, if any aspect of the operation or
requirements of the EIA need to be changed, MPCL will categorise that changes in accordance
Chapter 09 5 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
with the Change Management Plan provided in Section 9.9 of this EMP and take appropriate
measures thereon.
9.8.2 OPERATIONAL STAGE
Operational stage refers to all stages after designing and planning stage. In this EMP,
operational stage comprises of i.e. rig erection and operation/drilling. EMP will be implemented
during all phases. Implementation of following activities during operational stage is very
essential for overall management of mitigation measures.
a) Minimum Distances
The EIA specifies minimum distances to be maintained from environmental features including
communities, water sources, sensitive areas and archaeological/cultural/religious sites etc.
These minimum distances are provided in Table 9.1. MPCL and the contractors will ensure that
these minimum distances are adhered to during the execution of the project.
Table 9.1: Minimum distance from environmental receptors
Facility Distance
New access tracks
• 50m from all surface water sources
• 100m from Sensitive receptor (house, School and market)
• 100m from Dhands
Campsite
• 500 m from communities
• 500m from cultural sites (including graveyard and shrines)
• 200m from surface water bodies
Upholes
• 30m from water wells
• 50m from houses (including mud house and huts etc)
• 50m from Surface water bodies e.g. dhands
• 50m from reptile hole/nest/den
• 100m from Tank/ dug well/hand pumps
• 50m from archaeological significant and cultural sites
• (including graveyard, religious sites and shrines)
Soak pits • 300m from all surface/ground water sources
Shot holes and
Vibrators
• 50m from water wells
Chapter 09 6 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.1: Minimum distance from environmental receptors
• 50m from houses
• 50m from Surface water bodies
• 100m from Tank/ dug well/hand pumps
• 50m from reptile hole/nest/den
• 50m from archaeological significant and cultural sites
(including graveyard, religious sites and shrines)
Drilling Site • 500 m From Community
b) HSE Management System
MPCL and the contractors will ensure that the organisational HSE Management System is
implemented during the proposed project activities. The contractors will abide by the relevant
contractual provisions relating to the environment.
c) Emergency Preparedness
Emergency preparedness plan will be prepared and maintained by MPCL and its contractor to
deal with any emergency situation that may arise during the project activities e.g. fire
emergency, major oil spills, blow out (in case excess pressure abrupt rapidly during drilling),
occupational health & safety hazard etc. and communicate these to the regulatory agencies (if
required by these agencies). However, MPCL has a clearly defined, well structured and
dynamic Emergency Response Plan.
d) Communication and Documentation
HSE matters will be discussed during daily tail gate meetings held on-site, in order to monitor,
manage and document the environmental performance of project activities. Environmental
concerns raised during the meetings will be resolved after discussions between MPCL and
contractor’s management representative or higher management (if required). Weekly and
monthly environmental reports will be generated by MPCL Site HSE Coordinator and
contractor’s representative and will be shared to the respective higher management.
e) Environmental Training Programme
The MPCL’s HSE Manager is overall responsible for identifying, arranging evaluating and
development of comprehensive environmental training programme for effective
implementation of the EMP. The MPCL’s Site HSE Coordinator will determine the training
requirements for the contractors necessary for understanding and effective implementation of
the EMP. The MPCL’s Site HSE Coordinator and contractor’s representatives will then
disseminate the necessary training to all project personnel.
Chapter 09 7 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.2: Suggested Environmental Training
Project Activity Staff Contents
Seismic/Drilling
Drivers
• Road safety
• Road restrictions
• Defensive driving
• Vehicle restrictions
• Alcohol and drug policy
• Socio-economic sensitization
Crew
• Wildlife sensitivities
• Communication of environmental problems to
appropriate officer
• Waste disposal
• Socio-economic sensitization
Camp Staff
• Camp operation
• Waste Segregation
• Waste disposal
Construction Bull Dozer Operators
• Wildlife sensitivities
• Identification and avoidance of sensitive areas
• Waste disposal
• Waste management at work sites
• Communication of environmental problems to
appropriate officer
• Restoration requirements
f) Restoration
MPCL will be responsible for the final restoration of work areas according to the requirements
of the EIA.
9.9 CHANGE MANAGEMENT PLAN
The EIA recognises that changes in the operations or the EMP may be required during the
operation and therefore a Change Management Plan has been provided to manage such
Chapter 09 8 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
changes. The management of changes is discussed under two separate headings, changes to the
EMP and changes to the Operation.
9.9.1 CHANGES TO THE EMP
The EIA and the EMP have been developed based on the best possible information available at
the time of the EIA study. However, it is possible that during the seismic, construction and
operation phase some aspects of the EMP may need to be changed owing to their non-
applicability in a certain area of operation or the need for additional mitigation measures based
on the findings of environmental monitoring during the seismic, construction and operational
phase. In such cases following actions shall be taken.
