熊本大学学術リポジトリ Kumamoto University Repository …STUDIES ON COD REMOVAL USING...
Transcript of 熊本大学学術リポジトリ Kumamoto University Repository …STUDIES ON COD REMOVAL USING...
熊本大学学術リポジトリ
Kumamoto University Repository System
Title Studies on COD removal using poly (vinyl alcohol)-
gel beads as biomass carrier in UASB reactor
Author(s) Do Phuong Khanh
Citation
Issue date 2012-03-23
Type Thesis or Dissertation
URL http://hdl.handle.net/2298/24903
Right
STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL
BEADS AS BIOMASS CARRIER IN UASB REACTOR
A Dissertation Submitted in Partial Requirement for the Graduation in Engineering
February, 2012
DO PHUONG KHANH
Graduate School of Science and Technology
KUMAMOTO UNIVERSITY
STUDIES ON COD REMOVAL USING POLY(VINYL ALCOHOL)-GEL
BEADS AS BIOMASS CARRIER IN UASB REACTOR (PVA ゲルビーズを微生物担体として使う UASB 法による COD 除去に関する研究)
A Dissertation Submitted in Partial Requirement for the Graduation in Engineering
Doctoral Dissertation
February, 2012
By
DO PHUONG KHANH
Supervisor
Prof. KENJI FURUKAWA
Department of New Frontier Sciences
Graduate School of Science and Technology
KUMAMOTO UNIVERSITY
i
Acknowledgement
I am appreciated to many people whose support, advice and encouragement allowed
me to complete this work.
Firstly, I would like to express my sincere and honest thanks to my supervisor, Prof.
Kenji Furukawa. His academic guidance, technical advice and incisive considerations
during my study deserve all my gratitude. Without his patient instruction, the completion
of this thesis and the publications would not have been possible.
Secondly, I am very thankful to Prof. Susumu Takio, Prof. Yoshito Kitazono and
Assoc. Prof. Takeshi Kitano for their help to check my dissertation.
I am extremely thankful to Dr. Lai Minh Quan, Dr. Zhang Wenjie, Dr. Daisuke Hira,
Dr. Qiao Sen, Dr. Xu Xiaochen, Dr. Ma Yongguang, Dr. Li Zhigang, Mr. Kazuya
Kamishima and Mr. Takahiro Sato for the direct support during my experiments. I have
learned from all of you. My thanks are also due to Ms. Murashima Kimiyo, who never
failed to give me great encouragement and suggestions. I express my appreciation to
Kuraray Corporation for providing me the polymer gel beads.
I’m indebted to the Japanese students, Vietnamese students and Chinese students in
Prof. Furukawa’s lab. Specially, I deeply appreciate my tutors, Dr. Taichi Yamamoto and
Mr. Takehiko Shinohara; my “elder brother and elder sister”, Dr. Yang Jiachun and Dr.
Zhang Li; my young colleagues, Mr. Masashi Takekawa, Mr. Satoshi Ohta, Mr. Ryouta
Esaki, Mr. Yuuki Nakayama, Mr. Daisuke Yoshida; Dr. Liu Chengliang, Dr. Gao Yanning,
Dr. Sou Tyou Syun, Dr. Masako Sakai, Mr. Tran Thanh Liem, Ms. Phan Thi Hong Ngan,
Mr. Chen Cheng, Ms. Jiang Jing, Ms. Xu Shan, Ms. Wei Qiaoyan, Mr. Yuki Tomoshige
ii
and Dr. Keita Takagi for their kindness and friendships. I’m very grateful to Ms. Seiko
Saito for giving me so much administration guidance and sharing the unforgettable
moments in Hanoi.
I’m thankful to IJEP and GelK programs for giving me not only fundamental
academic knowledge and financial support, but also good friends. I have highly
appreciated all members of Meidensha Corporation (Stationed staff in Nagoya), who
have taught and helped me so much during my internship.
My gratitude also extends to Mr. & Mrs. Sakimoto, Mr. & Mrs. Harada, Ms. Midori
Noguchi, Mr. & Mrs. Akimoto, Ms. Mieko Ikeda, Ms. Megumi Yoshii and my closest
friends in ‘Kumavina’, who give me the second family. I would like to appreciate my
doctoral friends, Ms. Meshkatul Jannat, Ms. Nguyen Thi Ngoc, Ms. Liany Hendratta, Mr.
Lei Lu, Mr. Bingwei Tian, Mr. Tohirin Sukarno and Ms. Mahsa Saeidi, who always cheer
me up.
Special thanks to my all family members: Mom, Dad, Phuong Hanh and Duc Anh
for lots of spiritual support.
I wish to acknowledge all people, whom I might have not mentioned here and who
have either directly or indirectly give me their thoughtfulness and encouragement.
iii
List of contents
Abstract ……………………………………………………………………………….. v
List of acronyms and abbreviations …...……………………………………..…….. vii
Lists of tables ……………………………………………………………………..… viii
List of figures ……...…………………………………………………………………. ix
Chapter 1 Literature review ………………………………………………………... 01
1.1 Introduction ………………………………………………………………………. 01
1.1.1 Treatment of low-strength wastewater by UASB reactors …………………… 01
1.1.2 Application of PVA-gel carrier for wastewater treatment ….………………… 09
1.2 Objectives of this study …………………………………………………………... 12
Chapter 2 Effect of temperature on UASB treatment of low-strength wastewater
using poly(vinyl alcohol)-gel carrier ……………………………………………….. 17
2.1 Introduction ………………………………………………………………………. 17
2.2 Materials and methods ……………………………………………………………. 18
2.2.1 Experimental setup ……………………………………………………………... 18
2.2.2 Synthetic medium ………………………………………………………………. 19
2.2.3 Biomass carrier …………………………………………………………………. 20
2.2.4 Analytical methods ...…………………………………………………………… 20
2.3 Results ……………………………………………………………………………. 21
2.3.1 UASB reactor performance …………………………………………………….. 22
2.3.2 Effects of temperature decrease and extremely short HRTs ……………………. 25
2.3.3 Characteristics of attached growth ……...……………………………………… 26
2.3.4 Archaeal community analysis …………………………………………………... 28
2.3.5 Post-treatment of UASB reactor effluent ………………………………………. 30
2.4 Discussion ………………………………………………………………………… 31
2.5 Conclusions ………………………………………………………………………. 32
Chapter 3 Response of poly(vinyl alcohol)-gel and poly(ethylene glycol)-gel
biogranular sludges in two identical UASB reactors ……………………………… 37
3.1 Introduction ………………………………………………………………………. 37
3.2 Materials and methods ……………………………………………………………. 38
3.2.1 Reactor setup …………………………………………………………………… 38
3.2.2 Substrates ……………………………………………………………………….. 39
iv
3.2.3 Biomass carrier …………………………………………………………………. 39
3.2.4 Analytical methods ...…………………………………………………………… 40
3.3 Results and discussion ……………………………………………………………. 40
3.3.1 Reactor performance ……………………………………………………………. 40
3.3.2 Characteristics of attached growth ……………………………………………... 42
3.4 Conclusions ………………………………………………………………………. 57
Chapter 4 Substrate removal kinetics in a UASB reactor using poly(vinyl
alcohol)-gel carrier operated at 15oC ……................................................................. 50
4.1 Introduction ………………………………………………………………………. 50
4.2 Materials and methods ……………………………………………………………. 51
4.2.1 Experimental setup ……………………………………………………………... 52
4.2.2 Synthetic influent ……………………………………………………………….. 52
4.2.3 Seed sludge ……………………………………………………………………... 52
4.2.4 Analytical methods …...………………………………………………………… 52
4.3 Results and discussion ……………………………………………………………. 52
4.3.1 Reactor performance ……………………………………………………………. 53
4.3.2 Characteristics of attached growth …...………………………………………… 54
4.3.3 Substrate removal kinetics in UASB reactor …………………………………… 56
4.4 Conclusions ………………………………………………………………………. 62
Chapter 5 Post-treatment of UASB effluents by a swim-bed reactor ……………. 66
5.1 Introduction ………………………………………………………………………. 66
5.2 Materials and methods ……………………………………………………………. 66
5.2.1 Experimental setup ……………………………………………………………... 66
5.2.2 Seed sludge ……………………………………………………………………... 68
5.2.3 Biomass carrier …………………………………………………………………. 68
5.2.4 Analytical methods ……………………………………………………………... 68
5.3 Results and discussion ……………………………………………………………. 69
5.3.1 Reactor startup ………………………………………………………………….. 69
5.3.2 COD removal performance …………………………………………………….. 70
5.4 Conclusions ………………………………………………………………………. 73
Chapter 6 Conclusions ……………………………………………………………… 75
Publications…………………………………………………………………………... 78
v
Abstract
Low-strength wastewater is identified with COD concentrations below 1000 mg/L.
