Downloaded from on May 31, 2020 by guest · 4 Karukriti Kaushik Ghosh 1*, Aman Prakash 1*, Anusua...
Transcript of Downloaded from on May 31, 2020 by guest · 4 Karukriti Kaushik Ghosh 1*, Aman Prakash 1*, Anusua...
Page 1 of 42
Evaluating the moonlight role of supramolecule ErpY-like lipoprotein of Leptospira in 1
thrombin-catalyzed fibrin clot inhibition, binding to complement factors H & -I, and its 2
diagnostic potential 3
Karukriti Kaushik Ghosh1*
, Aman Prakash1*
, Anusua Dhara1, Md Saddam Hussain
1, Prateek 4
Shrivastav1, Pankaj Kumar
2, Vinayagamurthy Balamurugan
3, Manish Kumar
1# 5
1Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 6
Guwahati -781039, Assam, India 7
8
2ICAR Research Complex for Eastern Region- ICAR Parisar, Patna, India 9
3Indian Council of Agricultural Research - National Institute of Veterinary Epidemiology and 10
Disease Informatics (ICAR-NIVEDI), Bengaluru, India 11
12
*Equal contribution. 13
14
#corresponding author: 15
Manish Kumar 16
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, 17
Guwahati-781039, Assam, India 18
Email: [email protected] 19
Phone: +91-361-258-2230 20
Fax: +91-361-258-2249 21
22
Keywords: Leptospira, Lipoprotein, antibodies, ELISA, recombinant protein, extracellular 23
matrix component, LIC11966 24
Running Title: Characterization of rErpY-like protein of Leptospira interrogans 25
IAI Accepted Manuscript Posted Online 23 September 2019Infect. Immun. doi:10.1128/IAI.00536-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 2 of 42
Abstract 26
Leptospirosis is one of the most widespread zoonoses caused by pathogenic Leptospira spp. 27
In this study, we report that the LIC11966/ErpY-like lipoprotein is a surface-exposed outer 28
membrane protein exclusively present in pathogenic species of Leptospira. The recombinant 29
ErpY-like protein is recognized by the immunoglobulins of confirmed leptospirosis sera of a 30
diverse host (human, bovine and canine), suggesting the expression of the native leptospiral 31
surface protein during infection. Circular dichroism of pure rErpY-like protein showed the 32
secondary structural integrity to be uncompromised during the purification process. Analysis 33
of the rErpY-like protein by native-polyacrylamide gel electrophoresis, chemical cross-34
linking, dynamic light scattering, and field-emission transmission electron microscopy 35
demonstrate it to undergo supramolecular assembly. The rErpY-like protein can bind to 36
diverse host extracellular matrices, among which, it presented a saturable and stronger 37
binding affinity (dissociation constant/KD of 70.45±4.13 nM) to fibrinogen, a central host 38
plasma component involved in blood clotting. In the presence of rErpY-like supramolecule, 39
the thrombin catalyzed fibrin clot formation is inhibited up to 7%, implying its possible role 40
in inhibiting blood coagulation during Leptospira infection. Besides, binding of rErpY-like 41
supramolecule to complement factors H and -I suggests the protein may also contribute to 42
evading Leptospira from innate host defense during infection by inactivating alternative 43
complement pathway. This study reveals that rErpY-like protein is functionally active in 44
supramolecular state and performs moonlighting activity under the given in vitro conditions. 45
46
47
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 3 of 42
Introduction 48
Leptospirosis, a widespread zoonosis, especially in the tropical regions of the world, is caused by 49
the pathogenic species of the spirochete Leptospira (1). It is an endemic infectious disease of 50
farmers, veterinarians, abattoir workers, and people working in close contact with animals with 51
more than one million cases reported each year (2). Leptospirosis is among the most under-52
diagnosed disease owing to its wide range of symptoms ranging from jaundice to renal failure 53
(1). The most severe forms of leptospirosis are known as Weil’s syndrome, where pulmonary 54
hemorrhage may end up to 70% mortality rates (3-5). The molecular understanding of 55
pathogenicity and virulence of leptospires are still under early stages. The origin of 56
pathophysiological symptoms of leptospirosis and the severity of disease remain virtually 57
unknown (6, 7). 58
Comprehensive interrogation of host-pathogen interplay targeting outer membrane proteins to 59
understand the pathophysiology of Leptospira has been actively under study. However, to date, 60
only a few virulence factors of Leptospira have been functionally characterized and well-61
understood. It is now established that Leptospira adherence with the host cells, extracellular 62
matrix, and plasma proteins contribute to bacterial dissemination and host immune evasion (8). 63
Various evidence for the exploitation of host plasma proteins like complement factors (9, 10), 64
plasminogen (10, 11), ferritin (12), and fibrinogen (Fg) (13) by the leptospires have been 65
reported. The advent of the whole genome sequence of Leptospira established that a large share 66
of genes represent putative proteins with no identified function or is exclusively present only in 67
pathogenic species of Leptospira (14). Several such leptospiral proteins (13, 15, 16) have been 68
reported to interact with human fibrinogen (Fg) and complement regulatory proteins. Such 69
binding proteins benefits the bacteria in intervening thrombin-catalyzed clot formation or 70
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 4 of 42
inhibiting complement activation essential for successful establishment in the host and impeding 71
innate defense system. In a recent study, a protein annotated as ErpY-like (LIC11966) in 72
Leptospira has been demonstrated to be Fg-binding protein with diagnostic and subunit vaccine 73
potential (17-19). The ErpY protein annotation originated from outer surface protein E/F- related 74
proteins of another pathogenic spirochete, Borrelia burgdorferi (20). In the genus Borrelia, erp 75
genes have been subdivided into three distinct gene families as ospE, ospF, and elp group where 76
ErpY belongs to OspF protein family (21). These erp genes possess well-conserved leader 77
polypeptide sequences and encode highly charged lipoprotein (high number of lysine and 78
glutamate residues) localized to the bacterial outer surface (22).The first description of 79
LIC11966 as ErpY-like lipoprotein of Leptospira (17) was given due to its 26% sequence 80
identity with ErpY of B. burgdorferi. The ErpY-like protein with no known function is 81
conserved among pathogenic Leptospira spp., with up to 99% pairwise sequence identity. The 82
evaluation of recombinant ErpY-like protein as a diagnostic antigen for leptospirosis has been 83
not done extensively in bovines and canines till date. Moreover, being a conserved protein 84
exclusively in pathogenic Leptospira, it may be associated with virulence. The present study 85
deals with the characterization of a putative ErpY-like lipoprotein of Leptospira interrogans 86
emphasizing its sub-cellular location, diagnostic importance, and virulence activity. 87
88
Materials and Methods 89
Bacterial strains, culture media, and serum samples 90
The pathogenic Leptospira reference strains (L. interrogans serovar Copenhageni strain Fiocruz 91
L1-130, L. interrogans serovar Lai strain Lai and L. interrogans serovar Canicola strain Hond 92
Utrecht IV) and a non-pathogenic Leptospira strain (L. biflexa serovar Patoc strain Patoc 1) were 93
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 5 of 42
grown as described before (23). Serum samples positive (+) /negative (_) for leptospirosis in a 94
diverse host (human, bovine and canine) by microscopic agglutination test (MAT) were obtained 95
from the Indian Council of Agricultural Research-National Institute of Veterinary Epidemiology 96
and Disease Informatics (ICAR-NIVEDI), Bengaluru, Karnataka, India. The serum samples were 97
screened for MAT using the methodology described before (23). The Escherichia coli strains 98
DH5α or BL21 (DE3) were grown at 37 °C in Luria-Bertani (LB) broth medium (HiMedia 99
#M1245) or LB agar (HiMedia #M1151) with or without ampicillin (SRL #61314) or kanamycin 100
(SRL #99311) at a concentration of 100 μg mL−1
for gene cloning and protein expression studies. 101
In silico analysis of protein 102
The LIC11966/ErpY-like (new locus tag; LIC_RS10040) is annotated as a hypothetical protein 103
of L. interrogans serovar Copenhageni by NCBI (National Center for Biotechnology 104
Information) database. The amino acid sequence of the ErpY-like protein was retrieved using its 105
reference sequence ID (WP_000716642.1) from the NCBI protein database and was analyzed to 106
identify the signal peptide as reported previously (24). NCBI protein BLAST (Basic Local 107
Alignment Search Tool) was used to identify orthologs of ErpY-like among Leptospira species. 108
Phylogenetic analysis of Leptospira was performed based on ErpY-like protein as described 109
previously (23). Analysis of theoretical secondary structures of the recombinant protein was 110
performed using a web server PSIPRED version 3.3 (25). 111
Cloning, protein overexpression, purification, and polyclonal antibody generation 112
Genomic DNA (gDNA) was isolated from Leptospira as described previously in our laboratory 113
(23). All the enzymes used for DNA manipulations were purchased from New England Biolabs 114
or Thermo Fisher Scientific. The coding sequence (CDS) of the erpY-like gene without its signal 115
peptide encoding sequence was PCR-amplified (414 bp) from gDNA using gene-specific 116
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 6 of 42
primers, erpY-like forward: 5’CTAGCTAGCTGCAAACAAGATCCAGTAGAT’(NheI) and 117
reverse: 5’CCGCTCGAGTTATTGAGAAGCGTATTCTTTC3’ (XhoI). The pTZ57R/T plasmid 118
construct (Thermo Fisher Scientific #K1214) was used to facilitate the erpY-like gene cloning 119
into a pET28a expression vector (Novagen #69864). The sequencing of the cloned DNA insert in 120
pET28a was done from Eurofins Genomics India Pvt Ltd, Bengaluru, India. Induction of 121
expression and purification of the recombinant ErpY-like (rErpY-like; 17.8 kDa) protein in E. 122
coli BL21 (DE3) strain was done as described previously (26). Similarly, the recombinant 123
LIC10191/Loa22 (rLoa22) used in this study was purified as described elsewhere (27). Female 124
BALB/c mice (n=5) of 4-6 week old were immunized with recombinant protein for the 125
generation of specific polyclonal antibodies as described before (23). The immunization 126
experiments were performed at the department of microbiology, College of Veterinary Science, 127
Assam Agricultural University, Guwahati, India, after approval by the Institutional Animal 128
Ethics Committee (approval no.770/ac/CPCSEA/FVSC/AAU/IAEC/13-14). The antibodies 129
against OmpL54, LipL31, and LipL32 raised in rabbits were obtained as a generous gift from Dr. 130
David Haake (Division of Infectious Diseases, California, USA). 131
Circular dichroism spectroscopy 132