• A meeting will be held between MPCL and the concerned contractor. During the meeting
the proposed deviation from the EMP, planning and designing will be discussed and
agreed upon by all parties.
• Based on the discussion during the meeting, a change report will be produced collectively,
which will include the original EMP clause/plan or design, the change that has been agreed
upon, and the reasons for the change.
• The report will be signed by all the parties and will be filed at the site office. A copy of the
report will be sent to MPCL and contractor head offices.
• All relevant project personnel will be informed of the change.
9.9.2 CHANGES TO THE OPERATION
a) First-Order Change
A first order change is one that leads to a significant departure from the project described or the
impacts assessed in the EIA and consequently require a reassessment of the environmental
impacts associated with the change. Examples of such change include change in design of
proposed project.
In such an instance, the environmental impacts of the proposed change will be reassessed, and
the results sent to the Sindh EPA for approval.
b) Second- Order Change
A second-order change is one that entails project activities not significantly different from those
described in the EIA, and which may result in project impacts whose overall magnitude would
be similar to the assessment made in this report.
In case of such changes, the environmental impact of the activity will be reassessed, additional
mitigation measures specified if necessary, and the changes reported to the Sindh EPA.
c) Third –Order Change
A third-order change is one that is of little consequence to the EIA findings. This type of change
does not result in impact levels exceeding those already assessed in the EIA; rather these may
Chapter 09 9 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
be made onsite to minimize the impact of an activity. The only action required in this case will
be to record the change in the change record register.
9.10 WASTE MANAGEMENT PLAN
The waste management plan is a necessary requirement to ensure that the impact of generated
wastes is kept to be a minimum. A generic waste management principle is discussed here, that
will be employed during the project while a detailed plan will be developed by the MPCL and
its contractor. Different types of waste will be generated from different project activities which
needs to be properly disposed are;
• Seismic and construction waste
• Excess seismic and construction material
• Fuel, Oil & Chemical
• Drill cuttings and mud
• Recyclable waste
• Garbage
• Sewage etc.
General principles within this plan should be:
• All staff should be aware of waste management procedures;
• Waste Management procedures should be followed;
• Wastes shall be handled, stored and treated according to their nature or type;
• All reusable and recyclable waste should be segregated;
• All reusable waste should be reused where possible or sent for recycling or scrap
contractor;
• Waste generation and disposal records should be maintained.
9.11 ENVIRONMENTAL MONITORING PLAN
Project activities would be monitored by MPCL and its contractors; MPCL Site HSE
Coordinator will monitor project activities and will keep records of all non-conformances
observed and report these along with actions to MPCL management for further action. The Site
HSE Coordinator will also communicate any anticipated impact(s) which was not covered in
EIA for further action.
MPCL, IMC and the contractors will ensure that environmental monitoring of the project
activities is carried out according to the monitoring plan given in Table 9.3.
Chapter 09 10 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.3: Environmental Monitoring Plan
S. No. Monitoring Parameters Responsibility Timeline/ Frequency
1 Ambient air quality MPCL
Construction: Quarterly
Operation: Biyearly
2 Ambient noise monitoring MPCL
Construction: Quarterly
Operation: Biyearly
4 Vehicle Emission MPCL Construction: Quarterly
Operation: Biyearly
3 Drinking Water MPCL
Construction: Quarterly
Operation: Biyearly
5 Gaseous Emission MPCL
Construction: Monthly
Operation: Monthly
6 Wastewater MPCL
Construction: Monthly
Operation: Quarterly
Note: Operation Mean Seismic & Drilling Activities
9.12 IMPACTS MITIGATION PLAN
The purpose of impact mitigation plan is to ensure the implementation of mitigation measures
suggested in the EIA report. Impact mitigation plan is a reference tool for systematic monitoring
of the significant impacts identified in the EIA.
Suggested mitigation measures are summarized in Table 9.4 for seismic, construction & drilling
phases and contain the following information.
• The required mitigation measures recommended in EIA report.
• The person/organization directly responsible for adhering to or executing the required
mitigation measures.
• The person/organization responsible for ensuring the execution of mitigation measures in
the EIA report.
• A timescale for the implementation of the action to ensure that the objectives of mitigation
are fully achieved.
MPCL and its contractors will ensure the compliance of suggested mitigation measures during
the entire project as described in this EIA.
Chapter 09 11 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
1. Topography & Soil
1.1 Vegetation clearing will be minimized. CC, SC, DC MPCL Prior and during the land
clearing operation
1.2 Width of seismic line will be restricted to 4.5m in order to avoid unnecessary
cutting of vegetation and soil removal. CC, SC MPCL During line preparation
1.3
Any loss of dense patches of riverine forest/ Vegetation will be compensated by
plantation/replantation. The number of trees to be planted against the number
removed will be determined in consultation with the Sindh Forest department
(SFD) and IUCN.