Its main sources are cesspit leakage, septic tank, sewage treatment plant, industrial
process water, rainfall runoffs, agricultural drainage, etc. In many developing countries,
such wastewaters are large in quantity and discharged into water bodies without a
treatment process.
Over the past forty years, UASB reactor was introduced by Dr. Lettinga and his
coworkers in Netherlands. It has become one of the most popular anaerobic wastewater
treatment processes because of low energy demand, simple construction and high
removal efficiency. The application of UASB reactor for industrial wastewater treatment
indicated a number of reports on the treatment of high-strength wastewater and
medium-strength wastewater. A small fraction of published papers have discussed on the
treatment of low-strength wastewater, because such wastewater is poor in recoverable
materials, therefore treating them brings insignificant returns. It becomes crucial to treat
low-strength wastewater with less input of energy and other resources.
Sludge granulation is considered as the key success of UASB process. In our
experiments, PVA-gel beads were employed as a biomass carrier. This functional resin
has a reticulate structure that can trap and carry microorganisms. PVA-gel beads have
been employed as biomass carrier in hundreds of projects on industrial water treatment
systems in Japan. Recently, PVA gels have been applied for lab-scale anaerobic
bioreactors, including packed-bed, anammox and UASB. Zhang et al. (2009) carried out
his experiments with UASB reactor using PVA gels treating high-strength wastewater. In
my study, the treatment of low-strength wastewater by UASB reactor using PVA gel
beads has been discussed. This dissertation covered six following chapters:
Chapter 1 – An overview of the studies on low-strength wastewater treatment by
UASB bioreactors and the application of poly(vinyl alcohol)-gel beads as biomass carrier
for anaerobic wastewater treatment.
Chapter 2 – The performance of a UASB reactor treating low-strength wastewater
under mesophilic (35oC) to psychrophilic (15oC) conditions. The effect of temperature
vi
decrease on COD removal was evaluated. The operational strategy was keeping the stable
influent COD concentrations and accelerating HRT to below 1 hr. A stepwise increase of
organic loading rates was achieved, excluding the requirements for time and space of
experiments. The acceptable organic loading rates for treatment of low-strength
wastewater by UASB reactor were discussed.
Chapter 3 – The role of the porous macrostructure of PVA granules in UASB reactor
was investigated. COD removal and the dominant microbial species in two identical
UASB reactors using PVA-gel carrier and poly(ethylene glycol) (PEG)-gel carrier for
treating low-strength wastewater were studied.
Chapter 4 – The operation of a cylinder-shaped UASB reactor using PVA-gel carrier
at 15oC and under short HRTs. It was compared with the performance of a cuboid-shaped
UASB reactor as described in Chapter 2. The microbial population and substrate removal
kinetics for the cylinder-shaped UASB reactor was presented.
Chapter 5 – The feasibility of applying a swim-bed reactor as post-treatment of
UASB effluents was investigated.
Chapter 6 – Conclusion remarks and recommendation for future work.
vii
List of acronyms and abbreviations
AHR Anaerobic Hybrid Reactor
BF Biofringe
BOD5 5-day Biological Oxygen Demand
COD Chemical Oxygen Demand
GSS Gas Solid Separator
HRT Hydraulic Retention Time
OLR Organic Loading Rate
OTU Operational Taxonomic Unit
PCR Polymerase Chain Reaction
PVA Poly(vinyl alcohol)
PEG Poly(ethylene glycol)
SEM Scanning Electron Micrograph
SS Suspended Solids
TN Total Nitrogen
UASB Upflow Anaerobic Sludge Blanket
VFA Volatile Fatty Acids
VSS Volatile Suspended Solids
viii
List of Tables
Table Title
1-1 Classification of methanogenic bacteria (Whitman et al., 2001)
1-2 Five-year reports on COD removal using PVA bio-carriers (2005-2011)
2-1 Operational parameters
2-2 Performance of UASB reactor during Period I-III
2-3 Comparison of temperature coefficient (θ) for anaerobic treatments
2-4 Performance of lab-scale UASB reactors using PVA gel carrier
2-5 Archaeal communities of UASB sludge
2-6 BOD5, COD and TN concentrations in UASB effluents
3-1 Operational parameters of the two identical UASB reactors
3-2 Properties of the original PVA/PEG beads
3-3 Treatment performance of UASB reactors using PVA/PEG-gel carriers
3-4 Archaeal communities in UASBPVA and UASBPEG sludges
4-1 Operational parameters of 2.5 L-cylinder-shaped UASB reactor
4-2 Treatment performance of 2.5 L-cylinder-shaped UASB reactor
4-3 Treatment performance of UASB reactors using PVA-gel at 15oC
4-4 Archaeal communities in the granular sludge obtained from 2.5 L-UASB
4-5 Data for Grau second-order kinetic model for 2.5 L-UASB reactor
4-6 Comparison of kinetic parameters in the Grau second-order model
4-7 Data for modified Stover-Kincannon model for 2.5 L-UASB reactor
4-8 Comparison of kinetic parameters in the Stover-Kincannon model
5-1 Treatment performance of the swim-bed reactor
ix
List of Figures
Figure Title
1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by
UASB reactors
1-2 Schematic diagram of a basic UASB reactor
1-3 Anaerobic conversion of organic substrates to methane
1-4 Schematic of the multi-layer model for anaerobic granulation
1-5 Kuraray’s wastewater treatment technology using PVA gel beads
2-1 Schematic diagram of UASB reactor (A); blank PVA beads (B); macrostructure of
blank PVA bead, scale bar 20 µm (C); cultivated PVA beads (D)
2-2 Time courses of COD removal
2-3 COD concentrations at different sampling ports under loading rate of 17 kg-COD
m-3 d-1 (HRT 0.6 h)
2-4 Temperature dependence of COD removal rate
2-5 Scanning electron microscopic images of a matured PVA-gel beads
2-6 BOD5, COD and TN concentrations in UASB effluents under COD loading rates
of 5 to 40 kg-COD m-3 d-1
3-1 Schematic of two identical 1L-cylinder-shaped UASB reactors
3-2 Time courses of COD removal by UASBPVA and UASBPEG reactors
3-3 SEM of the anaerobic sludge attached to a matured PVA bead
3-4 SEM of the macrostructure of an original PEG bead
3-5 SEM of the anaerobic sludge attached to a matured PEG bead
4-1 Schematic diagram of 2.5 L-cylinder-shaped UASB reactor
4-2 Time courses of COD removal by 2.5 L-cylinder-shaped UASB reactor
x
4-3 Grau second-order model application for 2.5 L-UASB reactor
4-4 Modified Stover-Kincannon model application for 2.5 L-UASB reactor
4-5 Comparison of the predicted and the actual COD concentrations from 2.5
L-cylinder-shaped UASB reactor operated at 15oC
5-1 Schematic diagram of 7.7 L-swim-bed reactor as the post treatment of UASB
effluents from 3.9 L-cuboid-shaped UASB reactor (A) and 2.5 L-cylinder-shaped
UASB reactor (B)
5-2 Cross-sectional schematic diagram of swim-bed reactor
5-3 Time course of total sludge attachment to the BF carrier
5-4 Time courses of COD removal by swim-bed reactor
5-5 Linear relation between COD removal rate and COD loading rate
5-6 The BF carrier with attached growth (day 50 and day 320)
5-7 Time courses of reactor SS concentration and linear upflow velocity
1
Chapter 1 Literature Review
1.1 Introduction
Anaerobic biological wastewater treatment has been majorly collected much
attention by the researchers due to its sustainability. Many anaerobic bioreactor systems,
such as anaerobic filters (AF), anaerobic sequencing batch reactors (SBR), anaerobic
expanded bed reactors (EGSB) and anaerobic fluidized bed reactors (AFB) have been
introduced for the treatment of biodegradable wastewaters. Of these, upflow anaerobic
sludge blanket (UASB) technology was recently considered as the most popular method
in which organic materials can be removed under high loading rate (Habeeb et al., 2010).
Sludge granules are at the core of UASB technology (Lettinga et al., 1980; Van Haandel
et al., 1994). A sludge granule is an aggregate of microorganisms forming under a
constant upflow hydraulic regime. The sludge granules are multi-microbial
communities and none of the individual species is capable of degrading complex
organic matters (Lens et al., 1995; Yu et al., 2000). The operation of UASB reactor was
previously limited to the treatment of high-strength industrial wastewater (Alphenaar et
al., 1993; Arching et al., 1993; Hwang et al., 1991; Imai et al., 1997; Ke et al., 1996).
Recent studies have been practically indicated the feasibility of UASB reactors to treat
low-strength industrial and domestic wastewaters (Sankar Ganesh et al., 2007; Show et
al., 2004). This chapter attempts to review the application of UASB reactor in the
treatment of such wastewaters; besides, the development of granule-based UASB
reactors using poly(vinyl alcohol)-gel is briefly introduced.