A circular dichroism (CD) spectropolarimeter (model J-815 from JASCO, Japan) was used to 133
measure the molar ellipticity (Ф) of rErpY-like protein in terms of degrees cm2 dmol
−1 as 134
described previously in our laboratory (23). 135
Chemical cross-linking of rErpY-like protein of Leptospira 136
Purified rErpY-like protein (4 μg per reaction) was cross-linked with glutaraldehyde solution 137
(0.1%) in a cross-linking buffer (50 mM phosphate buffer, 100 mM KCl, 5 mM MgCl2, 5% 138
glycerol; pH 7.6) at room temperature. The reactions were terminated at various time intervals 139
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 7 of 42
(0-45 min), resolved on 12% SDS-PAGE with or without adding reducing agent dithiothreitol 140
(DTT) and visualized by Coomassie Blue staining as described previously (28) 141
Native polyacrylamide gel electrophoresis (Native-PAGE) of rErpY-like protein 142
Various amounts of pure rErpY-like protein (0.5-2 μg) were mixed with 3X native sample buffer 143
(240 mM Tris-HCl, 30% glycerol, 0.03% bromophenol blue; pH 6.8). The rErpY-like protein 144
subunits assembly was analyzed on a 4-20% gradient gel (Bio-Rad MiniProtean, catalog no. 456-145
1096) after resolving for 2 h at 120 V. The resolved proteins in native gradient gel were 146
visualized with Coomassie-blue stain and the size was estimated with standard protein markers 147
(Invitrogen# 928387) of native-PAGE. 148
Dynamic Light Scattering (DLS) 149
Untreated or heat denatured (30 min, 100 °C) rErpY-like protein (0.5 μg μL-1
) after overnight 150
incubation at 4°C in a phosphate buffer (50 mM sodium phosphate buffer, pH 7.4) was used in 151
DLS experiment to record the scattering as described previously (28). A total of thirty 152
autocorrelation functions were recorded for each of the protein samples, and intensity-weighted 153
hydrodynamic diameters were determined. The profile corresponding to average sizes is reported 154
and discussed. The hydrodynamic diameter and molecular weight of rErpY-like protein were 155
generated assuming a globular conformation model using the Malvern Zetasizer software. 156
Field Emission Transmission electron microscopy 157
The rErpY-like protein sample (5 μL of 40 ng μL-1
) was drop-casted on a UV-irradiated carbon-158
coated grid (Agar scientific #AGS147-4H), adsorbed, stained with Uranyl acetate solution for 159
field emission transmission electron microscopy (FETEM, JEOL-JEM-2100F) as described 160
previously (29). Images were acquired at an instrumental magnification of 40,000X and 200 161
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 8 of 42
keV. Selective particles of the image were enlarged using MS-Office image viewer tool for 162
clarity. 163
Triton X-114 extraction and phase partitioning of membrane proteins 164
A viable culture of L. interrogans serovar Copenhageni (5×109 cells) in mid-log phase (7-day-165
old) was harvested, washed with PBS, and subjected to detergent (Triton X-114) extraction and 166
phase-partitioning as described previously in our laboratory (23). Briefly, the whole lysates and 167
the phase partitioned fractions were resolved on SDS-polyacrylamide gel and then subjected for 168
immunoblot analyses using anti-ErpY-like (1:1000) or anti-LipL32 (1:5000) or anti-LipL31 169
(1:2000) antibodies. 170
Immunoblot assays 171
The spirochete whole cell lysate, detergent mediated phase-partitioned fraction, and the 172
recombinant proteins (rErpY-like and rLoa22) were immunoblotted as described before in our 173
laboratory (23). The membranes were probed for 2 h at room temperature with specific 174
polyclonal antisera (anti-ErpY-like at 1:1000; anti-Loa22 at 1:1000; anti-LipL32 at 1:5000; anti-175
LipL31 at 1:2000) as primary antibodies against the recombinant proteins or with the pooled sera 176
(1:400) of respective host (human/bovine/canine) testing MAT-positive/negative for 177
leptospirosis. The horseradish peroxidase (HRP) -conjugated secondary antibodies (goat anti-178
mouse IgG/goat anti-rabbit IgG/goat anti-human IgG/rabbit anti-bovine IgG/rabbit anti-dog IgG) 179
was used (1:5000) to probe bound primary antibodies. 180
Protease-accessibility assay 181
A viable culture of L. interrogans serovar Copenhageni (2.5×109 cells) in mid-log phase was 182
harvested, washed, and re-suspended in 5 mL of PBS. Each 1 mL suspension of live leptospires 183
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 9 of 42
(5×108
cells) was incubated with 5 μg of proteinase K (PK, SRL #36331) for 0, 1, 3 or 5 h before 184
the inhibition of PK activity by 1 mM phenylmethylsulfonyl fluoride (PMSF; HiMedia 185
#RM1592) as described previously in our laboratory (23). The bound bacteria in the microtiter 186
plate were probed individually with anti-OmpL54 (1:50), anti-ErpY-like (1:1000) or anti-LipL31 187
(1:1000) antibodies. The HRP-conjugated secondary antibodies (anti-mouse/anti-rabbit; 1:5000) 188
were added to detect bound primary antibodies. The absorbance obtained were analyzed and 189
plotted, as described before (23). 190
Binding of recombinant protein to host ligands 191
Binding of the rErpY-like protein to the host ligands, ECM or plasma components were analyzed 192
by indirect ELISA (enzyme-linked immunosorbent assay) as described previously (23). The 193
ECM components selected in this study are laminin (Sigma #L2020), collagen type-I (Sigma 194
#C9791 and Merck #08-115), chondroitin sulfate A & B (Sigma #C9819 & C3788), elastin 195
(Sigma #E1625), hyaluronic acid (Sigma #H7630) and heparan sulfate (Sigma #H7640). The 196
host plasma components used in this study are fibronectin (Sigma #F4759), fibrinogen (Fg, 197
Sigma #F3879), plasminogen (Sigma #P7999), complement factor H (CFH, Sigma #C5813) and 198
complement factor I (CFI, Sigma #C5938). Additionally, glycoprotein fetuin (New England 199
Biolabs #P6042) and bovine serum albumin fraction V (BSA, SRL #97350) are included as 200
control ligands. Briefly, 1 µg of each host ligand in PBS were coated and then each well was 201
blocked with BSA. The recombinant proteins (rErpY-like and rLoa22) was added individually in 202
each ligand coated well, and the binding was determined by specific primary (anti-ErpY-203
like/anti-Loa22 antibody) and secondary antibody (anti-mouse or anti-rabbit antibody). 204
Serological assay using sera testing MAT-positive or negative for leptospirosis 205
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 10 of 42
The sera testing MAT-positive+ / negative
− for leptospirosis (human: n=50
+/20
−; bovine: 206
n=50+/20
−; canine: n=18
+/11
−) was used to check its immunoglobulins reactivity to recombinant 207
antigens (rErpY-like and rLoa22; 400 ng each) on microtitre plate by ELISA. The percent 208
sensitivity and specificity of the assay were calculated as described previously (23). The 209
absorbance of MAT-negative serum samples of each host group for each antigen was used as a 210
control in ELISA to calculate the background cut-off value (mean+2SDs). 211
Dose-response curve of rErpY-like protein binding to fibrinogen 212
The rErpY-like protein in increasing concentrations (0.05-5 µM) was added individually into Fg-213
coated microtitre wells and was probed with specific primary and secondary antibody as 214
described in the ‘binding of recombinant protein to host ligands’ section. The obtained ELISA 215
data were plotted in the ‘OriginLab’ software to calculate the dissociation constant (KD) through 216
fitted Michaelis–Menten curve. Similarly, increasing concentrations (0.25-5 μM) of rErpY-like 217
protein (control) or its heat-denatured form (95 °C, 10 min) was used to measure the effect of 218
heat denaturation of rErpY-like protein in binding to human fibrinogen. 219
Antibody inhibition assay 220
A microtiter plate was coated with Fg and blocked with BSA. The rErpY-like protein (1 µg) was 221
pre-incubated with specific anti-ErpY-like antibody or non-specific anti-Loa22 antibody (1:100) 222
in PBS-T (0.05%) for 1 h, as described previously (13). The pre-incubated antibody-blocked 223
rErpY-like protein (1 µg) complex and the pure rErpY-like protein (1 µg) were added 224
independently into Fg-coated wells in triplicates and incubated for 2 h. After washing, the wells 225
were probed with monoclonal anti-his antibody (1:1000) (Merck #05-949). Further analysis of 226
protein interaction to the Fg was performed as described in the ‘binding of recombinant protein 227
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 11 of 42
to host ligands’ section. The obtained ELISA data of antibody inhibition assay were plotted in 228
relative percentage presuming the binding of the pure rErpY-like protein to Fg as 100%. 229
Inhibition of live leptospires adherence to fibrinogen in the presence of rErpY-like protein 230
Increasing concentrations of rErpY-like protein (0.05-5 µM) were added separately in triplicates 231
into Fg-coated wells. After three times of washings, live L. interrogans serovar Copenhageni 232
(4×107) were incubated into each well for 90 min. Each well was washed with PBS-T (0.05%) 233
before the addition of anti-Loa22 antibody (1:1000). After 2 h of incubation, secondary antibody 234
(1:5000) was used to detect inhibition of leptospires binding as described before in our lab (23). 235
Fibrin clot inhibition assay 236
Inhibition of thrombin-catalyzed fibrin clot formation from Fg in the presence of recombinant 237
proteins of Leptospira was performed as described previously (13). Briefly, increasing 238
concentrations of rErpY-like protein (0.05-5 µM) and a single highest concentration of rLoa22 (5 239
µM) were added independently to a soluble Fg (1 mg mL−1
) in PBS (300 µL). An aliquot (90 240
µL) of these complex solutions were added onto a microtiter plate in triplicates. Thrombin (0.1 241
units/10 µL) (Merck # 69671-3) was added to each well, and in every 2 min, the absorbance (595 242
nm) was recorded for 40 min at 25 °C. A graph of absorbance (595 nm) vs time (min) was 243
plotted in the ‘OriginLab’ software. The relative percentage of fibrin clot formation in the 244
presence of rErpY-like protein was calculated presuming the absorbance obtained in the positive 245
control of the assay to be 100%. 246
Far-Western blot 247
The whole-cell lysate of L. interrogans serovar Copenhageni, the recombinant proteins (rErpY-248
like protein & rLoa22: 1 µg each) and CFH (1 µg) were subjected to SDS-polyacrylamide gel 249
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 12 of 42
electrophoresis (12%) and far-Western blotting. The electroblotted membrane was overlaid with 250
10% human plasma (Sigma #P9523), as a source of CFH or 100 ng/µl of recombinant protein, 251
for 90 min after blocking with 5% nonfat dry milk for 2 h and was subsequently probed with 252
specific primary antibody (1:1000) of human CFH (anti-CFH antibody, Sigma # SAB1401172) 253
or anti-ErpY-like/Loa22 (1:1000) antibodies and the HRP-conjugated secondary IgG (1:5000). 254
Statistical analysis 255