CC, SC, DC MPCL, IMC As and when required
1.4 The number of access tracks will be specific and kept to minimum levels. CC, SC, DC MPCL During the entire
operation
1.5 Vehicle speeds will be regulated and monitored to avoid excessive dust
emissions. CC, SC, DC MPCL During the entire project
1.6 Water sprinkling should be carried out to minimize dust emissions due vehicular
movement and other construction activities. CC, SC, DC MPCL During the entire project
1.7 Off-road travel should be avoided and observance of this should be monitored
during the operation. CC, SC, DC MPCL During the entire project
1.8 Periodic training will be provided to drivers on mitigation measures related to
off-road travel and speeds limits. CC, SC, DC MPCL, IMC During the entire project
Chapter 09 12 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
1.9 The well site and camp site will preferably be located in existing clearing and
levelled land. CC, SC, DC MPCL
At the time of site
selection for camp site
1.10 Access tracks (other than the tracks used for the access the project site) to be used
by water tankers, dumper trucks and other vehicles shall be monitored. CC, SC, DC MPCL During the entire project
1.11 Movement of equipments will be restricted to avoid unnecessary disturbance to
soil. CC, SC, DC MPCL During the entire project
1.12 Areas along the access track will be visually monitored and any area showing
signs of soil erosion will be compacted as necessary. CC, SC, DC MPCL During the entire project
1.13 All fuel tanks/drums will be properly marked to highlight their contents CC, SC, DC MPCL During the entire project
1.14 Fuels tanks/drums will be checked on regular basis for leaks and all such leaks
will be plugged immediately. CC, SC, DC MPCL During the entire project
1.15 A spill prevention and contingency plan will be prepared to deal with spills. CC, SC, DC MPCL During the entire project
1.16
Photographs will be taken before the well site construction activities to record the
conditions of campsite and well site locations that are likely to undergo soil
erosion. Similar photographs will be taken after restoration, where applicable. CC, SC, DC, IMC MPCL During the entire project
2. Water Resources
2.1 The water extraction will be kept at minimum. CC, SC, DC MPCL During the entire project
Chapter 09 13 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
2.2 A complete record of water consumption during construction and drilling will be
maintained. CC, SC, DC MPCL
During the entire
operation
2.3
The water used during project activities (seismic, construction) will be kept to the
minimum required by taking cautious on site measures related to water
conservation.
CC, SC, DC MPCL During the entire
operation
2.4 Water conservation strategies will be developed to avoid over consumption or
depletion of water resource in the project area. CC, SC, DC MPCL
During the entire
operation
2.5 In case; new water well is installed by MPCL, this shall be drilled in deep aquifer
and at least 500 m from nearest community water well. CC, SC, DC MPCL, IMC
During the entire
operation
2.6
Water from public sources i.e. surface or ground water will only be abstracted
after getting formal permission from the concerned department and fulfilling the
requirements of the EIA and EMP.
CC, SC, DC MPCL, IMC During the entire
operation
2.7 Follow good housekeeping practices with all machinery that may potentially
discharge into wastewater pit. CC, SC, DC MPCL
During the entire
operation
2.8 Septic tanks and soak pits will be emptied periodically to ensure that effluent
does not overflow into surrounding areas. CC, SC, DC MPCL As and when required
2.9 Sumps will remain covered all the time and measures will be taken to prevent
rainwater entry. CC, SC, DC MPCL
During the entire
operation
2.10 Septic tanks and soak pits will be designed so that runoff does not flow into them. CC, SC, DC MPCL Before start of work
Chapter 09 14 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
2.11 At the time of restoration, septic tanks will be removed and the pits will be
backfilled. CC, SC, DC MPCL, IMC
After the completion of
work
2.12
Waste storage area should be properly covered, isolated and lined with tarpaulin
or other appropriate material to avoid ground water contamination from
leachate.
CC, SC, DC MPCL During the entire
operation
2.13 Fuels and lubricants will be stored in areas with impervious floors and bunds that
can contain spills. CC, SC, DC MPCL
During the entire
operation
2.14 All areas containing potentially hazardous materials will be isolated from the
remaining site. CC, SC, DC MPCL
During the entire
operation
2.15 All fuel tanks/drums will be properly marked to highlight their contents. CC, SC, DC MPCL During the entire
operation
2.16 Fuels tanks/drums will be checked on regular basis for leaks and all such leaks
will be plugged immediately. CC, SC, DC MPCL
During the entire
operation
3. Ambient Air Quality
3.1
All equipment, generators, and vehicles used during the construction phase will
be properly tuned and maintained in good working condition in order to
minimize exhaust emissions
CC, SC, DC MPCL During the entire
operation
3.2 All project vehicles will be checked regularly to ensure that engines are in sound
working condition and are not emitting smoke CC, SC, DC MPCL
During the entire
operation
Chapter 09 15 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
3.3 Well site and campsite should be located at least 500 m away from communities CC, SC, DC MPCL Prior to the construction of
camp site.