1.1.1 Low-strength wastewater treatment by UASB reactors
The UASB process has been developed by Dr. Gatze Lettinga in the late 1970's at
the Wageningen University, The Netherlands (Lettinga et al., 1980). The UASB reactor
is mainly classified as bioreactors, due to its biological treatment of wastewater. UASB
reactor is characterized by its low energy demand, simple construction and high removal
efficiency (Show et al., 2004). Sankar Ganesh et al. (2007), cited by Habeeb et al.
(2010) reported a survey to investigate the application of UASB reactor during
2
1999-2004. With numerous advances (sludge development, microbial manipulation,
reactor hydrology, upstream controls, combination with other reactors, etc.),
biodegradable wastewaters varying in strength have been treated efficiently with UASB
reactors as illustrated in Fig. 1-1.
Fig. 1-1 Five-year reports (1999-2004) on the treatment of industrial wastewaters by
UASB reactors (Sankar Ganesh, 2007)
It indicates that a small fraction of reports focused on low-strength industrial
wastewaters. UASB process was regarded to suite for the treatment of high-strength
wastewaters, followed by medium-strength ones, but low-strength wastewaters pose
special challenge. Such wastewaters generally ensue from washing operations:
households generate such wastewaters as sewages, and industries do so as streams
resulting from washing of the machinery and the rest of the shop floor. Such wastewaters
are of low-strength but are large in quantity. It therefore becomes crucial that techniques
be developed to treat such wastewaters with less input of energy.
The UASB system is mainly consisted of a tank, pump, and biogas collector system
as illustrated in Fig. 1-2A. Untreated wastewater is distributed at the bottom and fluid up
through the sludge blanket, where organic matters are digested, absorbed, and
metabolized into bacterial cell and produce biogas. The gas solid separator (GSS) was
designed at the top of the reactor (Fig. 1-2B).
3
Fig. 1-2 Schematic diagram of a basic UASB reactor:
UASB design (A), GSS design (B), GSS process (C), biodegradation in UASB
reactor (D) (Habeeb et al., 2010)
C D
B A
4
The main reason to provide UASB reactor with GSS was (i) to collect the discharged
biogas properly, (ii) to decrease the turbulence which is mainly resulted from gas arising
in bubbles, (iii) to reduce the solids content in effluent, and (iv) to reduce the sludge
particles washout by entrapping particles in sludge blanket or flocculating or settling the
particles. Fig. 1-2C shows how the separation device is working. The successful
treatment in UASB reactor is mainly attributed to the formation of anaerobic granular in
sludge bed where microbial communities plays the central role on digesting the substrates
to biogas. The biological digestion process is illustrated in Fig. 1-2D.
In the UASB granules, different groups of bacteria carry out sequential metabolic
processes. Various theories have been explained the activity and performance of
microbial communities inside UASB (Liu et al., 2003). An overall scheme for anaerobic
conversions of organic substrates to methane is indicated in Fig. 1-3. During anaerobic
degradation of particulate organic materials, particulate biopolymers (carbohydrates,
proteins and lipids) are firstly hydrolyzed to organic monomers, which can be utilized as
substrates by fermentative organisms (amino acids, sugars) or by anaerobic oxidizers
(fatty acids). The carbonic products from these reactions are either acetate (CH3COOH)
and hydrogen or intermediate compounds, such as propionate and butyrate, which may
later be converted to acetate or hydrogen (H2). Methane (CH4) is mostly produced from
acetate or hydrogen and carbon dioxide (CO2).
UASB microbial communities can be classified into two domains, Bacteria and
Archaea. Stable anaerobic digestion is accomplished by representatives of four major
metabolic groups: hydrolytic-fermentative bacteria, proton-reducing acetogenic bacteria,
acetotrophic methanogens and hydrogenotrophic methanogens. Acetotrophic and
hydrogenotrophic methanogens are essential for the last step of methanogenesis.
The acetotrophic methanogens are obligate Archaea anaerobes, which convert
acetate to methane and carbon dioxide (CH3COOH CH4 + CO2). The activity of the
acetotrophic methanogens are of paramount importance during anaerobic conversion of
acetate. In earlier work, Methanosarcina and Methanosaeta species were found to be the
dominant methanogens in a variety of UASB reactors. In other methanogenic reactions,
hydrogen is used as an electron acceptor to form methane by hydrogennotrophic
methanogens (4H2 + CO2 CH4 + 2H2O), while many H2-using methanogens can also
5
use formate as an electron donor for the reduction of CO2 to CH4 (4HCOOH CH4 +
3CO2 + 2H2O).
Complex organic substrates
Particulate organic matter Carbohydrates Proteins Lipids
Monomers
Amino acids Fatty acids Sugars Alcohols
Intermediary products
Acetate Propionate Ethanol Lactate
Methanogenesis Methane (CH4)
+ Carbon dioxide (CO2)
Fig. 1-3 Anaerobic conversion of organic substrates to methane
The hydrogen partial pressure is an important parameter, which defines process
stability or upsets in an anaerobic digestion process. Hence, the occurrence of the
hydrogenotrophic methanogens is crucial for an efficient process performance (Demirel
et al., 2008). Table 1-1 shows the outline of methanogenic bacteria classification
Hydrolysis
Acidogenesis
Acetogenesis
Reductive homoacetogenesis
Acetate
(CH3COOH) H2, CO2
Homoacetogenic oxidation
Reductive homoacetogenesis
Hydrolytic bacteria
Fermentative acidogenic bacteria
Acetogenic bacteria
Acetotrophic methanogens Hydrogenotrophic methanogens
6
(Whitman et al., 2001). So far, 28 genera of methanogens have been described. The
majority of rod-shaped methanogens are affiliated to the order Methanobacteriales,
which consists of three mesophilic genera (Methanobacterium, Methanobrevibacter and
Methanosphaera) and two thermophilic or hyperthermophilic genera
(Methanothermobacter and Methanothermus).
Table 1-1 Classification of methanogenic bacteria (Whitman et al., 2001)
Class I. Methanobacteria (known to grow on H2/CO2 and formate as carbon source) Order I. Methanobacteriales Family I. Methanobacteriaceae Genus I. Methanobacterium Genus II. Methanobrevibacter Genus III. Methanosphaera Genus IV. Methanothermobacter Family II. Methanothermaceae Genus I. Methanothermus Class II. Methanococci (known to grow on H2/CO2 and formate as carbon source) Order I. Methanococcales Family I. Methanococcaceae Genus I. Methanococcus Genus II. Methanothermococcus Family II. Methanocaldococcaceae Genus I. Methanocaldococcus Genus II. Methanotorris Class III. Methanomicrobia Order I. Methanomicrobiales (known to be hydrogenotrophic) Family I. Methanomicrobiaceae Genus I. Methanomicrobium Genus II. Methanoculleus Genus III. Methanofollis Genus IV. Methanogenium Genus V. Methanolacinia Genus VI. Methanoplanus Family II. Methanocorpusculaceae Genus I. Methanocorpusculum Family III. Methanospirillaceae Genus I. Methanospirillum Order II. Methanosarcinales (known to be acetotrophic and methylotrophic) Family I. Methanosearcinaceae Genus I. Methanosarcina Genus II. Methanococcoides Genus III. Methanohalobium Genus IV. Methanohalophilus Genus V. Methanolobus Genus VI. Methanomethylovorans Genus VII. Methanomicrococcus Genus VIII. Methanosalsum Family II. Methanosaetaceae Genus I. Methanosaeta
(Genus: related to the laboratory-scale work in Chapter 2, 3, 4)
7
All methanogens grow on a H2/CO2 gas mixture. Many of them utilize formate and
some grow on other simple alcohols. The anaerobic digester is a compatible surrounding
for the growth of mesophilic methanogens and Methanobacterium strains, which play an
important role in the anaerobic degradation of organic compounds as the terminal
metabolic groups (Hobson & Shaw, 1973).
Many mechanisms and models for anaerobic granulation are currently available in
the literature. Based on the microscopic observation, a layered structure of UASB
granules (Fig. 1-4) was initially proposed by MacLeod et al. (1990) and Guiot et al.
(1992), also supported by a numbers of works (Arcand et al., 1994; Lens et al., 1995; Liu
et al., 2003). Recent research by Sekiguchi et al. (1998) showed that UASB granules have
a center which might be formed as a result of the accumulation of metabolically inactive,
decaying biomass and inorganic materials. Tay et al. (2000) proposed a theory for the
molecular mechanism of sludge granulation. The overall granulation starts from
dehydration of bacterial surfaces, and followed by embryonic granule formation, granule
maturation and post maturation. This theory provides useful information for
understanding how anaerobic granules form in a molecular level, but it is most likely that
this theory does not account for those operational conditions associated metabolic
changes of microorganisms, which would highly contribute to the formation of UASB
granules.