All data point in graphs is representative of the mean±SD. Two-tailed Student’s paired t-test was 256
used to determine the significance of the differences between the mean. The P values between 257
0.05-0.01 (*), 0.001-0.01 (**) and less than 0.0001 (***) were considered to be statistically 258
significant, very significant, and extremely significant, respectively. Two independent 259
experiments were performed, each one in duplicate or triplicate as described. Statistical 260
agreement between the ELISA and MAT tests was determined using Cohen’s kappa coefficient 261
as described previously (23) 262
RESULTS 263
In silico analysis of LIC11966/ErpY-like protein 264
Bioinformatics analysis of LIC11966 using the SignalP 5.0 program (30) predicted a signal 265
peptide with the cleavage site between the 22nd
and 23rd
residues at the N-terminus. Also, the 266
amino acid sequence of LIC11966 (159 residues) was analyzed manually to identify its signal 267
peptide with the criteria set for spirochetal lipoproteins (31). The signal peptide cleavage site in 268
LIC11966 lipoprotein by signal peptidase (Lsp) was consistent with the findings predicted 269
through SignalP 5.0 program. The signal peptide (22 residues) of LIC11966 fulfills all the 270
criteria set for spirochete protein to be categorized as a lipoprotein. The PSORT program (32), 271
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 13 of 42
predicted LIC11966 to be localized more towards periplasmic region than the outer membrane of 272
Leptospira. The orthologs of LIC11966 were found to be highly conserved among the serovars 273
of L. interrogans with 99-100% sequence identity on BLAST search analysis. The phylogenetic 274
tree constructed using the 14 representative leptospiral LIC11966 orthologs shows a high level of 275
sequence conservation among pathogenic spp. of Leptospira and with the lowest sequence 276
identity of 57% (Table 1, Fig. 1). 277
ErpY-like protein is encoded exclusively in pathogenic Leptospira genome and is a 278
predominant outer membrane surface-exposed protein 279
Immunoblot assay using anti-ErpY-like antibody specifically detected the native ErpY-like 280
protein (~15 kDa) in the lysates (1×109 cells) of pathogenic L. interrogans serovars 281
(Copenhageni, Lai and Canicola) (Fig. 2A). However, there was no detection of native ErpY-like 282
protein in the lysate (1×109 cells) of non-pathogenic L. biflexa serovar Patoc. Immunoblot assay 283
detected the rErpY-like (~18 kDa) protein at relatively larger molecular size than the native 284
ErpY-like (~15 kDa) protein due to the presence of an additional N-terminal vector fusion of 2.5 285
kDa in recombinant protein (Fig. 2A). These results suggest that the in vitro-cultured Leptospira 286
(IVCL) expresses the native ErpY-like protein and share a common immunogenic epitope with 287
the recombinant protein. 288
To determine the ErpY-like protein subcellular location, 289
detergent extraction and phase partition of L. interrogans serovar Copenhageni was performed 290
using Triton X-114. Immunoblot assay of the phase-partitioned fractions of Leptospira detected 291
the ErpY-like protein predominantly in the hydrophobic detergent phase, advocating the ErpY-292
like protein to be an outer membrane protein (Fig. 2B). To validate the subcellular localization 293
experiment in Leptospira using Triton X-114, a known LipL32 and LipL31 protein, located in 294
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 14 of 42
the outer (23) and cytoplasmic membrane (33) respectively, was probed with its specific 295
antibodies in the phase-partitioned fraction. Besides, the assessment of ErpY-like protein as a 296
surface-exposed protein of Leptospira was executed by protease accessibility assay using 297
proteinase K treatment at different time intervals on live spirochetes. At a range of 1-5 h of 298
proteinase treatment on live spirochetes, a gradual decrease in the absorbance for detection of 299
ErpY-like protein in the ELISA suggested it to be a surface-exposed protein of Leptospira (Fig. 300
2C). Moreover, a known leptospiral surface-exposed protein OmpL54 and a cytoplasmic-301
membrane protein LipL31 (34) were used as controls to validate the protease accessibility assay 302
in Leptospira. During the various intervals of proteinase treatment on leptospires, an 303
insignificant change in the serological detection of LipL31 dictates that the cellular integrity of 304
Leptospira inner membrane was uncompromised (Fig. 2C). On the other hand, the reduction in 305
absorbance for detecting OmpL54 post-proteinase treatment validates the quality of protease 306
accessibility assay performed in this study and agrees to elsewhere (34). 307
Recognition of rErpY-like protein by serum obtained during natural Leptospira infection 308
The naturally infected hosts of Leptospira were evaluated for its ability to recognize rErpY-like 309
protein as an antigen. Indirect ELISA was conducted for comparing the recognition of rErpY-310
like antigen with the serum of broad host range (human, bovine, and canine) that tested positive 311
for leptospirosis by the MAT. As a control, serum samples that tested negative for leptospirosis 312
by the MAT of each host (humans, bovine, and canines) were included for assessment of 313
recognition of rErpY-like antigen. Besides, antigen rLoa22, a known serological diagnostic 314
candidate of Leptospira (35), was added to validate the MAT results and compare the 315
sensitivity/specificity of rErpY-like protein as a potential antigen. To further substantiate our 316
assessment, immunoblots were performed with the pooled serum samples of the host 317
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 15 of 42
(human/bovine/canine) tested positive or negative for leptospirosis by MAT. The calculated 318
sensitivity and specificity of the indirect ELISA to recognize antigens (rErpY-like and rLoa22) 319
with human serum were 100% (Fig. 3A and Fig. 3B). However, the measured cut-off value of 320
absorbance for detecting rErpY-like antigen (0.29) was lower than rLoa22 (0.49) in humans 321
naturally infected with Leptospira (Table 2). On the same note, immunoblots performed with 322
MAT-positive pooled serum of human could remarkably detect rLoa22 and rErpY-like antigens 323
in comparison to MAT-negative pooled serum for leptospirosis (Fig. 3C). It is now well 324
established that Leptospira has a wide host range where it can sustain itself, and these hosts 325
respond immunologically in diverse ways during leptospirosis; therefore, it was interesting to 326
evaluate the reactivity of immunoglobulins from sera of infected hosts to rErpY-like protein. 327
Under the similar experimental condition, immunoassay was performed with the serum samples 328
of bovine tested positive or negative for leptospirosis by MAT. In the same trend to that of 329
human serum for detecting antigens (rErpY-like and rLoa22) in this study, the bovine 330
leptospirosis serum also scored 100 percent of sensitivity and specificity (Fig. 3D and Fig. 3E). 331
In agreement with the ELISA results, immunoblot performed with the pooled bovine serum 332
(MAT-positive) detected rLoa22 and rErpY-like antigen (Fig. 3F). The serum samples 333
displaying MAT-positive for leptospirosis in canines also detected antigens (rErpY-like and 334
rLoa22) with each specificity and sensitivity of 100% (Fig. 3G and Fig. 3H). Among the tested 335
serum of various host in this study, canine serum used for serological detection of leptospirosis 336
demonstrated the lowest cut-off to detect both rErpY-like antigen (0.17) and rLoa22 (0.30) 337
(Table 2). Nevertheless, immunoblot with canines serum samples (MAT-positive) could detect 338
rLoa22 and rErpY-like antigen at an adequate level in comparison to MAT-negative serum 339
samples (Fig. 3I). The obtained data for detecting rErpY-like antigen by ELISA were compared 340
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 16 of 42
with those for the MAT using Cohen’s kappa coefficient value. The calculated kappa value 341
(kappa 1.0; 95% CI) for detecting leptospirosis in the serum samples of the different host 342
(human, bovine, and canine) interpreted a “very good” strength of agreement. 343
Interaction of rErpY-like protein to host ECM and plasma components 344
Several leptospiral surface proteins have been established to mediate pathogen colonization and 345
dissemination in host tissues by adhering to extracellular matrix (ECM) proteins (13, 36). 346
Moreover, Leptospira binding to host-specific plasma component through its surface-exposed 347
membrane proteins may cause an imbalance in the physiological process like blood coagulation 348
and complement activation cascade in the host (37). Before attempting to understand the role of 349
ErpY-like protein as an outer membrane protein of Leptospira, we first evaluated the secondary 350
structure integrity of rErpY-like protein by circular dichroism (CD) spectroscopy (Fig. 4A). The 351
obtained experimental CD spectra data for rErpY-like protein using the K2D2 program (38) 352
predicted 87.6% α-helix and 0.5% β-strand. The secondary structure prediction for native ErpY-353
like protein using the PSIPRED program (39, 40) was close to the experimental CD data, 354
indicating its suitability for downstream biochemical studies. Using ELISA, we evaluated the 355
binding capability of rErpY-like protein to a spectrum of host ECM and plasma components. 356
Among all the host ligands (laminin, fibronectin, collagen type I, chondroitin sulphate A and B, 357
hyaluronic acid, heparan sulphate, elastin, fibrinogen, plasminogen, factor H and factor I) 358
examined for interaction with rErpY-like protein using ELISA, a higher absorbance for binding 359
to Fg, complement Factor H (CFH), and factor I (CFI) was evident (Fig. 4B). This binding study 360
of rErpY-like protein to ECM leads us to hypothesize that during natural Leptospira infection 361
ErpY-like protein might play a moonlighting role in disrupting blood coagulation process and 362
evading complement-mediated lysis of Leptospira. 363
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 17 of 42
Interestingly, the binding of the rErpY-like protein to another plasma component like 364
plasminogen was statistically insignificant in comparison to ligands fetuin and BSA (negative 365
control) (Fig. 4B). Moreover, a negative control protein, rLoa22 used in the assay showed 366
moderate binding with all the examined ECM and plasma components of the host (Fig. 4B) and 367
agrees to an earlier report (41). The moderate binding of rLoa22 to ECM components validates 368
the experimental procedures and the quality of ligands used in this assay. Binding of the rErpY-369
like protein to host plasma components like CFH/I and Fg prompted us to evaluate if rErpY-like 370
tends to undergo supramolecular assembly. To determine the self-assembly property of rErpY-371
like, the purified recombinant protein was resolved on native-PAGE and stained with 372