3.4 Access track to access well sites and camp site will maintain a practical distance
from communities in order to avoid dust impacts on nearby communities CC, SC, DC MPCL
During the entire
operation
3.5
Dust emissions during construction activities will be minimized by good
management practices such as locating stock piles out of the wind direction,
keeping the height of the stock piles to a minimum, keeping earthwork areas
damp etc.
CC, SC, DC MPCL During the entire
operation
3.6 Imposing speed limits will reduce the dust emissions produced by vehicular
movement. CC, SC, DC MPCL
During the entire
operation
3.7 Water sprinkling should be carried out to minimize dust emissions in order to
minimum deterioration of ambient air quality. CC, SC, DC MPCL
During the entire
operation
4. Noise Pollution & Vibration
4.1
Proper engineering control will be applied to noise producing sources like
generator (Canopy, muffler and enclosure will be installed/ provided to reduce
the noise impact on the surroundings and nearby communities).
CC, SC, DC MPCL During the entire
operation
4.2 It will be ensured that generators, vehicles and other potentially noisy equipment
used are in good condition. CC, SC, DC MPCL
During the entire
operation
Chapter 09 16 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
4.3 Noise from generators, vehicles and other equipment and machinery will be kept
to the minimum through regular maintenance. CC, SC, DC MPCL
During the entire
operation
4.4 The use of horns by project vehicles will be minimized. The use of pressure horns
will not be allowed CC, SC, DC MPCL
During the entire
operation
4.5 Camp & Well site will be located at a distance mentioned in this EIA report in
order to minimize the noise impacts. CC, SC, DC MPCL
During the entire
operation
4.6 All on-site personnel will use required personal protective equipment (PPE) in
high noise areas that will be clearly marked. CC, SC, DC MPCL
During the entire
operation
4.7 Ambient noise levels (intermittently) will be monitored during construction
activities. CC, SC, DC MPCL, IMC
During the entire
operation
5. Waste Generation
5.1 Black water (sewage water) should be disposed through septic system comprising
of septic tanks and soak pits. CC, SC, DC MPCL
During the entire
operation
5.2 Grey water (washing water, kitchen water etc.) should be disposed through soak
pits and where required should be sprinkled on access tracks. CC, SC, DC MPCL
During the entire
operation
5.3 Septic tanks and soak pits should be constructed and designed to accommodate
domestic sewage i.e. black and grey water. CC, SC, DC MPCL Before start of work
Chapter 09 17 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
5.4 Soak pits and septic tanks will be confined with a buffer area in order to stop any
entrance or its exposure to outer environment. CC, SC, DC MPCL At the time of construction
5.5 Solid residue from the septic tanks should be transported to municipal sewage
treatment facilities in any nearby city. CC, SC, DC MPCL
During the entire
operation
5.6 All project related vehicles should be checked on regular basis for fuel or oil
leaks. Vehicles with leaks should not be allowed to operate until repaired. CC, SC, DC MPCL
During the entire
operation
5.7 All chemical and fuel storage areas are equipped with secondary containment in
the form of concrete or brick masonry dykes/bunds. CC, SC, DC MPCL
During the entire
operation
5.8 Solid waste disposal should be through waste contractors CC, SC, DC MPCL During the entire
operation
5.9 The recyclable waste should be sent to waste contractors/ vender or any other
recycling facility for reused. CC, SC, DC MPCL
During the entire
operation
5.10 Medical waste should be sent to an EPA approved incineration facility. CC, SC, DC MPCL During the entire
operation
5.11 Non-recyclable debris and domestic garbage should be stored separately and sent
to nearest domestic contractor for final disposal CC, SC, DC MPCL
During the entire
operation
5.12 Waste management procedures and activities should be monitored to avoid any
land contamination. CC, SC, DC MPCL
During the entire
operation
Chapter 09 18 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
5.13
A waste management plan should be developed before the start of the project
activities. Key elements of the waste management system are discussed in detail
in respective section of the EIA report.