Fig. 1-4 Schematic of the multi-layer model for anaerobic granulation
(Hulshoff Pol, 2004)
CH4, CO2
CH3 COOH
VFA
8
The start-up and operation of UASB reactor is involved the adjustment of pH of
influent, initial sludge amount, hydraulic retention time (HRT), organic loading rate
(OLR), upflow velocity and temperature of treatment. The start-up period is continuing
until reaching steady-state operation, which is recognized by the changes in removal
efficiency below 10%.
Temperature is a significant variable where it enhances microorganisms to produce
methane from digestion organic matters. An investigation for the influence of the
temperature on the UASB performance included operation of two UASB reactors in the
same HRT of 7 days and OLRs of 10.74 kg COD m-3 d-1 but different temperatures of
treatment (mesophilic temperature of 37oC vs. thermophilic temperature at 55oC). Where
the temperature was increasing from 37 to 43oC, removal efficiency increment was
observed, consequently it had been concluded that the optimum range is the mesophilic
temperature up to 37oC and less than 43oC (Choorit et al., 2007). Furthermore,
temperature shock is of considerable phenomena. It usually occurs in seasonal countries
due to their temperatures varieties during the day. The influence of temperature shock has
been studied by Hwang et al. (1991) and Ke et al. (1996). The authors reported that as a
result of decreased the temperature by 15oC for 48h, a reduction in biogas production of
60% and was observed. The partial recovery of gas production took 5 days to reach 80%
of original level whereas the full recovery has been achieved after 30 days.
HRT is considered as the key operating parameter where its effectiveness is mainly
controlling the performance of UASB reactors. Many authors are in agreement by
considering HRTs of 8 hr is the optimum. The very long HRTs (over 10 hr) are affecting
adversely on the process of sludge granulation with a little removal efficiency increment
was obtained. The very short HRTs (under 1 hr) can be disadvantageous due to its
negative role of biomass washout (Alphenaar et al., 1993; Van Haandel et al., 1994; Yu et
al., 2000).
The pH value is also affected the UASB performance. The pH of influent has been
limited by Van Haandel & Lettinga (1994) between the ranges of 6.3 to 7.8. The change in
pH of treatment is an important factor for the UASB reactor stability. Some of
experiments have been conducted to illustrate the behavior of UASB system towards a
change in the substrate pH (Borja & Banks, 1995). Lowering the pH value from 6.8 to 6.6
9
by injecting HCl, gas production increased 40% as well as the concentration of CO2.
Where NaOH was added to raise the pH up to 7.4, an increment of biogas generation was
observed with decreasing in CO2 production.
Recently, modifications of UASB have been conducted in order to expand the use of
system and to increase its purpose. Some of suggested ideas have been practically
implemented. Lettinga et al. (1980) has been recommended adding natural ionic acids to
treatment of a very strong wastewater in order to enhance the digestion process.
Subsequently, it has been implemented by Leal et al. (2006) using additive hydrolytic
enzyme to remove oil and grease in treating dairy effluents. Yu et al. (2000) and Tiwari et
al. (2005) reported the possibilities of adding natural or artificial materials to increase the
sludge granule size and enhance the digestion of UASB reactor. One major drawback of
the UASB reactor is its long start-up period, which generally requires 2-8 months for the
development of anaerobic granular sludge (Liu et al., 2003). In order to reduce the
space-time requirements of UASB bioreactors towards a cheaper treatment, strategies for
expediting granular formation are highly desirable.
1.1.2 Application of PVA-gel carrier for wastewater treatment
The inert nuclei model for anaerobic granulation was initially proposed by Lettinga
et al. (1980). In the presence of inert micro-particles in an UASB reactor, anaerobic
bacteria could attach to the particle surfaces to form the initial biofilms, namely
embryonic granules. The mature granules can be further developed through the growth of
these attached bacteria under given operational conditions. The inert nuclei model was
supported by experimental evidences that addition of water absorbing polymer particles
were used to promote the formation of anaerobic granules (Imai et al., 1997).
Biomass entrapment within various hydrogels is among the progressive approaches
for the creation of enhanced granulation. Many gel matrices have been proposed as
possible carriers. Either natural biopolymers (polysaccharides such as alginate, agar,
carrageenan, etc. or proteins such as gelatin, collagen and others) or synthetic polymers
(polyvinyl alcohol, polyethers, polyacrylates, polyurethanes) can be used. These
polymeric materials were first described at the beginning of 1970s. In recent years,
poly(vinyl alcohol) (PVA)-gel which is an inexpensive and non-toxic synthetic polymer
10
has been widely used for immobilization of bioactive materials (Cao et al., 2002, Chen et
al., 1998; Lozinsky et al., 1998; Quan et al., 2009; Zhang et al., 2007). Because PVA-gel
possesses many attractive properties (i.e. hydrophilicity, reactivity, film formation,
resistance to oxidation), it is a potential biomass carrier that can be applied in the
fermentation industry, medicine, food, chemistry and the ecological engineering (Bai et
al., 2010). Table 1-2 shows the recent laboratory-scale work on removal of COD from
wastewaters using PVA-based biomass carriers.
Table 1-2 Five-year reports on COD removal using PVA-gel carriers (2005-2011)
Carrier Reactor Operational
time (days)
Substrate,
Temperature (oC)
HRT
(h) Reference
PVA entrapment Cinder filtration 4 days per
batch
Oil-field
wastewater, 30 96 Li (2005)
PVA beads Anaerobic fluidized
bed (AFB)
120 Corn steep liquor,
35 10
Zhang
(2009)
PVA-calcium
alginate pellets
Membrane
bioreactor (MBR)
330 Reactive Black 5
dye, 20 24
You
(2010)
PVA beads UASB 90 Ethylene glycol,
35 8
Zhang
(2011)
In the present work, PVA-gel beads were supplied by Kuraray Corporation, from
which it was first industrialized in the world. This is a small white spherical
bacteria-fixed carrier made from PVA resin. With an extremely fine net-like structure,
each sphere with diameter of 4 mm and specific gravity of 1.025 can sustain one billion
microorganisms. PVA gel is design to treat industrial and domestic wastewater through
bacterial activities. Fig. 1-5 shows the biological wastewater treatment system using
PVA-gel beads. Because it enables the use of smaller facilities and more efficient
processing than the conventional activated sludge method, this process is being adopted
in household septic tanks, factory wastewater facilities and sewage processing plants.
Removal efficiencies of biological oxygen demand (BOD5), chemical oxygen demand
(COD) and total nitrogen (TN) obtained from treatment of industrial wastewater
11
containing 600 mg BOD L-1, 200 mg COD L-1 and 600 mg TN L-1 is 99, 90 and 98%,
respectively. PVA-gel carrier has been selected for hundreds of industrial-scale water
treatment systems (Kuraray Corporation). It has also been applied for lab-scale anaerobic
bioreactors, including packed-bed reactor (Rouse et al., 2005), anammox reactor (Tran et
al., 2006; Quan et al., 2010; Li et al., 2011) and UASB reactor (Zhang et al., 2008; Khanh
et al., 2011). Quan et al. (2010) conducted an anammox reactor using modified PVA-gel
carrier with immobilization technique. Other authors used the original Kuraray’s PVA-gel
beads. Zhang et al. (2008-2011) carried out his experiments with UASB reactor using
PVA carrier treating high-strength wastewaters. The treatment of low-strength
wastewater is crucial in many developing countries, such as Vietnam, etc., thus, my study
focus on the UASB reactor using PVA-gel carrier treating low-strength wastewater.
Fig. 1-5 Kuraray’s wastewater treatment technology using PVA gel beads.
(Kuraray Annual Report, 2007)
12
1.2 Objectives of this study
COD reduction is one of the most common factors for validation of any wastewater
treatment facility. The aim of this study was to investigate COD removal from
low-strength wastewater with application of UASB reactors using PVA-gel beads. The
more specific objectives of the research included:
1. Establishing a UASB reactor treating low-strength wastewater under mesophilic
to psychrophilic conditions. The effect of temperature decrease on COD
reduction will be studied; besides, the acceptable organic loadings for
low-strength wastewater treatment by UASB reactor will also be investigated
under the decrease of hydraulic retention time. (Chapter 2);
2. Realizing the role of porous structure of PVA granules in UASB reactors. COD
removal performance and the dominant microbial species in two identical
bioreactors using PVA and poly(ethylene glycol)-gel carriers will be studied
(Chapter 3);
3. Studying the diversity and dynamics of microbial communities in two lab-scale
UASB bioreactors treating low-strength wastewater (Chapter 4);
4. Investigating the feasibility of applying a swim-bed reactor as post-treatment of
UASB effluents (Chapter 5).
References
Alphenaar, P.A., Visser, A., Lettinga, G. (1993): The effect of liquid upward velocity and
hydraulic retention time on granulation in UASB reactors treating wastewater with a
high sulphate content, Bioresource Technology, 3, 960–968.