Coomassie-blue. In native-PAGE gel, the proteins migrate not only according to their size but 373
also to their shape and hydrodynamic properties and therefore may not represent the actual size 374
of protein. The apparent molecular weight of rErpY-like protein resolved on native-PAGE was 375
found to be around 300 kDa (Fig. 4C). The ability of the rErpY-like protein to form 376
supramolecule, as evident by native-PAGE image, encouraged us to find if chemical cross-377
linking with glutaraldehyde could detect the transient assembly of rErpY-like protein subunits on 378
denaturing polyacrylamide gel. As expected, multiple transient bands of cross-linked rErpY-like 379
protein corresponding to 1-, 2-, 4-, and 8-mers were evident on SDS-PAGE stained with 380
Coomassie-blue until 45 min of cross-linking reaction (Fig. 4D). In contrast, cross-linked 381
product of two control proteins β-casein and a recombinant protein LIC13341 of Leptospira, 382
previously studied in our laboratory (23), show only one transient cross linked band (Fig. 4D, 383
right panel). Among all the multiple bands visualized, 2-mer band of rErpY-like protein 384
appeared in majority when resolved in the absence of reducing agent, dithiothreitol (DTT). We 385
further looked into the hydrodynamic size of the supramolecule rErpY-like protein by dynamic 386
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 18 of 42
light scattering as the 12 % SDS-PAGE cannot resolve the cross-linked product of more than 387
170-200 kDa. 388
Dynamic light scattering and field emission transmission electron microscopy of rErpY-like 389
protein 390
Dynamic light scattering (DLS) was performed to determine the size distribution profile of the 391
purified rErpY-like oligomeric protein or its heat-denatured form in solution. The size 392
distribution profile of purified rErpY-like protein using DLS demonstrated a homogenous 393
distribution of single major population species of mean hydrodynamic diameter (DH) 394
10.88±5.18 nm and with an estimated molecular weight of 177±84.3 kDa (Table 3). On the other 395
hand, the heat-denatured rErpY-like protein demonstrated a heterogeneous size distribution, 396
composed of a significant population with DH of 163.6±57.92 nm and a minor population with 397
mean DH of 6.94±1.03 nm. Such a shift in size distribution profile of heat-denatured rErpY-like 398
protein suggests rErpY-like protein has aggregated, whereas, the pure rErpY-like protein in 399
solution tends to form a supramolecule with homogenous size distribution (Fig. 5A). The values 400
of particle polydispersity, polydispersity index, count rate, volume & intensity % and estimated 401
MW (molecular weight) of major peaks of rErpY-like protein have been shown (Table 3). The 402
supramolecule rErpY-like protein topography was also imaged using FETEM. Negative stain 403
FETEM image of r-ErpY-like supramolecule demonstrate the homogenous distribution of the 404
particles with identical spherical shape and size (~20 nm diameter) throughout the grid (Fig 5B). 405
Characterization of rErpY-like protein interaction to human fibrinogen 406
The optimal binding of the rErpY-like protein to human Fg was evaluated on a quantitative basis 407
through indirect ELISA. A dose-dependent and saturable binding curve were obtained when 408
increasing concentration of the rErpY-like protein (0-5 µM) was allowed to bind to a fixed 409
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 19 of 42
amount of human Fg (1 µg) onto a microtitre plate. The rErpY-like protein binding to Fg ligand 410
achieved saturation at 5 µM concentration of recombinant protein, demonstrating the interaction 411
to be specific (Fig. 6A). The value of calculated dissociation constant (KD) of rErpY-like protein 412
binding to ligand Fg was 70.45±4.13 nM (Fig. 6A). To address, if the structural epitopes of 413
rErpY-like protein were critical for the binding to Fg, the recombinant protein was heat-414
denatured for 10 min at 95 °C prior it's binding to the ligand. Severe reduction in binding of the 415
heat-denatured rErpY-like protein at a different concentration to Fg was observed in contrast to 416
the structurally intact rErpY-like protein (Fig. 6B). The binding assay of the structurally intact or 417
heat-denatured rErpY-like protein to Fg along with the DLS data suggest that ligand binding are 418
dependent on both, structural conformation and assembly of supramolecule subunits of 419
recombinant protein. Also, the role of immunogenic epitopes of rErpY-like protein to interact 420
with host Fg was assessed by allowing the rErpY-like protein to bind with its specific 421
immunoglobulins (serum-containing anti-rErpY-like) before determining the binding reaction to 422
Fg. The specific immunoglobulins inhibited (51%) the interaction of rErpY-like protein to ligand 423
Fg in comparison to the control where no serum was used (Fig. 6C). The serum anti-Loa22 424
utilized as a source of non-specific antibody demonstrated insignificant inhibition (5%) of 425
rErpY-like protein binding to the Fg (Fig. 6C), suggesting that immunogenic epitopes of rErpY-426
like protein are essential in the binding to Fg. 427
It was interesting to evaluate the effect of rErpY-like protein on adherence of live Leptospira, 428
expressing the native ErpY-like surface protein, to Fg. Indirect ELISA quantified the impact of 429
the presence of rErpY-like protein on adherence of leptospires to Fg. Live leptospires were 430
allowed to competitively adhere to Fg pre-incubated with different concentrations of rErpY-like 431
protein (0-5 µM). Fibrinogen bound leptospires were quantified using antiserum against Loa22, a 432
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 20 of 42
predominant surface-exposed leptospiral membrane protein (42). A dose-dependent reduction in 433
the number of leptospires adhering to Fg pre-incubated with increasing rErpY-like protein 434
concentration indicates specific interaction of ErpY-like protein to the Fg. It turned out to be that 435
only 53% of leptospires could bind to Fg in the presence of saturable binding concentration (5 436
µM) of the rErpY-like protein (Fig. 6D). 437
Inhibition of fibrin clot formation catalyzed by thrombin 438
The binding ability of the rErpY-like protein to plasma component Fg prompted us to address 439
whether the presence of rErpY-like protein can interfere in the thrombin-catalyzed conversion of 440
soluble fibrinogen into insoluble fibrin, a physiological reaction essential for initiating blood clot 441
formation. The enzymatic conversion of soluble fibrinogen into insoluble fibrin can be detected 442
by measuring the increase in absorbance (595 nm). Therefore, the kinetics of fibrin formation 443
from fibrinogen, catalyzed by thrombin in the presence or absence of increasing concentration 444
(0-5 µM) of rErpY-like protein was measured (Fig. 7A). The thrombin-catalyzed clot formation 445
in the absence of rErpY demonstrated the maximal clotting (100%; positive control), whereas the 446
fibrinogen clot reaction with no added thrombin showed a lack of any measurable clotting 447
(negative control). The rLoa22, a known protein of Leptospira with a moderate binding ability to 448
Fg, was used as another control in the thrombin-catalyzed clot formation. The kinetics of clot 449
formation in the presence of rLoa22 (5 µM) was similar to the positive control of the assay (Fig. 450
7A). On the other hand, the kinetics of clot formation regularly decreased (47-7%) in the 451
presence of an increasing concentration of rErpY (0.05-5 µM) (Fig. 7B). 452
Leptospira rErpY-like protein is a complement factor H binding protein 453
It is a known fact that few pathogens can evade the host’s innate immune responses more 454
efficiently by the complement inactivation, thus being able to survive and enhance host 455
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 21 of 42
colonization. The alternative pathway of complement activation is an essential arm of vertebrate 456
innate immunity, which rapidly clears susceptible microorganisms from the host in the absence 457
of antibody (43). In this study, we observed that CFH and CFI show relatively higher interaction 458
to rErpY-like protein than plasminogen, another soluble plasma component. Interestingly, CFH 459
is a soluble glycoprotein present in normal plasma at a concentration of 0.3–0.5 mg mL-1
and is 460
also a cofactor for CFI, a serine protease of the alternative pathway of complement (43). 461
Therefore, it was interesting to find if the recombinant and the native ErpY-like protein of 462
Leptospira could bind to the CFH present in the normal human plasma. To address this, we 463
performed far-Western blotting of rErpY-like protein as bait proteins on nitrocellulose 464
membrane and human plasma (10%) as prey protein component. The rErpY-like protein (18 465
kDa) could bind to the CFH (prey protein) present in the human plasma overlay and when 466
probed with an anti-CFH antibody (Fig. 8A, bottom panel). In contrast, the same amount of 467
rLoa22 failed to bind CFH during the overlay experiment (Fig. 8A, bottom panel). Similarly, 468
human CFH was used as bait and rErpY-like as prey to identify the protein-ligand interaction 469
through far-Western blot. Human CFH was resolved on SDS-PAGE (Fig. 8B, top panel), 470
electroblotted and the membrane was overlaid with recombinant proteins. It was evident that 471
rErpY-like protein showed interaction with CFH (~150 kDa) (Fig. 8B, middle panel) whereas, an 472
equivalent amount of rLoa22 did not show any interaction with CFH (Fig. 8B, bottom panel). 473
The whole-cell lysate of L. interrogans serovar Copenhageni used as bait could bind to the CFH 474
component present in human plasma. Detection at an approximately 15 kDa in the far-Western 475
blot probably corresponds to the native ErpY-like protein of Leptospira (Fig. 8C, middle panel). 476
Additionally, two other Leptospira proteins (~50 and 30 kDa) were detected (Fig. 8C, middle 477
panel) and agreed to a previous report (44). Detection of the native protein in Leptospira lysate 478
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 22 of 42
using anti-ErpY-like antibody (Fig. 8C, right panel) indicates that the CFH bound protein 479
detected at approximately 15 kDa in far-Western blot (Fig. 8C, middle panel) is, in fact, the 480
ErpY-like protein of Leptospira. The binding of rErpY-like protein (18 kDa) to CFH by far-481
Western was in agreement with the binding ability of native ErpY-like protein (15 kDa) of 482
Leptospira. 483
484
DISCUSSION 485
To date, the role of ErpY-like protein in Leptospira pathogenesis is not known; however, it is a 486
potential vaccine and diagnostic candidate for leptospirosis in the specific host (18, 19). We 487
demonstrate that ErpY-like protein of Leptospira is a surface-exposed outer membrane 488
lipoprotein and its recombinant form of antigen can be implemented in serological diagnosis of 489
leptospirosis in humans, bovines, and canines. The serological diagnosis using rErpY-like 490