CC, SC, DC MPCL Before start of work
6. Vehicular Movement
6.1 Noise from all type of vehicles will be kept to the minimum through regular
maintenance. CC, SC, DC MPCL
During the entire
operation
6.2 The use of horns by project vehicles will be minimised. The use of pressure horns
will not be allowed. CC, SC, DC MPCL
During the entire
operation
6.3 Where required, water sprinkling will be carried out to minimize dust emissions
due to vehicular movement and other activities. CC, SC, DC MPCL As and when required
6.4 Imposing speed limits, all drivers will receive specific direction on this
requirement. CC, SC, DC MPCL
During the entire
operation
7. Vegetation
7.1 Vegetation clearing during seismic activities and construction of well sites and
camp sites will be kept to a minimum. CC, SC, DC MPCL During seismic operation
7.2 When developing new access roads, routes that minimize vegetation loss will be
chosen, avoiding unnecessary damage to vegetation. CC, SC, DC MPCL
During the entire
operation
Chapter 09 19 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
7.3 Use of local vegetation as fuel by project personnel will be prohibited. CC, SC, DC MPCL During the entire
operation
7.4 Clearing of dense vegetation during project activities shall be minimized by
careful selection of camps and access tracks by providing off-site tracks. CC, SC, DC MPCL
During the entire
operation
7.5 Clearing of vegetation/forest should be avoided and incase of any plant damaged
it should be replanted and monitored through IMC. CC, SC, DC MPCL, IMC
During the entire
operation
8. Wildlife and Habitat
8.1 No-hunting and no-trapping policy will be strictly enforced, unless human life is
under threat. CC, SC, DC MPCL
During the entire
operation
8.2 Harassment of wildlife during construction activities will not be allowed. CC, SC, DC MPCL During the entire
operation
8.3 Areas with concentrated colonies of active burrows and dens will be avoided
during the seismic activities & access track improvement/construction. CC, SC, DC MPCL
During the entire
operation
8.4
Prior to the improvement and construction works on the access tracks, areas with
small mammal and reptile holes will be identified. All live holes will be disturbed
manually or by other appropriate means so as to dislocate species residing in
these holes.
CC, SC, DC MPCL During the entire
operation
8.5 Training should be provided to drivers and staff for safe driving practices to
protect local community and wildlife. CC, SC, DC MPCL
During the entire
operation
Chapter 09 20 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
8.6 All mitigations related to minimising noise will be adhered to. CC, SC, DC MPCL During the entire
operation
8.7 General awareness of the crew would be provided regarding the wildlife,
through environmental training, notice board postings, tool box talks etc. CC, SC, DC MPCL
During the entire
operation
8.8 The project staff would be educated and morally trained to avoid killing, feeding
or harassment of wildlife. CC, SC, DC MPCL
During the entire
operation
8.9 Night time travelling will be kept to a minimum. CC, SC, DC MPCL During the entire
operation
8.10 Lights used at well sites and campsites will be kept to the minimum required. CC, SC, DC MPCL During the entire
operation
8.11 Food wastes will not be disposed off in the open. Food wastes collected in waste
segregation units will be disposed off according to waste management plan. CC, SC, DC MPCL
During the entire
operation
9. Land Acquisition and Compensation
9.1 A generous compensation will be granted to land owner as per prevailing market
rates (if land acquired for construction activities) MPCL MPCL
Prior to or during
construction
9.2 Compensation amount should be disbursed in time to avoid any conflicts
between proponent and local community. MPCL MPCL Before start of work
Chapter 09 21 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
9.3
Agricultural, archaeological, religious or other valuable land will not be used for
seismic and exploratory drilling activities without consent of respective
authorities.
MPCL MPCL During the entire
operation
10. Community Disturbance
10.1
While deploying major noise generating equipment, it should be checked that all
noise abatement devices are in good working condition and proper measures
have been taken to minimize the noise levels.
CC, SC, DC MPCL During the entire
operation
10.2 Use alternate route, wherever possible, that passes away from community. CC, SC, DC MPCL During the entire
operation
10.3 Campsite will be selected away from the human settlements and maintain a
minimum distance of 500 m. CC, SC, DC MPCL
During the entire
operation
10.4 Consent from respective local authority is mandatory prior to use of local
resources e.g. water CC, SC, DC MPCL Before start of work
10.5 All the mitigation measurements for the vehicles movement & waste
management mentioned above will be followed to avoid any disturbance. CC, SC, DC MPCL
During the entire
operation
11. Restricted Mobility
11.1 Ensure there should be no interaction with the local womenfolk. CC, SC, DC MPCL During the entire
operation
Chapter 09 22 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
11.2 Project staff should respect local cultural norms. CC, SC, DC MPCL During the entire
operation
11.3 Project crew should be restricted to work corridor CC, SC, DC MPCL During the entire
operation
11.4 Limit the social interaction between the project team and local communities in
order to avoid disputes between the construction team and locals. CC, SC, DC MPCL
During the entire
operation
12. Community Grievance/Complaints
12.1 Grievance handling system will be established to address community
grievance/complaints. MPCL MPCL
During the entire
operation
12.2 A social complaint register will be maintained on site by MPCL. All complaints
received from local communities shall be noted. MPCL MPCL
During the entire
operation
12.3
Community complaints shall be duly addressed and appropriately resolved. The
measures taken to mitigate these concerns will also be noted in social complaint
register.