Arcand, Y., Guiot, S.R., Desrochers, M., Chavarie, C. (1994): Impact of the reactor
hydrodynamics and organic loading on the size and activity of anaerobic granules,
Chemical Engineering Journal and Biochemical Engineering Journal, 56, 23–35.
Arching, B.K., Schmidt, J.E., Winther-Nielsen, M., Macario, A.J.L., de Macario, E.C.
(1993): Effect of medium composition and sludge removal on the production,
composition and architecture of thermophilic (55oC) acetate-utilizing granules from
13
an upflow anaerobic sludge blanket reactor, Applied and Environmental
Microbiology, 59, 2538–2545.
Bai, X., Ye, Z.F., Li, Y.F., Zhou, L.C., Yang, L.Q. (2010): Preparation of crosslinked
macroporous PVA foam carrier for immobilization of microorganisms, Process
Biochemistry, 45, 60–65.
Borja, R., Banks, C.J. (1995): Response of an anaerobic fluidized bed reactor treating
ice-cream wastewater to organic, hydraulic, temperature and pH shocks, Journal of
Biotechnology, 39 (3), 251–259.
Cao, G.M., Zhao, Q.X., Sun, X.B., Zhang, T. (2002): Characterization of nitrifying and
denitrifying bacteria coimmobilized in PVA and kinetics model of biological
nitrogen removal by coimmobilized cells, Enzyme and Microbial Technology, 30,
49–55.
Chen, K.C., Lee, S.C., Chin, S.C., Houng, J.Y. (1998): Simultaneous carbon-nitrogen
removal in wastewater using phosphorylated PVA-immobilized microorganisms,
Enzyme and Microbial Technology, 23, 311–320.
Choorit, W., Wisarnwan, P. (2007): Effect of temperature on the anaerobic digestion of
palm oil mill effluent, Journal of Biotechnology Research, 10 (3), 376–385.
Demirel, B., Scherer, P. (2008): The roles of acetotrophic and hydrogenotrophic
methanogens during anaerobic conversion of biomass to methane: a review,
Reviews in Environmental Science and Biotechnology, 7, 173–190.
Guiot, S.R., Pauss, A., Costerton, J.W. (1992): A structured model of the anaerobic
granules consortium, Water Science and Technology, 25, 1–10.
Habeeb, S.A., Aziz Bin Abdul Latiff, A.B., Zulkifli B.A. (2010): A review on Properties
of the digestion process in the upflow anaerobic sludge blanket (UASB) reactor.
Canadian Journal on Environmental, Construction and Civil Engineering, 1 (3),
58–70.
Hobson, P.N., Shaw, B.G. (1973): The bacterial population of piggery-waste anaerobic
digesters, Water Research, 8, 507–516.
14
Hulshoff Pol, L.W., de Castro Lopes, S.I., Lettinga, G., Lens, P.N.L. (2004): Anaerobic
sludge granulation, Water Research, 38, 1376–1389.
Hwang, P.C., Cheng, S.S. (1991): Treatment of p-cresol with a recirculating UASB
reactor using the concept of kinetic control, Water Science and Technology, 24,
133–140.
Imai, T. (1997): Advanced start-up of UASB reactors by adding of water absorbing
polymer, Water Science and Technology, 36, 399–406.
Ke, S.Z., Shi, Z., Zhang, T., Fang, H.H. (1996): Degradation of phenol in wastewater in
an upflow anaerobic sludge blanket reactor, Water Research, 30 (6), 1353–1360.
Khanh, D.P., Quan, L.M., Zhang, W., Hira D., Furukawa, K. (2011): Effect of
temperature on low-strength wastewater treatment by UASB reactor using
poly(vinyl alcohol)-gel carrier, Bioresource Technology, 102, 11147–11154.
Kuraray Annual Report (FY2007) www.kuraray.co.jp/ir/library/pdf/annual/ar2007.pdf
Leal, M.C.M.R., Freire, D.M.G., Cammarota, M.C., Sant Anna Jr. G.L. (2006): Effect of
enzymatic hydrolysis on anaerobic treatment of dairy wastewater, Process
Biochemistry, 41 (5), 1173–1178.
Lens, P., de Beer D., Cronenberg, C., Ottengraf, S., Verstraete, W. (1995): The use of
microsensors to determine distributions in UASB aggregates, Water Science and
Technology, 31, 273–280.
Lettinga, G., Velsen, A.F.M., Hobma, S.W., Zeeuw, W., Klapwijk, A. (1980): Use of the
upflow sludge blanket reactor concept for biological wastewater treatment,
Biotechnology and Bioengineering, 22 (4), 699–734.
Li, Q., Kang, C., Zhang, C. (2005): Wastewater produced from an oilfield and
continuous treatment with an oil-degrading bacterium, Process Biochemistry, 40,
873–877.
Li, Z.G., Hira, D., Fujii, T., Furukawa, K. (2011): Treatment capability and microbial
community of anammox process using PVA gel beads as biomass carriers,
Japanese Journal of Water Treatment Biology, 47 (4), 137–145.
15
Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic
granulation in UASB reactor, Water Research, 37 (3), 661–673.
Lozinsky, V.I., Plieva, F.M. (1998): Poly(vinyl alcohol) cryogels employed as matrices
for cell immobilization: 3. Overview of recent research and developments, Enzyme
and Microbial Technology, 23, 227–242.
MacLeod, F.A., Guiot, S.R., Costerton, J.W. (1990): Layered structure of bacterial
aggregates produced in an upflow anaerobic sludge bed and filter reactor, Applied
and Environmental Microbiology, 56, 1598–1607.
Quan, L.M., Khanh, D.P., Hira, D., Fujii, T., Furukawa, K. (2011): Reject water
treatment by improvement of whole cell anammox entrapment using polyvinyl
alcohol/alginate gel, Biodegradation, 22, 1155–1167.
Sankar Ganesh, P., Ramasamy, E.V., Gajalakshmi, S., Sanjeevi, R., Abbasi, S.A. (2007):
Studies on treatment of low-strength effluents by UASB reactor and its application
to dairy industry wash waters, Indian Journal of Biotechnology, 6, 234–238.
Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H., Nakamura, K.
(1998): Diversity of mesophilic and thermophilic granular sludge determined by
16S rRNA gene analysis, Microbiology, 22, 2655–2665.
Show, K.Y., Wang, Y., Foong, S.F., Tay, J.H. (2004): Accelerated start-up and enhanced
granulation in upflow anaerobic sludge blanket reactors, Water Research, 38,
2293–2304.
Rouse, J.D., Fujii, T., Sugino, H., Tran, H., Furukawa, K. (2005): PVA-gel beads as a
biomass carrier for anaerobic oxidation of anmmonium in a packed-bed reactor, In:
Proceedings of 5th International Exhibition and Conference on Environmental
Technology, Heleco’05, Athens, Greece, 1–9.
Tay, J.H., Xu, H.L., Teo, K.C. (2000): Molecular mechanism of granulation. I: H+
translocation-dehydration theory, Environmental Engineering, 126, 403–410.
Tiwari, M.K., Guha, S., Harendranath, C.S., Tripathi, S. (2005): Enhanced granulation
by natural ionic polymer additives in UASB reactor treating low-strength
16
wastewater, Water Research, 40 (7), 3801–3810.
Tran, T.T.H., Luong, N.K., Liu, Z.J., Fujii, T., Rouse, J.D., Furukawa, K. (2006):
Nitrogen removal by immobilized anammox sludge using PVA gel as biocarrier,
Japanese Journal of Water Treatment Biology, 42 (3), 139–149.
Van Haandel, A., Kato, M.T., Cavalcanti, P.F.F., Florencio, L. (2006): Anaerobic reactor
design concepts for the treatment of domestic wastewater, Environmental Science
and Bioechnology, 5, 21–38.
Van Haandel, A.C., Lettinga, G. (1994): Anaerobic sewage treatment: A practical guide
for regions with a hot climate, John Wiley & Sons, New York.
Whitman, W.B., Boone, D.R., Koga, Y., Keswani, J. (2001): Taxonomy of methanogenic
Archaea, In: Boone DR, Castenholz RW, Garrity GM (eds), Bergey’s manual of
systematic bacteriology, vol 1. Springer, 211–294.
Yu, J.H., Chen, M.J., Yue, P.L. (2000): Distribution and change of microbial activity in
combined UASB and AFB reactors for wastewater treatment, Bioprocess and
Biosystems Engineering, 22 (4), 315–322.
Zhang, L.S., Wu, W.Z., Wang, J.L. (2007): Immobilization of activated sludge using
improved polyvinyl alcohol (PVA) gel, Journal of Environmental Sciences, 19,
1293–1297.
Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008): PVA
gel beads enhance granule formation in a UASB reactor, Bioresource Technology,
99, 8400–8405.