protein in this study is in agreement with the previous reports for detecting leptospirosis in 491
humans (17), swine (18), and rabbits (17). This serological study in reconciliation with the other 492
reports establishes the expression of ErpY-like protein during Leptospira natural infection 493
evokes an immune response in a broad host range, including bovines and canines. In this study, 494
we also compared the diagnostic potential of rErpY-like antigen with rLoa22, a known 495
diagnostic antigen. The diverse Leptospira host (humans, bovines, and canines) positive for 496
leptospirosis by MAT demonstrated superior serological reactivity with rLoa22 than rErpY-like 497
antigen in terms of the ELISA cut-off value. Nevertheless, the immunoblot performed on these 498
two antigens with the pooled sera of diverse host did not find any difference in serological 499
reactivity. 500
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 23 of 42
A study done on golden Syrian hamsters infected with L. interrogans serovar Pomona failed to 501
detect ErpY-like protein expression in the liver samples using immunofluorescence technique; in 502
contrast, human serum positive for leptospirosis showed reactivity to rErpY-like protein using 503
ELISA (17). Failure of polyclonal antibodies reactivity to ErpY-like antigen in hamster’s model 504
may be either due to the low expression of antigen in L. interrogans serovar Pomona or due to 505
the low immune response in hamster against ErpY-like protein. Moreover, the expression of 506
ErpY-like protein in L. interrogans serovar Pomona under in vitro growth has been reported to 507
be modulated by iron-limitation and the presence of serum (17). Interestingly, an attenuated 508
strain of L. interrogans serovar Manilae (M1352, defective in lipopolysaccharide biosynthesis) 509
immunized to hamsters conferred protection against leptospirosis and demonstrated serological 510
recognition of rLA1939 (ErpY-like protein ortholog) (45). In a follow up of a similar study, the 511
rErpY-like protein was shown to protect hamsters (62.5%) against mortality but not against 512
tissue lesions developed during laboratory-generated Leptospira infection (19). 513
Pathogenic species of Leptospira exclusively express the ErpY-like protein; hence, we speculate 514
it to be one of a virulence factor required during the pathogenesis of Leptospira. Biophysical 515
interaction studies reported earlier have demonstrated Erp proteins in spirochetes to bind with 516
host Fg and CFH (19, 22). Moreover, bacterial adhesion to host extracellular matrix (ECM) 517
components or plasma protein is assumed to be an indispensable step in the pathogenesis of 518
spirochete infection. In accordance, the ErpY protein of B. burgdorferi had been demonstrated as 519
a binding partner to factor H complement regulating protein from rodents, dogs, and cats (22). 520
The Leptospira ErpY-like protein, a predominant OMP, is having 26% identity to ErpY protein 521
of Borrelia. Therefore, we pursued to evaluate if the secondary structure of the recombinant 522
protein is retained in the purified rErpY-like protein before pursuing any interaction study with 523
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 24 of 42
host extracellular and plasma protein components. The CD spectra of rErpY-like protein 524
suggested the secondary structure of the purified protein is retained. The interaction of the 525
rErpY-like protein with the host ECM component was compared with the interaction of another 526
Leptospira protein (rLoa22) known to have a low/moderate binding property to ECM 527
components as described before in our laboratory (23). In this study, the binding assay of rErpY-528
like protein to host ECM or plasma component endorses it to facilitate Leptospira in adhesion. 529
Interestingly, the rErpY-like protein showed a higher preference for specific plasma proteins (Fg, 530
CFH, and CFI). Such host plasma protein components are known to form oligomeric structure 531
(46-48). This raised an interest to find if ErpY-like protein also undergoes supramolecular 532
assembly. Native gel electrophoresis, chemical cross-linking, DLS and TEM imaging of rErpY-533
like protein demonstrated the tendency of this protein to oligomerize in solution and further 534
comprehensive analysis of such protein structure is warranted. 535
The plasma component Fg plays a central role in coagulation and thrombosis in host blood. 536
Several important pathogens, including spirochetes, exploit host Fg through a diverse mechanism 537
to enhance its survival and colonization in the host (49-52). The Fg-binding protein also 538
contributes in increasing the virulence of pathogens during wound infection (53). In Leptospira, 539
till date, multiple Fg-binding proteins viz, LigA, LigB (16, 54), OmpL37 (55), rLIC12238 (56), 540
Lsa33, Lsa25 (57), Lsa30, OmpL1, rLIC11360 and rLIC11975 (13) with different binding 541
affinity to Fg have been established. Also, many of such recombinant proteins along with the live 542
virulent L. interrogans strains have been demonstrated to have a direct role in inhibiting 543
thrombin-catalyzed fibrin clot formation (13, 16, 54). Such a large repertoire of Fg-binding 544
proteins encoded in virulent Leptospira genome is discrete in nature. However, in this study, we 545
demonstrate the binding of the rErpY-like protein to Fg biochemically to be dose-dependent, 546
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 25 of 42
saturable, and specific in nature. The measured KD value (70.45±4.13 nM) of rErpY-like protein 547
to Fg demonstrated a stronger affinity relative to other reported Fg-binding proteins like 548
rLIC12238 and Lsa33 (733±277 to 128±90 nM) of Leptospira. Moreover, in the presence of 549
rErpY-like protein the thrombin-catalyzed fibrin clot formation from fibrinogen and the binding 550
of live L. interrogans to Fg get inhibited in a dose-dependent manner. Thus, Leptospira in 551
reconciliation with the other reports and, alike other pathogens, encode multiple Fg-binding 552
proteins (49, 58) including the rErpY-like protein that may enhance its survival, colonization, 553
and dissemination in the host during infection. 554
The activation of the alternative complement pathway in a host leads to C3b opsonization on the 555
surfaces of invading microbes that may result in bacterial destruction (59). However, such 556
complement activation is not deleterious to host cells due to the presence of regulatory CFH that 557
coats the host cell surface and either thwarts C3b opsonization on its cell surface or promote 558
degradation of bound C3b with the help of CFI. Inspired by the vertebrate host cell of self-559
defense from its complement-mediated killing, several pathogens including Leptospira have 560
evolved a mechanism of hijacking CFH to evade complement-mediated execution (37, 44, 60-561
63). It has been demonstrated that pathogenic Leptospira possesses the capacity to recruit and 562
bind not only the host CFH but also, factor H-like 1 (FHL-1), factor H-related 1 (FHR-1), and 563
C4b binding protein (C4BP) to avoid complement-mediated killing (9, 44, 64, 65). Till date, as 564
there is already established multiple OMPs of Leptospira that can adhere to complement 565
regulator FH, the precise contributory role of ErpY-like protein for alternative complement 566
system inactivation is further required to be evaluated. 567
In this study, we have identified a conserved immunogenic ErpY-like lipoprotein localized on 568
the outer membrane of pathogenic L. interrogans. The rErpY-like protein of Leptospira that 569
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 26 of 42
tends to form supramolecule structure can be serologically detected by antibodies present in the 570
serum of human, bovine, and canine infected naturally with Leptospira. Our experimental 571
analyses suggest rErpY-like protein interfere in fibrin clot formation and possibly in the evasion 572
of complement-mediated killing by binding to CFH and CFI. Further investigation on ErpY-like 573
protein may give its exact role in evading complement-mediated execution and inhibition of 574
blood clot during infection. Moreover, deciphering the structure of the rErpY-like protein as 575
supramolecule may provide a better insight into its molecular interaction with host plasma 576
components. The characterization of novel diagnostic rErpY-like protein as antigen for 577
diagnosing leptospirosis and its possible role as an adhesin to diverse host ECM component may 578
help in developing new strategies for disease intervention. 579
Acknowledgements 580
The authors gratefully acknowledge ICMR, Port Blair India for providing the Leptospira strains 581
and Dr Nitin Chaudhary, Department of Biosciences and Bioengineering (BSBE), Indian 582
Institute of Technology Guwahati (IIT Guwahati) for providing help in recording and analyzing 583
the DLS experiments. We appreciate the efforts made by Dr Shankar Prasad Kanaujia (BSBE) 584
for refining the manuscript. We acknowledge central instruments facility, IIT Guwahati for 585
electron microscopy. We would also like to thank the department of microbiology, College of 586
Veterinary Science, Guwahati, for generating polyclonal antibodies. 587
Funding 588
The present work was financially supported by the Department of Science and Technology 589
(DST), Science and Engineering Research Board (SERB) and ICMR Government of India, 590
bearing project number SERB/EMR/2015/000255 and Leptos/10/2013-ECD-I, respectively. 591
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 27 of 42
592
Conflict of interest statement: None declared 593
594
595
596
Table 1: Comparative analyses of the LIC11966/ErpY-like protein orthologs among 597
Leptospira species 598
Leptospira
species (serovar)
Query coverage
(%)
Sequence
identity
(%)
NCBI accession number
L. interrogans (Canicola) 100 100 OCC30350.1
L. interrogans (Lai) 100 99 NP_712120.1
L. interrogans (Linhai) 100 99 AJR14687.1
L. interrogans (Manilae) 100 99 EYU63405.1
L. interrogans (Bataviae) 100 99 OAM75663.1
L. interrogans (Pomona) 100 99 EMI70432.1
L. kirschneri 100 92 WP_004755938.1
L. noguchii 100 85 WP_002151500.1
L. mayottensis 100 79 WP_117340238.1
L. santarosai 100 78 WP_004476249.1
L. weilii 98 80 WP_002622075.1
L. alstonii 98 71 WP_020772825.1
L. kmetyi 98 57 WP_040912836.1
L. alexanderi 76 64 WP_078128751.1
599
600
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 28 of 42
601
602
603
Table 2: Measured ELISA data for the recognition of antigens (rErpY-like protein and 604
rLoa22) using sera of host (human, bovine, and canine) testing positive or negative for 605
leptospirosis by MAT 606
Host MAT-sera
(samples)
Recombinant-
proteins Mean OD±SD
Cut-off
(mean+2SDs)
Sensitivity
(%)
Specificity
(%)
Human
Positive
(n=50)
rErpY-like 0.3587±0.0230 _ 100 _
rLoa22 0.6339±0.0360 _ 100 _
Negative
(n=20)
rErpY-like 0.2268±0.0308 0.2883 _ 100
rLoa22 0.4478±0.0212 0.4903 _ 100