MPCL MPCL During the entire
operation
13. Archaeological, Cultural and Religious Sites
13.1 Ensure all project activities will be carried out away from any archaeological,
cultural and religious site, if any. MPCL MPCL
During the entire
operation
13.2 For all other sites of local significance e.g. Masjids, graveyard etc. a safe distance
(determined after consultation with locals) will be maintained. MPCL MPCL Before start of work
Chapter 09 23 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
13.3 Safe distance should be maintained to avoid any physical damage, change in
aesthetic value, or disrespect to any site of archaeological or religious importance. MPCL MPCL
During the entire
operation
13.4
Any sudden discovery of any such site of archaeological, cultural and religious
importance during project activities shall be communicated to project proponent
for further intimation to relevant department.
CC, SC, DC MPCL During the entire
operation
14. Community Safety
14.1 Project vehicles should follow speed limits which will reduce road safety issues
significantly. CC, SC, DC MPCL
During the entire
operation
14.2 Safe driving practices will be adopted while passing through settlements. CC, SC, DC MPCL During the entire
operation
14.3 Explosives should be stored in an isolated and clearly marked area. The area
should be constructed keeping in view community and campsite safety. CC, SC, DC MPCL
During the entire
operation
14.4 Local people will be informed about project activities in order to keep locals
especially children away from project area. CC, SC, DC MPCL
During the entire
operation
15. Emergencies And Accidents
15.1 Ensure emergency response plan should be developed and implemented to cater
different emergency situation as mentioned in respective section of the report. MPCL MPCL, IMC
During the entire
operation
15.2 Ensure project related staffs are well aware and trained on emergency response
plan. CC, SC, DC MPCL
During the entire
operation
Chapter 09 24 of 24
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Table 9.4: Impact Mitigation Plan For Seismic, Construction And Drilling Phase
S. No. Mitigation Measures Execution Monitoring Time Line/Frequency
15.3 Ensure provision of first aid at site in case of any emergency. CC, SC, DC MPCL During the entire
operation
16. Employment
16.1
MPCL and its contractors should employ local residents for semi skilled and
unskilled opportunities and wherever possible, for skilled jobs during the project
cycle.
CC, SC, DC MPCL During the entire
operation
16.2 Local residents living closest to the project location will be given priority in the
employment process. CC, SC, DC MPCL
During the entire
operation
16.3 Labour from local communities will be recruited equitably among the tribes and
the employment procedures will be transparent. CC, SC, DC MPCL
During the entire
operation
IMC : Independent Monitoring Consultant
DC : Drilling Contractor
MPCL : Mari Petroleum Company Limited
SC : Seismic Contractor
Chapter 10 1 of 2
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
10 CONCLUSION
Pakistan is facing severe energy crisis and looking for various options to meet the growing
energy demand. Pakistan’s energy demand over the next 15 years is expected to grow at a rate
of 4.4% to 6.1% per annum based on the projected economic growth and is likely to be in the
range of 115 to 148 MTOE by 2021-22.
Oil and Gas are major components of Pakistan's energy mix meeting over 80% of energy needs.
Around 80% of Pakistan’s crude requirements are met through imports, which is a severe
burden on its foreign exchange reserves.
There is, therefore, a vital need to explore for additional energy reserves and further develop
existing fields. The proposed project will help towards achieving this objective and will
contribute to reduce Pakistan’s energy demand.
SGS Pakistan successfully materialized the EIA study of the proposed project. The study was
based on baseline environmental and socioeconomic information which was collected from a
variety of sources, including reports of previous studies, desk studies, census report etc. All
adequate requirements have been addressed in this EIA report, which has a viable length
covering the following:
• The proposed project activities
• Environmental conditions of the proposed site and its surroundings
• Legislative requirements related to the project
• Significant environmental impacts of the proposed project activities on the physical,
biological and socio-economic receptors
• Mitigation measures in order to reduce any impact on physical, biological and socio-
economic receptors
• An EMP has been provided that will help in effective implementation of the mitigation
measures.
This environmental study has fully examined the potential environmental impacts due to
proposed project activities. Mitigation measures that required minimizing or obviating these
impacts is also suggested.
It is therefore concluded that
“Proposed seismic and drilling activities with associated seismic data acquisition, construction
and drilling work has low intensity adverse impacts, likely to be of short term duration, minor
and of local consequence and are insignificant. A vigilant implementation of mitigation
measures and Environmental Management Plan (EMP) will ensure that environmental impacts
are managed and minimized and are within acceptable limits.”
Chapter 10 2 of 2
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
Moreover, proposed project activities will not lead to pose adverse environmental impacts, if
suggested mitigation measures and EMP is implemented effectively.
Chapter 11 1 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
11 REFERENCES
The information provided in this EIA report has been collected from a variety of sources,
including reports of previous studies conducted by SGS, published literature, and secondary
sources. All these references are presented in this section.