Zhang, W., Xie, Q., Rouse, J.D., Qiao, S., Furukawa, K. (2009): Treatment of
high-strength corn steep liquor using cultivated polyvinyl alcohol gel beads in
anaerobic fluidized-bed reactor, Bioscience and Bioengineering, 107 (1), 49–53.
Zhang, W., Zhang, X., Wang, D., Koga, Y., Rouse, J.D., Furukawa, K. (2011): Trace
elements enhance biofilm formation in UASB reactor for solo simple molecule
wastewater treatment, Bioresource and Technology, 102, 9296–9299.
17
Chapter 2 Effect of temperature on UASB treatment of
low-strength wastewater using poly(vinyl alcohol)-gel carrier
2.1 Introduction
COD reduction is one of the most common factors for validation of any facility that
has to comply with wastewater treatment regulations. Failure to deal appropriately with
COD reduction can result in non-compliance fines. UASB reactor is among the most
popular anaerobic treatment process in which organic matter is digested, absorbed, and
metabolized into bacterial cell mass and biogas, thus COD reduction can be successfully
achieved (Seghezzo et al., 1998; Tchobanoglous et al., 2003). PVA, which is a readily
available low-cost polymeric gel, has previously been shown to be an effective biomass
carrier in UASB reactors treating high-COD-containing wastewater (Zhang et al., 2008a
and 2008b). Further experiments were therefore conducted to evaluate the feasibility of
using UASB reactors for low-COD-containing wastewater treatment. It is widely known
that low-COD-containing wastewater [<700 mg-COD L-1 (Bhunia and Ghangrekar,
2007), <1000 mg-COD L-1 (Kumar et al., 2007; Ndon et al., 1997)] is mostly
domestically generated, but sometimes consists of industrial effluents. A number of
studies of anaerobic treatment of such wastewater by a UASB process have been
documented (Bhunia and Ghangrekar, 2008; Singh et al., 1995; Uemura and Harada,
2000). However, the use of PVA-gel carrier in UASB reactors has not been widely
reported. In addition, low-strength wastewaters such as municipal sewage and
food-processing effluents are often discharged at ambient temperatures (15–20°C).
UASB reactors, however, are commonly operated under mesophilic conditions at around
35°C for high-rate anaerobic treatment. These conditions increase the operating costs of
anaerobic systems (Angenent et al., 2001). Thus, the UASB process is more attractive
under lower-temperature conditions that require less energy. This paper addresses the
effects of temperature (mesophilic to psychrophilic conditions) on the COD reduction by
a UASB reactor using PVA-gel carrier. Moreover, the potential of UASB reactor under
shorten HRT was investigated. The stable influent COD concentrations and a stepwise
decrease in HRT allow savings in space and time requirements of UASB process.
18
2.2 Materials and methods
2.2.1 Experimental setup
Fig. 2-1 Schematic diagram of 3.9L-cuboid-shaped UASB reactor (A),
blank PVA-gel beads (B), macrostructure of a PVA-gel bead, scale bar 20 μm (C),
cultivated PVA-gel beads (D)
The laboratory-scale UASB reactor constructed in cuboid shape was made of
Plexiglas® with a total volume of 3.9 L (60x60x110 mm). The reactor had six sampling
ports and a peristaltic pump was used to maintain the fluidity of the sludge bed (Fig.
2-1A). The influent was injected at the bottom-end of the reactor with a stepwise increase
in flow rates. Table 2-1 shows the strategy for operating UASB reactor under short
hydraulic retention times. HRTs less than 2h and 1h were applied, involving with high
A
Recycle port
PVA gel carrier
P
Gas-solid separator
Influent
Gas
co
llect
ion
NaCl
solution
SP-1
SP-2
SP-3
SP-4
SP-5
Effluent port
P
Water bath
19
organic loading rates. In comparison with HRTs of 6h and more in conventional UASB,
these HRTs was short, allows savings in time for treatment process. The treatment
temperature was decreased allows to save input of energy supplied for the reactor. The
treatment of low-strength wastewater is preferably carried out at ambient temperature.
The reactor temperature was referred to the mean annual temperatures in
moderate-climate and tropical-climate countries. Depending on the geographical location,
mean annual temperatures of wastewater have been reported in the range 3–27°C in the
United States and from 30 to 35°C for countries in Africa and the Middle East
(Tchobanoglous et al., 2003).
Table 2-1 Operational parameters
HRT
(h)
Flow rate
(L h-1)
Upflow velocity
(m h-1)
Loading rate
(kg-COD m-3 d-1)
Time (days)
Period I
(35oC)
Period II
(25oC)
Period III
(15oC)
2.00 2.0 0.9 5.0±5.3 0−17
1.56 2.5 1.1 6.4±6.6 17−27 70−95 190−205
0.87 4.5 1.7 11.5±12.0 27−33 95−110 205−224
0.60 6.5 2.2 17.0±17.5 33−39 110−130 224−240
0.49 8.0 2.6 21.0±22.0 39−45 130−150 240−265
0.39 10 3.2 26.0±27.5 45−53 150−180 265−270
0.33 12 3.8 27.5±31.5 53−56 180−185 270−275
0.28 14 4.3 36.4±37.1 56−61 185−190 275−278
0.25 16 4.9 39.1±39.7 65−67
0.23 17 5.1 42.5±44.5 67−69
0.22 18 5.4 46.0±47.5 69−70
2.2.2 Synthetic medium
The influent containing COD concentrations of 430 ± 20 mg L−1 was prepared by
diluting concentrated synthetic wastewater composed of bonito extract (40 g L−1),
peptone (60 g L−1), NaHCO3 (80 g L−1), NaCl (10 g L−1), KCl (2.8 g L−1), CaCl2·2H2O
20
(2.8 g L−1), and MgSO4·7H2O (2.0 g L−1). Influent pH was approximately 7.1-7.3. The
5-day soluble biochemical oxygen demand (BOD5) was about 65% of the soluble COD.
2.2.3 Biomass carrier
The original PVA-gel beads (4-mm diameter) were supplied by the Kuraray Co., Ltd
(Osaka, Japan) (Figs. 2-1B, 1C). The cultivated PVA-gel beads originated from a
previously studied anaerobic fluidizing reactor. The volume of bio-carrier was 0.8 L.
These beads were black when transferred to the UASB reactor (Fig. 2-1D) and had an
average settling velocity of 177 m h−1. The settling velocities of the PVA gel were
determined in quiescent water in a 2-L graduated cylinder (height 42 cm).
2.2.4 Analytical methods
Effluent filtered through a 1.0-μm membrane filter was used for analysis of soluble
components. Soluble COD concentrations were measured by the closed reflux
colorimetric method (APHA, 1995). The evolved gas was collected through a gas–solid
separator and the volume was measured using an inverted cylinder containing tap water
with the pH lowered to 3.0 using 1N H2SO4. Methane analyses were performed using a
GC-14B gas chromatograph (Shimadzu, Kyoto, Japan). Determination of BOD5 was
carried out using the dilution method and total nitrogen (TN) concentration was measured
using the persulfate digestion-UV spectrophotometric method and Standard Methods
(APHA, 1995).
Scanning electron microscopic observations of the PVA-gel structure were
conducted as follows: a PVA-gel bead was cut into two pieces and washed twice, for 5
min each time, with 0.1 M phosphate buffer (pH 7.4). The PVA-gel pieces were hardened
for 90 min in a 2.5% glutaraldehyde solution prepared with 0.1 M phosphate buffer (pH
7.4). Next, the samples were washed in the buffer solution three times, for 10 min each
time, and then fixed for 90 min in a 1.0% OsO4 solution prepared with 0.1 M phosphate
buffer. After washing the samples three times, for 10 min each time, in the buffer solution,
they were dehydrated in serially graded solutions of ethanol at concentrations of 10%,
30%, 50%, 70%, 90%, and 95% for 10 min each, and then twice at a concentration of
99.5% for 30 min each time. The samples were frozen and dried using a freeze-drier
(JEOL JFD-300, JEOL, Tokyo, Japan), and then sputter-coated with gold for 100 s with
21
an ion-sputtering device (JEOL JFC-1100E). Finally, the samples were observed with a
scanning electron microscope (JEOL JSM 6390LV).
A sludge sample attached to PVA gel was taken from at sampling port 1 (day 270).
The sludge samples used for DNA extraction were stored at −20°C prior to analyses. The
sludge sample was first ground with a pestle under liquid nitrogen. Meta-genomic DNA
was extracted using an ISOIL kit (Nippon Gene, Tokyo, Japan) according to the
manufacturer’s instructions. The archaeal 16S rRNA genes in the DNA were amplified by
PCR with Phusion High-Fidelity DNA polymerase (Finnzymes, Espoo, Finland) and the
primers of Parch519f (forward primer: 5’-CAGCCGCCGCGGTAA-3’) and ARC915r
(reverse primer: 5’- GTGCTCCCCCGCCAATTCCT -3’) (Coolen et al., 2004). PCR was
carried out according to the following thermocycling parameters: 30 s initial denaturation
at 98°C, 25 cycles of 10 s at 98°C, 20 s at 65°C, 20 s at 72°C, and 5 min final elongation
at 72°C. The amplified products were electrophoresed on a 1% agarose gel. A band (~0.4
kb) on the agarose gel was excised, and the DNAs in that band were extracted and
purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI,
USA).