Bovine
Positive
(n=50)
rErpY-like 0.3684±0.0373 _ 100 _
rLoa22 0.6404±0.0194 _ 100 _
Negative
(n=20)
rErpY-like 0.2431±0.0236 0.2902 _ 100
rLoa22 0.4401±0.0223 0.4846 _ 100
Canine
Positive
(n=18)
rErpY-like 0.2497±0.0143 _ 100 _
rLoa22 0.4215±0.0191 _ 100 _
Negative
(n=11)
rErpY-like 0.1291±0.0198 0.1687 _ 100
rLoa22 0.2578±0.0207 0.2992 _ 100
607
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 29 of 42
608
609
610
Table 3: Dynamic light scattering data of r-ErpY-like protein 611
612
613
614
615
616
617
618
619
620
621
Sample
Particle
polydispersity
( Pd) in nm
Pd
index
Count rate
in
counts per
sec
(cps)
Volume %
(Mass %)
Intensity
% Est. MW (kDa)*
(Mean ± SD)
*[Major peak]
rErpY-like 5.348 0.282 2,32,700
99
89.7 177±84.3
Heat-
treated
rErpY-like
70.38 0.33 5,33,300
91.4
92.6 1.01x10
5±1.49x10
4
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 30 of 42
622
623
624
REFERENCES 625
1. Bharti, A. R., J. E. Nally, J. N. Ricaldi, M. A. Matthias, M. M. Diaz, M. A. Lovett, P. 626
N. Levett, R. H. Gilman, M. R. Willig, and E. Gotuzzo. 2003. Leptospirosis: a zoonotic 627
disease of global importance. The Lancet infectious diseases 3:757-771. 628
2. Costa, F., J. E. Hagan, J. Calcagno, M. Kane, P. Torgerson, M. S. Martinez-Silveira, 629
C. Stein, B. Abela-Ridder, and A. I. Ko. 2015. Global morbidity and mortality of leptospirosis: 630
a systematic review. PLoS Negl Trop Dis 9:e0003898. 631
3. Nicodemo, A. C., M. I. S. Duarte, V. A. Alves, C. F. Takakura, R. T. Santos, and E. 632
L. Nicodemo. 1997. Lung lesions in human leptospirosis: microscopic, immunohistochemical, 633
and ultrastructural features related to thrombocytopenia. The American journal of tropical 634
medicine and hygiene 56:181-187. 635
4. Marchiori, S. E., B. Netto, and W. Tavares. 1992. Pulmonary compromise in 636
leptospirosis. Revista da Sociedade Brasileira de Medicina Tropical 25:21-30. 637
5. Segura, E. R., C. A. Ganoza, K. Campos, J. N. Ricaldi, S. Torres, H. Silva, M. J. 638
Céspedes, M. A. Matthias, M. A. Swancutt, and R. L. Linán. 2005. Clinical spectrum of 639
pulmonary involvement in leptospirosis in a region of endemicity, with quantification of 640
leptospiral burden. Clinical infectious diseases 40:343-351. 641
6. Vieira, M. L., C. Naudin, M. Mörgelin, E. C. Romero, A. L. T. Nascimento, and H. 642
Herwald. 2016. Modulation of Hemostatic and Inflammatory Responses by Leptospira Spp. 643
PLoS neglected tropical diseases 10:e0004713. 644
7. Evangelista, K. V., and J. Coburn. 2010. Leptospira as an emerging pathogen: a review 645
of its biology, pathogenesis and host immune responses. Future microbiology 5:1413-1425. 646
8. Evangelista, K. V., B. Hahn, E. A. Wunder Jr, A. I. Ko, D. A. Haake, and J. Coburn. 647
2014. Identification of cell-binding adhesins of Leptospira interrogans. PLoS neglected tropical 648
diseases 8:e3215. 649
9. Castiblanco-Valencia, M. M., T. R. Fraga, L. B. d. Silva, D. Monaris, P. A. E. Abreu, 650
S. Strobel, M. Józsi, L. Isaac, and A. S. Barbosa. 2012. Leptospiral immunoglobulin-like 651
proteins interact with human complement regulators factor H, FHL-1, FHR-1, and C4BP. Journal 652
of Infectious Diseases 205:995-1004. 653
10. Cavenague, M. F., A. F. Teixeira, S. Antonio Filho, G. O. Souza, S. A. Vasconcellos, 654
M. B. Heinemann, and A. L. Nascimento. 2019. Characterization of a novel protein of 655
Leptospira interrogans exhibiting plasminogen, vitronectin and complement binding properties. 656
International Journal of Medical Microbiology. 657
11. Santos, J. V., P. R. Pereira, L. G. Fernandes, G. H. Siqueira, G. O. de Souza, A. 658
Souza Filho, S. A. Vasconcellos, M. B. Heinemann, E. G. Chapola, and A. L. Nascimento. 659 2018. Binding of human plasminogen by the lipoprotein LipL46 of Leptospira interrogans. 660
Molecular and cellular probes 37:12-21. 661
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 31 of 42
12. Lo, M., G. L. Murray, C. A. Khoo, D. A. Haake, R. L. Zuerner, and B. Adler. 2010. 662
Transcriptional response of Leptospira interrogans to iron limitation and characterization of a 663
PerR homolog. Infection and immunity 78:4850-4859. 664
13. Oliveira, R., R. F. Domingos, G. H. Siqueira, L. G. Fernandes, N. M. Souza, M. L. 665
Vieira, Z. M. de Morais, S. A. Vasconcellos, and A. L. Nascimento. 2013. Adhesins of 666
Leptospira interrogans mediate the interaction to fibrinogen and inhibit fibrin clot formation in 667
vitro. PLoS neglected tropical diseases 7:e2396. 668
14. Picardeau, M. 2015. Genomics, proteomics, and genetics of leptospira, p. 43-63. 669
Leptospira and Leptospirosis. Springer. 670
15. Siqueira, G. H., A. F. Teixeira, L. G. Fernandes, G. O. de Souza, K. Kirchgatter, E. 671
C. Romero, S. A. Vasconcellos, M. L. Vieira, and A. L. T. Nascimento. 2015. The 672
recombinant LIC10508 is a plasma fibronectin, plasminogen, fibrinogen and C4BP-binding 673
protein of Leptospira interrogans. Fems Pathogens and Disease 74:ftv118. 674
16. Lin, Y. P., S. P. McDonough, Y. Sharma, and Y. F. Chang. 2011. Leptospira 675
immunoglobulin‐like protein B (LigB) binding to the C‐terminal fibrinogen αC domain inhibits 676
fibrin clot formation, platelet adhesion and aggregation. Molecular microbiology 79:1063-1076. 677
17. Eshghi, A., P. A. Cullen, L. Cowen, R. L. Zuerner, and C. E. Cameron. 2009. Global 678
proteome analysis of Leptospira interrogans. Journal of proteome research 8:4564-4578. 679
18. Padilha, B. C. R., H. Q. Simão, T. L. Oliveira, and D. D. Hartwig. 2019. The use of 680
ErpY-like recombinant protein from Leptospira interrogans in the development of an 681
immunodiagnostic test for swine leptospirosis. Acta tropica. 682
19. Oliveira, T. L., R. A. Schuch, G. R. Inda, B. C. Roloff, A. C. P. S. Neto, M. Amaral, 683
O. A. Dellagostin, and D. D. Hartwig. 2018. LemA and Erp Y-like recombinant proteins from 684
Leptospira interrogans protect hamsters from challenge using AddaVax™ as adjuvant. Vaccine 685
36:2574-2580. 686
20. Stevenson, B., W. Zuckert, and D. R. Akins. 2000. Repetition, conservation, and 687
variation: the multiple cp32 plasmids of Borrelia species. Journal of molecular microbiology and 688
biotechnology 2:411-422. 689
21. Akins, D. R., M. J. Caimano, X. Yang, F. Cerna, M. V. Norgard, and J. D. Radolf. 690
1999. Molecular and Evolutionary Analysis ofBorrelia burgdorferi 297 Circular Plasmid-691
Encoded Lipoproteins with OspE-and OspF-Like Leader Peptides. Infection and immunity 692
67:1526-1532. 693
22. Stevenson, B., N. El-Hage, M. A. Hines, J. C. Miller, and K. Babb. 2002. Differential 694
binding of host complement inhibitor factor H by Borrelia burgdorferi Erp surface proteins: a 695
possible mechanism underlying the expansive host range of Lyme disease spirochetes. Infection 696
and immunity 70:491-497. 697
23. Ghosh, K. K., A. Prakash, P. Shrivastav, V. Balamurugan, and M. Kumar. 2018. 698
Evaluation of a novel outer membrane surface-exposed protein, LIC13341 of Leptospira, as an 699
adhesin and serodiagnostic candidate marker for leptospirosis. Microbiology 164:1023-1037. 700
24. Cullen, P. A., D. A. Haake, and B. Adler. 2004. Outer membrane proteins of 701
pathogenic spirochetes. FEMS microbiology reviews 28:291-318. 702
25. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific 703
scoring matrices. Journal of molecular biology 292:195-202. 704
26. Dixit, B., K. K. Ghosh, G. Fernandes, P. Kumar, P. Gogoi, and M. Kumar. 2016. 705
Dual nuclease activity of a Cas2 protein in CRISPR-Cas subtype I-B of Leptospira interrogans. 706
FEBS Lett 590:1002-1016. 707
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 32 of 42
27. Ghosh, K. K., A. Prakash, V. Balamurugan, and M. Kumar. 2018. Catecholamine-708
Modulated Novel Surface-Exposed Adhesin LIC20035 of Leptospira spp. Binds Host 709
Extracellular Matrix Components and Is Recognized by the Host during Infection. Appl Environ 710
Microbiol 84. 711
28. Dhara, A., M. S. Hussain, D. Datta, and M. Kumar. 2019. Insights to the Assembly of 712
a Functionally Active Leptospiral ClpP1P2 Protease Complex along with Its ATPase Chaperone 713
ClpX. ACS omega 4:12880-12895. 714
29. Lin, M.-H., Y.-C. Chang, C.-D. Hsiao, S.-H. Huang, M.-S. Wang, Y.-C. Ko, C.-W. 715
Yang, and Y.-J. Sun. 2013. LipL41, a hemin binding protein from Leptospira santarosai serovar 716
Shermani. PLoS One 8:e83246. 717
30. Almagro Armenteros, J. J., K. D. Tsirigos, C. K. Sønderby, T. N. Petersen, O. 718
Winther, S. Brunak, G. von Heijne, and H. Nielsen. 2019. SignalP 5.0 improves signal 719
peptide predictions using deep neural networks. Nature Biotechnology 37:420-423. 720
31. Setubal, J. C., M. Reis, J. Matsunaga, and D. A. Haake. 2006. Lipoprotein 721
computational prediction in spirochaetal genomes. Microbiology (Reading, England) 152:113. 722
32. Nakai, K., and P. Horton. 1999. PSORT: a program for detecting sorting signals in 723
proteins and predicting their subcellular localization. Elsevier Current Trends. 724
33. Abreu, P. A., A. C. Seguro, D. Canale, A. M. G. da Silva, L. do RB Matos, T. B. 725
Gotti, D. Monaris, D. A. de Jesus, S. A. Vasconcellos, and T. de Brito. 2017. Lp25 membrane 726
protein from pathogenic Leptospira spp. is associated with rhabdomyolysis and oliguric acute 727
kidney injury in a guinea pig model of leptospirosis. PLoS neglected tropical diseases 728
11:e0005615. 729
34. Pinne, M., and D. A. Haake. 2009. A comprehensive approach to identification of 730
surface-exposed, outer membrane-spanning proteins of Leptospira interrogans. PLoS One 731
4:e6071. 732
35. Chalayon, P., P. Chanket, T. Boonchawalit, S. Chattanadee, P. Srimanote, and T. 733
Kalambaheti. 2011. Leptospirosis serodiagnosis by ELISA based on recombinant outer 734
membrane protein. Transactions of the Royal Society of Tropical Medicine and Hygiene 735
105:289-297. 736
36. Atzingen, M. V., A. S. Barbosa, T. De Brito, S. A. Vasconcellos, Z. M. de Morais, D. 737
M. Lima, P. A. Abreu, and A. L. Nascimento. 2008. Lsa21, a novel leptospiral protein binding 738
adhesive matrix molecules and present during human infection. BMC Microbiol 8. 739
37. Siqueira, G. H., M. V. Atzingen, G. O. de Souza, S. A. Vasconcellos, and A. L. 740
Nascimento. 2016. Leptospira interrogans Lsa23 protein recruits plasminogen, factor H and 741
C4BP from normal human serum and mediates C3b and C4b degradation. Microbiology 742
162:295-308. 743
38. Perez-Iratxeta, C., and M. A. Andrade-Navarro. 2008. K2D2: estimation of protein 744
secondary structure from circular dichroism spectra. BMC structural biology 8:25. 745
39. LaBreck, C. J., S. May, M. G. Viola, J. Conti, and J. L. Camberg. 2017. The Protein 746
Chaperone ClpX Targets Native and Non-native Aggregated Substrates for Remodeling, 747
Disassembly, and Degradation with ClpP. Frontiers in Molecular Biosciences 4:26. 748
40. Buchan, D. W., F. Minneci, T. C. Nugent, K. Bryson, and D. T. Jones. 2013. Scalable 749
web services for the PSIPRED Protein Analysis Workbench. Nucleic acids research 41:W349-750
W357. 751
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 33 of 42