• 1998 District Census Report of Thatta, Population Census Organization, Statistics Division,
Government of Pakistan, Islamabad, February 2000
• Buset, P., Riiber, M., (2001) "Jet Drilling Tool: Cost-Effective Lateral Drilling Technology for
Enhanced Oil Recovery ",SPE 68504, SPE, SPE/ICoTA Coiled Tubing Roundtable, 7-8
March 2001, Houston, Texas
• DOE, 1999, "Environmental Benefits of Advanced Oil and Gas Production Technology,"
DOE-FE-0385, U.S. Department of Energy, Office of Fossil Energy, Washington, DC
• Environmental Legislation in Pakistan and the OECD Guidelines for Multinational
enterprises: A Gap Analysis.
• Environmental Law in Pakistan – Part 1 by IUCN.
• Environmental Management in Oil and Gas Exploration and Production-an Overview of
Issues and Management Approaches. Joint Technical Publication of E&P Forum and
UNEP.
• Pakistan Petroleum Exploration Promotion Conference, 2012, Ministry of Petroleum and
Natural Resources.
• Investment Opportunities in Pakistan’s Upstream Oil and Gas Sector-Ministry of
Petroleum & Natural Resources Government of Pakistan.
• Akber, G and S. Fatima. 2012. Folral guide, Indus ecoregion, Indus for All Programme,
WWF - Pakistan
• Ali, S.I. and Y.J. Nasir. 1989-1991. Flora of Pakistan, fascicles nos.191-193. Department of
Botany, University of Karachi and PARC, Islamabad.
• Ali, S.I. and Y.J. Nasir. (Eds.). 1989-1992. Flora of Pakistan. Nos. 191-204. Islamabad,
Karachi.
• Ali, S.I. and M. Qaiser. (Eds.). 1993-2009. Flora of Pakistan. No. 191-217. Islamabad,
Karachi.
• Ali, S. I. and M. Qaiser. 1986. A phytogeographical analysis of the phanerogams of Pakistan
and Kashmir. Proceedings of the Royal Society of Edinburgh. Pp: 89-101.
• Amjad, S and S. Qidwai. 2002. Freshwater, brackish water and coastal wetlands of Sindh. A
Status Paper. National Institute of Oceanography, Karachi, Pakistan.
Chapter 11 2 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Anwar, F. 2004. Freshwater Resources of the Indus Delta Eco-region. In: Proceedings of the
consultative workshop on Indus Delta Eco-region (IDER), WWF Pakistan. Karachi. Pp. 17-
37
• Blatter, E., C. McCann, and T. S. Sabnis. 1929. The flora of Indus Delta. The Indian Botanical
Society. The Methodist Publishing House, Madras, India. P.173.
• Chaudhri, I.I. and M.S. Chuttar. 1966. The vegetation and range Flora of Thar desert, W.
Pak. Forest dept., Hyderabad.
• Donaldson, J. S., Mills, A., O'farrell, P., todd, S., Skowno, A. and Nanni, I. 2003.
Conservation Farming with biodiversity in South Africa; A preliminary evolution of
ecosystem goods and services in the Bokkeveld Plateau. In: Lamons, J., Victor, R., and
Schaffer, D. (Eds.) Conserving Biodiversity in Arid regions. Kluwer academic Publishers.
Foreverindus.org/ Indus ecoregion.
• Gregory L. Possehl. (eds.) The Indus civilization. A Contemporary Perspective. AltaMira
Press. 2002.
• Gregory, S.V., Swanson, F.J., McKee, W.A., and Cummins, K.W. 1991. An ecosystem
perspective of riparian zones. BioScience 41: 540-551.
• Hassan, M. H. A. 2003. Preface In: Lamons, J., Victor, R., and Schaffer, )
• Hoekstra, D. A., N. Mahmood., G. R. Shah, W. A. Shah., M. A. Domki., and Q. M. Ali 1997.
Diagnostic study Indus Delta Mangrove ecosystem. Main sub-system characteristics,
problems, potentials, proposed interventions and pilot sites. Sub-project. RRIDM (World
Bank/GoS funds) 76 pp.
• Hughes. A. W. Gazetteer of the Province of Sindh, G. Bell (London) 1876.
• Ismail, S., Saifullah S.M. and Khan S.H. 2006. Assessment of Chromium in the water and
Sediments of Indus Delta Mangroves. . Soc. Pak. (28) 426-429. D. (eds. Conserving
Biodiversity in Arid regions. Kluwer academic Publishers Jour. Chem
• Ishaque, M. Memon, A. and Shahani, N. M. 1986. Annual research report, Survey and
domestication of wild plants in Sind, Pakistan. Department of plant breeding & genetics,
Sindh Agriculture University, Tandojam.
• IUCN, 2004. Sindh State of Environment & Development, Karachi, Pakistan.
• IUCN, 2007. Sindh Strategy for Sustainable Development, Karachi, Pakistan.
• Jafri, S.M.H. 1966. The Flora of Karachi. The Book Corporation, Pakistan.