The purified DNA fragments were ligated into the EcoRV site of pBluescript II KS +
(Stratagene, La Jolla, CA, USA). Escherichia coli DH5 was transformed using the
constructed plasmids. The plasmids were extracted from the clones carrying them by the
alkaline method. The DNA fragments were sequenced using a 3130xl genetic analyzer
and BigDye terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA,
USA). Operational taxonomic units (OTUs) were defined by a 1% distance level in the
nucleotide sequences. The sequences were compared with those in the nr database by the
basic local alignment search tool (BLAST) program available on the NCBI website
(http://blast.ncbi.nlm.nih.gov/Blast.cgi).
2.3 Results
2.3.1 UASB reactor performance
The reactor was operated at temperatures varying from 35°C (Period I) to 25°C
(Period II), and 15°C (Period III) as shown in Table 2-2. The experiments were carried
22
out with stable influent COD concentrations (430±20 mg L−1) and a stepwise decrease in
HRT, which reduces the treatment space and time.
Table 2-2 Performance of UASB reactor during Period I-III
Parameters 35oC (I) 25oC(II) 15oC (III)
Influent COD (mg L-1) 425±15 429±16 425±8
Effluent COD (mg L-1) 96±80 175±30 325±40
COD loading rate (kg m-3 d-1) 22±17 17±10 14±7
COD removal rate (kg m-3 d-1) 14±11 10.5±6.5 4±2
COD removal efficiency (%) 76±10 60±10 31±3
Specific COD removal rate (kg m3-PVA-gel−1 d−1) 60±46 50±31 19±9
CH4 yield (m3 kg−1-CODremoved) 0.25±0.04 0.15±0.06 0.02±0.01
Fig. 2-2 shows the time courses of COD removal. Influent COD concentration was
kept stable and HRT was shortened, leading to an increase in loading rates and specific
COD removal rate. Due to the decrease of temperature, the methane yield reduced and
effluent COD concentrations increased stepwise. The effluent COD concentrations were
below 200 mg L-1 during Period I-II. At extremely short HRTs, COD removal rates
dropped to low values that indicated the COD overloads.
The reactor was started up at 35 °C and an HRT of 2.0 h. From day 20, the HRT was
decreased stepwise. As the HRT was shortened to 0.26 h, the COD loading rate reached
40 kg-COD m−3 d−1. A COD removal rate of 28 kg-COD m−3 d−1, correlated with a high
specific COD removal rate of 137 kg-COD m3-PVA-gel−1 d−1, was achieved. The
methane yield reached 0.25 m3 kg−1-CODremoved. At the extremely short HRT of 0.22 h,
the COD removal rate dropped to 26 kg-COD m−3 d−1 with a decrease in methane yield to
0.21 m3 kg−1-CODremoved.
Period II at 25°C was started from day 70. The COD removal rate reached 17
kg-CODremoved m−3 d−1 at an HRT of 0.39 h. The maximum loading rate was 27 kg-COD
m−3 d−1. A specific COD removal rate of 80 kg-COD m3-PVA-gel−1 d−1 and a methane
23
yield of 0.21 m3 kg−1-CODremoved were obtained. The HRT was then shortened to 0.28 h,
and thereafter it was increased to 1.56 h for the third period of operation, at 15 °C, from
day 190.
Period I (35oC)
Period II (25oC)
Period III (15oC)
Fig. 2-2 Time courses of COD removal
During Period III, a maximum loading rate of 21 kg-COD m−3 d−1 was obtained
using stepwise decreases in HRT. The COD removal rate reached 6 kg-COD m−3 d−1
under HRT 0.49 h. A specific COD removal rate of 28 kg-COD m3-PVA-gel−1 d−1 was
obtained, and the methane yield was reduced to 0.19 m3 kg−1-CODremoved. Overall, COD
removal rate decreased by 50% with each temperature decrease of 10°C.
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
0
5
10
15
20
25
30
35
HR
T (
h)
Tem
per
atu
re (
o C) Temperature
HRT
0 5 10 15 20 25 30 35 40 45 50
050
100150200250300350400450500
CO
D lo
adin
g ra
te,
CO
D r
emov
al r
ate
(kg-
CO
D m
-3d
-1)
CO
D c
once
ntr
atio
n (
mg
L-1
)
Influent COD Effluent COD COD loading rate COD removal rate
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0
20
40
60
80
100
120
0 50 100 150 200 250 300
Met
han
e yi
eld
(m
3k
g-1-C
OD
rem
oved
)
Sp
ecif
ic C
OD
rem
oval
rat
e (k
g-C
OD
m3 -
PV
A-g
el-1
d-1
)
Time (day)
Specific COD removal rateMethane yield
24
In each period of operation, a steady-state phase was reached before COD overload
conditions occurred; overload conditions occurred during days 65–69, days 180–189, and
days 265–278. The HRTs for each COD overload condition were 0.26 h, 0.39 h, and 0.49
h at 35°C, 25°C, and 15°C, respectively. The changes in COD concentrations inside the
UASB reactor during the steady-state phases were measured (Fig. 2-3). The samples were
taken from the three sampling ports (lower port SP-3; middle port SP-4; higher port SP-5)
located at heights of 35, 50, and 65 cm above the reactor bottom.
The steady-state COD concentrations were compared with the influent and effluent
COD concentrations. At the same HRT (0.6 h) and an up-flow linear velocity of 2.2 m h−1,
only 7–15% of the influent COD concentration (30 to 60 mg-COD L−1, depending on the
reactor temperatures) was removed from the upper part of UASB reactor where the
sampling ports are located. Thus, it could be concluded that organic matter was mostly
degraded by the PVA-gel layer in the lower part of reactor. High COD consumption in the
sludge bed at 35°C and 25°C periods demonstrated that the PVA-gel beads played an
important role as support materials in retaining a sufficient amount of anaerobic sludge in
the UASB reactor. Under short HRTs, temperatures as low as 15°C may lead to limited
biodegradation, thus high concentrations of residual COD in the upper part of UASB
reactor were observed.
Fig. 2-3 COD concentrations at different sampling ports
under loading rate of 17 kg-COD m−3 d−1 (HRT 0.6 h)
0
50
100
150
200
250
300
350
400
450
CO
D c
once
ntr
atio
n (
mg
L-1
)
Influent port Lower port Middle port Higher port Effluent port
35oC 25oC 15oC
25
2.3.2 Effects of temperature decrease and extremely short HRTs
A decrease in biochemical reaction rate is often related to a decrease in treatment
temperature. The effect of reactor temperature (T) on COD removal rate (k) is given by
the following empirical equation (Tchobanoglous et al., 2003):
(1)
where kT is the COD removal rate at temperature T °C, k20 is the COD removal rate at
20°C, and θ is the temperature coefficient 1.056 (20-30oC) and 1.135 (4-20oC). The θ
values for cold temperatures (below 20°C) were larger than those for medium
temperatures, implying that psychrophilic conditions had more influence on the COD
removal rate than mesophilic conditions did. This trend is illustrated in Fig. 2-4 that
shows the temperature dependence of COD removal rates under HRTs ranging from 1.56
h to 0.49 h.
Fig. 2-4 Temperature dependence of COD removal rate
The Eq. (1) permits the calculation of the temperature coefficient (θ) based on
experimental COD removal rates. The θ value was determined to be 1.05 to 1.09
(average: 1.07) at temperatures ranging from 35°C to 15°C. The θ values in the present
study were consistent with previously reported results (Table 2-3).
0
5
10
15
20
15 25 35
CO
D r
emov
al r
ate
(kg-
CO
D m
-3d
-1)
Temperature (oC)
HRT 1.56 h
HRT 0.87 h
HRT 0.60 h
HRT 0.49 h
26
Table 2-3 Comparison of temperature coefficients (θ) for anaerobic treatments
Temperature coefficient (θ) Temperature References
1.047 ≥ 20oC Phelps (1944)
1.135
1.056
4−20oC
20−30oC Schroepfer et al., (1964)
1.09 (PVA beads)
1.05 (PVA beads)
15−25oC
25−35oC This study
1.07-1.11 (star channel)
1.06-1.11 (pall rings)
1.04-1.05 (gravel)
15−25oC El-Monayeri et al., (2007)
All values of θ were larger than 1, showing that the COD removal rate decreased as
the temperature decreased. El-Monayeri et al. (2007) discussed that the structure of
biomass carrier influences the θ values. The reported values of θ varied from 1.05 to 1.11
for three types of support media (gravel, pall rings and star channel). The highly porous
carriers, such as star channel and pall rings have the higher values of θ than non-porous
carriers. The average value of θ in case of PVA-gel carrier was 1.07 consistent with the
range of θ values for the highly porous carriers.