41. Barbosa, A. S., P. A. Abreu, F. O. Neves, M. V. Atzingen, M. M. Watanabe, M. L. 752
Vieira, Z. M. Morais, S. A. Vasconcellos, and A. L. Nascimento. 2006. A newly identified 753
leptospiral adhesin mediates attachment to laminin. Infection and immunity 74:6356-6364. 754
42. Malmström, J., M. Beck, A. Schmidt, V. Lange, E. W. Deutsch, and R. Aebersold. 755
2009. Proteome-wide cellular protein concentrations of the human pathogen Leptospira 756
interrogans. Nature 460:762. 757
43. Brissette, C. A., A. E. Cooley, L. H. Burns, S. P. Riley, A. Verma, M. E. Woodman, 758
T. Bykowski, and B. Stevenson. 2008. Lyme borreliosis spirochete Erp proteins, their known 759
host ligands, and potential roles in mammalian infection. International Journal of Medical 760
Microbiology 298:257-267. 761
44. Verma, A., J. Hellwage, S. Artiushin, P. F. Zipfel, P. Kraiczy, J. F. Timoney, and B. 762
Stevenson. 2006. LfhA, a novel factor H-binding protein of Leptospira interrogans. Infection 763
and immunity 74:2659-2666. 764
45. Srikram, A., K. Zhang, T. Bartpho, M. Lo, D. E. Hoke, R. W. Sermswan, B. Adler, 765
and G. L. Murray. 2011. Cross-protective immunity against leptospirosis elicited by a live, 766
attenuated lipopolysaccharide mutant. Journal of Infectious Diseases 203:870-879. 767
46. Perkins, S. J., A. S. Nealis, and R. B. Sim. 1991. Oligomeric domain structure of human 768
complement factor H by X-ray and neutron solution scattering. Biochemistry 30:2847-2857. 769
47. Goldberger, G., G. Bruns, M. Rits, M. Edge, and D. Kwiatkowski. 1987. Human 770
complement factor I: analysis of cDNA-derived primary structure and assignment of its gene to 771
chromosome 4. Journal of Biological Chemistry 262:10065-10071. 772
48. Mosesson, M. 2005. Fibrinogen and fibrin structure and functions. Journal of 773
Thrombosis and Haemostasis 3:1894-1904. 774
49. Rivera, J., G. Vannakambadi, M. Höök, and P. Speziale. 2007. Fibrinogen-binding 775
proteins of Gram-positive bacteria. Thrombosis and haemostasis 98:503-511. 776
50. Houston, S., R. Hof, T. Francescutti, A. Hawkes, M. J. Boulanger, and C. E. 777
Cameron. 2011. Bifunctional role of the Treponema pallidum extracellular matrix binding 778
adhesin Tp0751. Infection and immunity 79:1386-1398. 779
51. Haapasalo, M., K. Müller, V. Uitto, W. Leung, and B. McBride. 1992. 780
Characterization, cloning, and binding properties of the major 53-kilodalton Treponema 781
denticola surface antigen. Infection and immunity 60:2058-2065. 782
52. Flick, M. J., X. Du, J. M. Prasad, H. Raghu, J. S. Palumbo, E. Smeds, M. Höök, and 783
J. L. Degen. 2013. Genetic elimination of the binding motif on fibrinogen for the S. aureus 784
virulence factor ClfA improves host survival in septicemia. Blood 121:1783-1794. 785
53. Shannon, O., and J.-I. Flock. 2004. Extracellular fibrinogen binding protein, Efb, from 786
Staphylococcus aureus binds to platelets and inhibits platelet aggregation. Thrombosis and 787
haemostasis 91:779-789. 788
54. Choy, H. A., M. M. Kelley, J. Croda, J. Matsunaga, J. T. Babbitt, A. I. Ko, M. 789
Picardeau, and D. A. Haake. 2011. The multifunctional LigB adhesin binds homeostatic 790
proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans. PLoS 791
One 6:e16879. 792
55. Pinne, M., H. A. Choy, and D. A. Haake. 2010. The OmpL37 surface-exposed protein 793
is expressed by pathogenic Leptospira during infection and binds skin and vascular elastin. PLoS 794
neglected tropical diseases 4:e815. 795
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 34 of 42
56. Vieira, M. L., M. V. Atzingen, T. R. Oliveira, R. Oliveira, D. M. Andrade, S. A. 796
Vasconcellos, and A. L. Nascimento. 2010. In vitro identification of novel plasminogen-797
binding receptors of the pathogen Leptospira interrogans. PLoS One 5:e11259. 798
57. Domingos, R. F., M. L. Vieira, E. C. Romero, A. P. Gonçales, Z. M. de Morais, S. A. 799
Vasconcellos, and A. L. Nascimento. 2012. Features of two proteins of Leptospira interrogans 800
with potential role in host-pathogen interactions. BMC microbiology 12:50. 801
58. Sun, H. 2006. The interaction between pathogens and the host coagulation system. 802
Physiology 21:281-288. 803
59. Janeway Jr, C. A., P. Travers, M. Walport, and M. J. Shlomchik. 2001. The 804
complement system and innate immunity. Immunobiology: The Immune System in Health and 805
Disease. 5th edition. Garland Science. 806
60. Joiner, K. A. 1988. Complement evasion by bacteria and parasites. Annual Reviews in 807
Microbiology 42:201-230. 808
61. Lindahl, G., U. Sjöbring, and E. Johnsson. 2000. Human complement regulators: a 809
major target for pathogenic microorganisms. Current opinion in immunology 12:44-51. 810
62. da Silva, L. B., L. dos Santos Miragaia, L. C. D. Breda, C. M. Abe, M. C. B. 811
Schmidt, A. M. Moro, D. Monaris, J. N. Conde, M. Józsi, and L. Isaac. 2015. Pathogenic 812
Leptospira species acquire factor H and vitronectin via the surface protein LcpA. Infection and 813
immunity 83:888-897. 814
63. Fraga, T. R., L. Isaac, and A. S. Barbosa. 2016. Complement evasion by pathogenic 815
Leptospira. Frontiers in immunology 7:623. 816
64. Barbosa, A. S., P. A. Abreu, S. A. Vasconcellos, Z. M. Morais, A. P. Gonçales, A. S. 817
Silva, M. R. Daha, and L. Isaac. 2009. Immune evasion of leptospira species by acquisition of 818
human complement regulator C4BP. Infection and immunity 77:1137-1143. 819
65. Meri, T., R. Murgia, P. Stefanel, S. Meri, and M. Cinco. 2005. Regulation of 820
complement activation at the C3-level by serum resistant leptospires. Microbial pathogenesis 821
39:139-147. 822
823
LEGEND TO FIGURES 824
Fig. 1. Phylogenetic analysis of Leptospira spp. based on the amino acid sequence of 825
LIC11966/ErpY-like protein of L. interrogans serovar Copenhageni by maximum 826
likelihood method. The amino acid sequence of ErpY-like protein was retrieved from NCBI-827
protein database, and a total of 14 orthologs of ErpY-like protein were retrieved through NCBI-828
protein BLAST. The obtained sequences were aligned, and the phylogenetic tree was constructed 829
using MEGA version 7.0.26 program. The tree with the highest log likelihood (-987.90), inferred 830
following 1000 bootstrap replications, is shown where the bootstrap value greater than 50 831
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 35 of 42
indicates the reliability of the data. The tree was drawn to scale, with branch lengths measured in 832
the number of substitutions per site. The resulting phylogram shows that ErpY-like protein (red 833
box) is exclusively present in pathogenic species of Leptospira with a high level of sequence 834
conservation. 835
Fig. 2. Characterization of the recombinant Leptospira ErpY-like protein. 836
(A). Immunoblot analysis of recombinant and native ErpY-like antigen using anti-ErpY-like 837
protein antibody. Laboratory animal (mice) generated polyclonal antisera (1:1000) after 838
immunization with rErpY-like protein can detect both the native ErpY-like antigen in the 839
pathogenic Leptospira (L. interrogans serovars; Copenhageni, Lai or Canicola) and the purified 840
rErpY-like antigen (200 ng). The lysates of a non-pathogenic L. biflexa serovar Patoc was used 841
as a negative control in the immunoblot. (B). Phase-partitioning of whole-cell protein of L. 842
interrogans serovar Copenhageni using Triton X-114 and its immunoblot with the anti-rErpY-843
like antibody. Live leptospires were subjected to 1% Triton X-114 to partition proteins into 844
detergent (Det) and aqueous-phase (Aq) fractions. Phase partitioned proteins were resolved on 845
12% SDS-polyacrylamide gel, electroblotted on nitrocellulose membrane, and probed with anti-846
ErpY-like (1:1000) or anti-LipL32 (1:5000) or anti-LipL31 (1:2000) antibodies. The ErpY-like 847
protein was detected (15 kDa) predominantly in the detergent phase (top panel). LipL32, a 848
known outer membrane protein of Leptospira, was detected predominantly in the detergent phase 849
(middle panel) whereas a leptospiral cytoplasmic membrane protein LipL31 was detected in the 850
aqueous phase (bottom panel). Whole-cell lysate of L. interrogans serovar Copenhageni (W) was 851
used in the immunoblot as a marker for ErpY-like protein, LipL32 and LipL31. (C). Protease 852
accessibility assay of L. interrogans serovar Copenhageni using proteinase K (PK). Live 853
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 36 of 42
leptospires suspensions (5×108
cells per suspension) were incubated with 5 µg of PK at indicated 854
time points. The suspensions were harvested, washed, resuspended in PBS, and coated on a 855
microtiter plate (5×107
cells per well). In ELISA, the reactivity of ErpY-like protein with its anti-856
serum showed a perpetual decrease in signal from 0-5 h of PK treatment. A similar trend of 857
reduction in signal was observed for OmpL54, a known surface-exposed outer membrane protein 858
of Leptospira. The serological detection of antigen LipL31, a known cytoplasmic membrane 859
protein of Leptospira, demonstrate the uncompromised integrity of leptospires inner membrane 860
during treatment with PK. Error bars represent SDs from three replicates and are indicative of 861
two independent experiments. Statistical analysis was performed using Student's t-test by 862
comparing the signals obtained for 0 h and other time points of treatment with proteinase K 863
(*P<0.05, **P<0.01, and ***P<0.001). 864
Fig. 3. Leptospirosis-positive sera of various hosts recognize recombinant-ErpY-like 865
protein. ELISA was performed with two antigens (rErpY-like and rLoa22) independently to 866
determine the reactivity of human, bovine and canine sera testing MAT-positive or -negative for 867
leptospirosis. Serum samples reactivity against the two antigens was recorded in triplicate. The 868
mean of absorbance values obtained from each serum sample is demarcated as empty circles or 869
as empty triangles for leptospirosis MAT-positive or -negative samples, respectively. Solid-black 870
horizontal lines represent the mean of each group. The cut-off value (dashed-black horizontal 871
lines) of the assay was derived from the mean of the absorbance values obtained from 872
leptospirosis MAT-negative samples (control group) plus two SDs (standard deviations) for the 873
antigen used. (A). ELISA to detect rErpY-like antigen (400 ng) using MAT-positive (n=50) and -874
negative (n=20) serum samples of human (1:100) for leptospirosis. Infected human sera 875
recognized the rErpY-like protein with 100% sensitivity and specificity. (B). ELISA to detect 876
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 37 of 42
rLoa22 (400 ng) antigen using MAT-positive and -negative human serum samples for 877
leptospirosis. Infected human sera recognized the rLoa22 antigen with 100% sensitivity and 878
specificity. (C). Immunoblot of antigens (rErpY-like and rLoa22) using the pooled human 879
serum. Pooled human serum testing MAT-positive for leptospirosis recognized both antigens 880