• Meynell, Peter-Jhon and Qureshi, M. T. 1995. Water resources and management in the
Indus river delta, Pakistan. Parks 5: 15-23.
• Nasir, E. and S.I. Ali. 1969-1989. Flora of Pakistan. No. 1-190. Department of Botany,
University of Karachi.
Chapter 11 3 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Qazi, J. History, Logic, Law and Politics of water and Indus. In: IBRAT (Newspaper). 2003.
• Qureshi, R. 2004. Floristic and Ethnobotanical Study of Desert Nara region, Sindh. (Ph.D.
Thesis), Department of Botany, Shah Abdul Latif University, Khairpur, Sindh, Pakistan.
Vol. I-II:1-454 pp.
• Qureshi, S. in Nasir, E and Ali, S. I. eds (1972) Flora of Pakistan No 29 ( ), Department of
Botany, University of Karachi.
• Shinwari, Z. K., Watanabe, T., Rehman, M., Yoshikawa, T. 2006. A Pictorial Guide to
Medicinal Plants of Pakistan. Kohat University of Science and Technology, Kohat.
• Smyth, J. W. Gazetteer of the Province of Sind. B (1). The Government Central Press,
Bombay. 1919.
• Stewart, R. R. 1982. Flora of Pakistan. History and exploration of flora in Pakistan and
adjoining areas. E. Nasir and S. I. Ali (eds.) National Herbarium, PARC, Islamabad. Pp 8-
14.
• Swanson, F. J., Kratz, T. K., Caine, N., and Woodmansee, R. G. 1988. Landform effects on
ecosystem pattern and processes. _ BioScience 38: 92-98.
• Urban, L., Bridgewater, S.G. M., and Harris, D.J. 2006. The Macal river: A floristic and
phytosociological study of a threatened riverine vegetation community in Belize.
Edinburgh Journal of Botany 63: 95 - 118.
• Wani, Bashir Ahmed, Hakim Shah and Saliheen Khan. 2004. Forestry statistics of Pakistan.
Pakistan forest Institute, Peshawar.
• Wells, J. T. and Coleman, J. M. 1984. Deltaic morphology and sedimentology, with special
refrence to the Indus River Delta. In: Haq, B. U. and Milliman, J. D. (eds.) Marine Geology
and Oceonography of Arabian Sea and Coastal Pakistan. Van Nostrand reinhold Co.,
NewYork. Pp. 85-100. Salvadoraceae Wikipedia.org/sindh
• Initial Environmental Examination of Exploratory Drilling Activities at Barkhan Block,
District Barkhan, Baluchistan. Prepared by SGS Pakistan.
• Initial Environmental Examination of Multiple Drilling Activities at Kandhkot Mining
Lease, Kashmore, Sindh. Prepared by SGS Pakistan.
• Initial Environmental Examination of Drilling of Hala-2 Exploratory Well in Hala Block,
Sindh. Prepared by Halcrow.
• McFarlane, K., Nguyen, V.T. 1991. The Deposition of Drill Cuttings on the Seabed. Health,
Safety and Environment in Oil and Gas Exploration and Production Conference, The
Hague, Netherlands
• Pakistan Energy Year Book, 2011- Hydrocarbon Development Institute of Pakistan.
Chapter 11 4 of 4
Environmental Impact Assessment of Exploration Activities in Sujawal Block-Sindh 2014
• Pakistan Meteorological Department, Climate Data Processing Centre, Government of
Pakistan. Sectoral guidelines for upstream petroleum sector Volume 2 of 2 - Prepared for
PEPCA.
• Asif Inam. Peter D Clift. The Geographic, Geological And Oceanographic Setting Of The
Indus River
• Annual Flood Report 2010. Government Of Pakistan Ministry of Water And Power
• Environmental Degradation and Impact on Livelihood Sea Intrusion, Case Study IUCN
• Study of Riverine Forest Upstream Sukkur And Downstream Kotri 2008 . K.K Consultants.
• Sindh State of Environment &Development IUCN
• http://www.eoearth.org/view/article/51cbee397896bb431f6963ce/
• Muhammad Rafique, Najam Ul Huda Khan, Distribution And Staus Of Fresh Water Fishes
Of Pakistan
• A. L Korai ,G.A. Sahato Fish Diversity in Relation to Physiochemical Properties of
Kheenjhar Lake ( Thatta District Sindh)
• Fresh Water Turtles Of Pakistan Illegeal Trade In Sindh November 2009 WWF Pakistan
• Integrating Wetland Economics Value Into Indus River Basin Management Indus Delta
Pakistan: Economic Cost Of Reduction In Fresh Water Flow. IUCN.
• Study. Sindh Irrigation Department Bio Saline Agriculture In Badin and Thatta Districts
Feasibility
• Muhammad Iqbal Sheikh 1993. Trees OF Pakistan