(left panel). In contrast, there was no recognition of both antigens using a pooled human serum 881
testing negative for leptospirosis (right panel). (D). ELISA to detect rErpY-like antigen using 882
bovine serum samples testing MAT-positive (n=50) or -negative (n=20) for leptospirosis. (E). 883
ELISA to detect rLoa22 antigen using bovine serum samples testing MAT-positive or -negative 884
for leptospirosis. (F). Immunoblot using pooled bovine serum testing MAT-positive or -negative 885
for leptospirosis (G). ELISA to detect rErpY-like antigen using canine serum samples testing 886
MAT-positive (n=18) or -negative (n=18) for leptospirosis. (H). ELISA to detect rLoa22 antigen 887
using canine serum samples testing MAT-positive or -negative for leptospirosis. (I). Immunoblot 888
using pooled canine serum testing MAT-positive or -negative for leptospirosis. 889
Fig. 4. Recombinant ErpY-like protein binds to host extracellular matrix and plasma 890
components. 891
(A). Far-ultraviolet (190-240 nm) CD spectra of rErpY-like protein. The analysed CD spectra 892
data shows the predominance of α-helix (87.6%) which is in agreement to theoretically predicted 893
the secondary structure of the rErpY-like protein. The spectra represented as an average of three 894
scans with a scanning speed of 100 nm min−1
. (B). Interaction between rErpY-like protein and 895
commercial host ECM components. The binding of rErpY-like protein to ECM components 896
(laminin, fibronectin, collagen type I, chondroitin sulfate A &B, hyaluronic acid, heparan sulfate, 897
and elastin or plasma components; fibrinogen, plasminogen, factor H, and factor I) were 898
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 38 of 42
analyzed through ELISA. The plasma components; fetuin (highly glycosylated protein) and 899
bovine serum albumin fraction V (non-glycosylated protein) were included as negative controls 900
for ligands. The rLoa22 that is known to interact moderately with host ECM components was 901
included in the assay as a negative control protein. Protein-specific antisera (anti-ErpY-like 902
protein or anti-Loa22 antibody) were used to measure the interaction of recombinant proteins 903
with host ligands. The rErpY-like protein was recorded to interact preferentially to plasma 904
fibrinogen followed by factor H and other host ligands. The bar represents mean absorbance 905
value (450 nm) for a ligand. Error bars are indicative of SDs from two independent experiments 906
each performed in triplicate. For statistical analyses, the binding of rErpY-like protein with host 907
ligands was compared to that with fetuin or BSA by the two-tailed t-test (***P<0.001). (C). Pure 908
rErpY-like protein forms supramolecule. The purified rErpY-like protein (0.5, 1 and 2 μg) were 909
resolved on a 4-20% native-PAGE and stained with Coomassie-blue. The standard native 910
molecular weight marker (M) was run in lane 1. The rErpY-like protein resolved at around 300 911
kDa. The gel in this figure has been spliced for labelling purpose. (D). Denaturing 912
polyacrylamide gel electrophoresis of rErpY-like protein after glutaraldehyde (GLD) cross-913
linking. Chemical cross-linking of rErpY-like protein with glutaraldehyde (0-45 min) show 914
multiple higher molecular weight bands when resolved in the presence (+) or absence (-) of DTT. 915
In the right panel, cross-linked product of two control proteins, β-casein and rLIC13341 916
demonstrate only one band of higher size. 917
Fig. 5: Analyses of rErpY-like supramolecule by DLS and FETEM. (A).Size distribution 918
profile of purified rErpY-like protein by dynamic light scattering. The purified rErpY-like 919
protein shows a single major peak with an average hydrodynamic diameter of 10.88±5.18 nm 920
whereas, the heat-denatured protein show a shift in the size distribution of the major peak with 921
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 39 of 42
an average diameter of 163.6±57.92 nm and a minor peak corresponding to the non-aggregated 922
rErpY-like protein (red striped bars). The representative size distribution data of the 30 scans is 923
presented here. (B). Negative stain FETEM image of r-ErpY-like protein. FETEM image 924
demonstrates the self-assembly of the r-ErpY-like protein monomer into spherical particles of 925
nearly uniform shape and size (~20 nm diameter) throughout the grid. Sample image was 926
acquired at 40,000X magnification. Micrograph scale bar = 100 nm. For clarity particle-1 and -2 927
magnified images are shown. 928
Fig. 6. Binding characterization of the rErpY-like protein to human fibrinogen. (A). Dose-929
dependent binding of the rErpY-like protein to human fibrinogen. Fibrinogen (1 µg/well) coated 930
microtiter plates were incubated with increasing concentrations of rErpY-like protein (0.05-5 931
µM) and the ligand interaction was detected by anti-ErpY-like antibody (1:1000). The mean 932
absorbance values of rErpY-like protein binding to fibrinogen as a function of rErpY-like protein 933
concentration is shown. Binding saturation was recorded at 5 µM of rErpY-like protein with a 934
dissociation constant (KD) of 70.45±4.13 nM. (B). Heat-denatured rErpY-like protein fails to 935
bind human fibrinogen. The rErpY-like protein was heat-denatured for 10 minutes at 95 °C. The 936
untreated (control) or heat-denatured rErpY-like protein (0.25-5 µM) was allowed to interact 937
with fibrinogen-coated microtiter plates. In contrast to dose-dependent binding of the untreated 938
rErpY-like protein to fibrinogen, no significant change in binding to fibrinogen was observed 939
with increasing concentration of heat-denatured rErpY-like (ΔrErpY-like) protein. (C). Specific 940
antibody-mediated inhibition of rErpY-like antigen binding to human fibrinogen. The rErpY-like 941
protein was incubated individually with the antibody against rErpY-like/rLoa22/blank before its 942
interaction to fibrinogen-coated microtiter plates. The specific antibody-antigen complex 943
generation showed a reduction in interaction to fibrinogen (51%) relative to control with no 944
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 40 of 42
antibody supplementation. In contrast, a relative reduction of 5% was observed when serum 945
against rLoa22 antigen was used as a non-specific antibody control. (D). Presence of rErpY-like 946
protein inhibits live leptospires adherence to human fibrinogen. Adhesion of leptospires to 947
fibrinogen was reduced in the presence of an increasing concentration of rErpY-like protein. 948
Fibrinogen bound leptospires were quantified by anti-Loa22 antibody, and the absorbance 949
obtained in the absence of rErpY-like protein was measured as 100%. The live leptospires 950
adherence to fibrinogen was reduced to 53% in the presence of saturated concentration (5 µM) of 951
rErpY-like protein. The binding measurements were performed in three replicates, and the data 952
shown are representative of two independent experiments. Statistical analyses were performed by 953
the two-tailed t-test (***P<0.001). 954
Fig. 7. Inhibition of thrombin-catalyzed fibrin clot formation in the presence of rErpY-like 955
protein. (A). Recombinant ErpY-like protein dose-dependent inhibition of fibrin clot reaction. 956
Increasing concentrations of rErpY-like protein (0.05-5 µM) were pre-incubated with human 957
fibrinogen (Fg; 1 mg mL-1
) in a microtiter plate for 2 hours at 37 °C before initiating the 958
thrombin (Thr; 10 mU/well) catalyzed fibrin clot formation. The clotting reaction in the well-959
containing fibrinogen plus thrombin is taken as a positive control, while the reaction containing 960
only fibrinogen is the negative control. The rLoa22 was used to check the specificity of clot 961
inhibition assay. The absorbance obtained during thrombin-catalyzed fibrin clot reaction was 962
measured at every 2 minutes for 40 min. The recorded absorbance (595 nm) versus time (min) 963
plot shows inhibition of thrombin catalyzed fibrin clot formation from fibrinogen in the presence 964
of rErpY-like protein. (B). Reduction in the percentage of fibrin clot formation in the presence of 965
rErpY-like protein. The absorbance obtained during fibrin clot formation in the positive control 966
of the assay shown in Fig 7A was taken as 100%. The fibrin clot formation at a saturation time 967
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 41 of 42
point (40 min) in the presence of an increasing concentration of rErpY-like protein was 968
calculated in percentage. The thrombin catalyzed fibrin clot formation was reduced to 7% in the 969
presence of a saturated concentration of r-LIC11966 (5 µM). The measurements were performed 970
in triplicates, and the data shown is the representative of two independent experiments. Statistical 971
analysis was performed by the two-tailed t-test (***P<0.001). 972
Fig. 8. The recombinant and native ErpY-like protein interacts with complement factor H 973
present in human plasma. (A). Comparison of far-Western and Coomassie-Blue stained gel of 974
rErpY-like and rLoa22 proteins. The recombinant proteins (rErpY-like protein and rLoa22) 975
resolved on SDS-polyacrylamide gel was stained with Coomassie-blue to demonstrate the equal 976
loading of the recombinant proteins (top panel). An equivalent amount of recombinant proteins 977
were electroblotted onto the nitrocellulose membrane to perform Far-Western blot with anti-CFH 978
antibody after overlaying it with 10% human plasma. Far-Western blot demonstrated the rErpY-979
like protein (~18 kDa, blue arrowhead) interaction with CFH component of human plasma 980
whereas, rLoa22 (negative control) did not show any interaction with CFH (bottom panel). (B). 981
Comparison of far-Western and Coomassie-Blue stained gel of CFH. The human CFH (1 µg) of 982
150 kDa size was resolved on SDS-polyacrylamide gel and stained with Coomassie-Blue (top 983
panel). An equivalent amount of CFH was electroblotted onto nitrocellulose membrane and 984
overlaid with 100 ng/µl of rErpY-like protein (middle panel) or rLoa22 (bottom panel). Far-985
Western blot demonstrated the rErpY-like protein interaction with CFH (~150 kDa) whereas, 986
rLoa22 (negative control) did not show any interaction with CFH. (C). Comparison of far-987
Western blot and Coomassie-Blue stained gel of whole-cell lysate of Leptospira. The whole-cell 988
lysate of L. interrogans serovar Copenhageni was resolved on SDS-polyacrylamide gel for 989
Coomassie-Blue staining (left panel) and far-Western blot (middle panel). Detection at 990
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
Page 42 of 42
approximately 15 kDa (red arrowhead) demonstrates the possible interaction of native ErpY-like 991
protein of Leptospira to CFH present in of human plasma (middle panel). Detection of the native 992
protein (15 kDa, red arrowhead) in Leptospira lysate using anti-ErpY-like antibody (right panel). 993
The gels in this figure have been spliced for labelling purposes. 994
995
996
997
on June 23, 2020 by guesthttp://iai.asm
.org/D
ownloaded from