2.3.3 Characteristics of attached growth
Fig. 2-5 Scanning electron microscopic images of a matured PVA-gel bead:
cross-section (A), surface (B) and interior (C)
A B C
27
The PVA beads on days 70, 170, and 270 had average settling velocities of 194, 199,
and 201 m h−1, respectively, greater than the value of 177 m h−1 in the start-up process. In
comparison, reported typical values for anaerobic biomass granules are in the range
18–100 m h−1 (Quan et al., al., 2011). Because of biomass attachment, the color of
PVA-gel beads turned to black. The outer surface of matured PVA-gel was covered with a
dense sludge layer (Fig. 2-5). Cracks appeared as a result of gas release. The porous
structure of PVA-gel provided a matrix for biomass development to the inner core of bead.
The use of PVA-gels in lab-scale UASB reactors treating different types of wastewater
under temperature variation is summarized in Table 2-4. Zhang et al. (2008a) conducted
his experiments using PVA beads as seed nuclei in a UASB reactor treating high-strength
synthetic wastewater made of corn steep liquor. The PVA-gel beads had a similar density
to natural granules, 1.03–1.08 g cm−3, which has been shown to be beneficial for
microbial attachment (Schmidt and Ahring, 1996).
Table 2-4 Performance of lab-scale UASB reactors using PVA-gel carrier
Operational condition UASB I
(Zhang et al., 2008a; 2008b)
UASB II
(this study)
Reactor temperature 35 °C 35 °C 35 °C 25 °C 15 °C
Reactor volume (L) 7.5 7.5 3.9 3.9 3.9
HRT (h) 48−10 14.4−8.0 2.00−0.22 1.56−0.28 1.56−0.28
Synthetic medium Corn steep liquor Ethylene glycol Peptone-bonito extract
Influent COD concentration (mg L−1) 770-11000 600-3800 430±20
COD loading rate (kg-COD m−3 d−1) 0.4−22.5 1.0−11 5.2−47 6.3−37 6.4−35.5
COD removal rate (kg-COD m−3 d−1) 20.5 10.7 25 16 12
Operation period (day) 280 137 70 118 98
PVA-gel size (mm diameter) 2−3 3−4 4 4 4
Packing ratio (%) 8 12 20 20 20
Specific COD removal rate (kg-COD m3-PVA-gel−1 d−1)
154 78 119 81 60
Settling velocity (m h−1) 200 322 194 199 201
28
During the experimental periods, the PVA-gel beads always settled at the bottom of
the reactor. The smaller PVA-gel beads (2~3-mm diameter) promoted biomass
attachment, but the bigger ones (4-mm diameter) were helpful for retaining the beads in
the reactor (Zhang et al., 2008a and 2008b). Hence, the bigger-size PVA-gel beads were
selected for the experiments in our study. As the reactor temperature decreased from
35 °C to 15 °C, the specific COD removal rate decreased by nearly 50%, from 119 to 60
kg-COD m3-PVA-gel−1 d−1; however, the settling velocity increased. The mechanism of
anaerobic sludge granulation in UASB reactors is poorly understood, but the increase in
settling velocity could be explained by the development of attached biomass layers on the
surface of PVA-gel.
2.3.4 Archaeal community analysis
In the UASB reactor, sequential metabolic processes are carried out by different
groups of bacteria such as hydrolytic bacteria, fermentative acidogenic bacteria,
acetogenic bacteria, and methanogens. The archaeal communities for UASB sludge on
the surface of the PVA-gel carrier treating low-strength organic wastewater in the present
study is shown in Table 2-5.
Eight different OTUs were identified in the archaeal clone library of the sludge
sample (day 270). OTU 1 and OTU 2 had 100% and 98% sequence identity with
Methanobacterium beijingense strain 4-1 (AY552778), respectively. Methanobacterium
beijingense strain 4-1 was isolated from an anaerobic digester in Beijing, China. The
strain has been shown to use H2/CO2 and formate for growth and methane production.
OTU 3 and OTU 4 had 100% sequence identity with Methanobacterium formicicum
strain FCam (AF028689) and Methanobacterium formicicum strain S1 (DQ649309),
respectively. Methanobacterium formicicum strain FCam was isolated from rice-field soil
in France. The strain has also been shown to use H2/CO2 and formate for growth and
methane production. Thus, 36% (12 clones/33 clones) of archaeal members in the UASB
sludge community were thought to belong to the genus of Methanobacterium which grow
on H2/CO2 and formate.
OTU 5 and OTU 6 had 99% sequence identity with Uncultured Methanosarcinales
archaeon clone QEEC1CH041 (CU917466) and 97% sequence identity with Uncultured
29
Methanosaeta sp. clone DI_C03 (AY454761), respectively.
Table 2-5 Archaeal communities of UASB sludge
OTU Taxon GenBank Accession
Identity (%)
Number of clones
1 Uncultured Methanobacterium sp. clone WA1
Methanobacterium beijingense strain 4-1
EU88817
AY552778
100
100
6/33
2 Uncultured Methanogenic archaeon isolate SSCP band As11
Methanobacterium beijingense strain 4-1
DQ682559
AY552778
99
98
1/33
3 Uncultured Methanobacterium sp. clone SWA3
Methanobacterium formicicum strain FCam
EU888014
AF028689
100
100
4/33
4 Uncultured Methanobacterium sp. clone SWA4
Methanobacterium formicicum strain S1
EU888013
DQ649309
100
100
1/33
5 Uncultured Methanosarcinales archaeon clone QEEC1CH041
Uncultured Methanosarcinales archaeon clone QEEC1AB061
CU917466
CU917434
99
99
1/33
6 Uncultured archaeon isolate ARC7_G07
Uncultured Methanosaeta sp. clone DI_C03
FM162215
AY454761
99
97
1/33
7 Archaeon enrichment culture clone C4-15C-A
Uncultured archaeon 44A-1
GU196162
AF424765
100
100
12/33
8 Uncultured crenarchaeote clone F31
Uncultured crenarchaeote clone GoM_GC232_4463_Arch73
EU910616
AM745241
99
94
7/33
It is widely known that Methanosarcina and Methanosaeta are important aceticlastic
methanogenic species. Methanosarcina are the most versatile methanogens. They can use
various sources of carbon, including methylamines and acetate. Methanosaeta also can
use acetate as a substrate, although their growth rate is slower than that of
Methanosarcina. Methanosaeta was found to be dominant at very low acetate
concentrations and has a high affinity for acetate (Kongjan et al., 2011). On the other hand,
the genus Methanosarcina was able to tolerate high acetate concentrations and has a
30
much lower substrate affinity, but higher maximum specific use rate (Karakashev et al.,
2005; Tatara et al., 2005). Thus, the presence of Methanosarcina and Methanosaeta
species would support the proposition that methanogens with slow growth rates like
Methanosaeta can easily bind to PVA-gel, allowing longer sludge retention times in the
UASB reactor.
OTU 7 and OTU 8 had 100% sequence identity with Archaeon enrichment culture
clone C4-15C-A (GU196162) and Uncultured archaeon 44A-1 (AF424765), 94-99%
sequence identity with Crenarchaeote-relatives (EU910616 and AM745241). The
presence of these sequences can be explained by the distinctive operating conditions of
the UASB reactor under low temperatures and extremely short hydraulic retention time.
2.3.5 Post-treatment of UASB reactor effluent
The benefits of anaerobic wastewater treatment in UASB reactors are fully realized
if a post-treatment system is available. This process should be easy to operate, stable
under shock loads, and have low energy-requirements because the UASB reactor is
operated under various temperatures and HRTs. Fig. 2-6 shows the effluent BOD and
COD concentrations. The BOD5/COD ratio was 0.6, so the effluents from our UASB
reactor contain easily biodegradable organic carbon.
Fig. 2-6 BOD5, COD and TN concentrations in UASB effluents
under loading rates of 5 to 40 kg-COD m−3 d−1
Nitrogen removal is also often required before discharging treated effluents. The
influent total nitrogen (TN) concentrations were from 35 to 40 mg L−1, of which 30% was
removed from the influent by the UASB reactor. As shown in Fig. 2-6, the UASB
effluents contained low TN concentrations. The economical post-treatment of such
0
50
100
150
200
250
300
350
BOD5 COD TN
Con
cen
trat
ion
(m
g L
-1) 35oC 25oC 15oC35oC 25oC 15oC
BOD5
31
UASB effluents has been documented using a down-flow hanging-sponge system
(Takahashi et al., 2011); a sequencing batch reactor system (Moawad et al., 2009); an
electrocoagulation system (Yetilmezsoy et al., 2009); slow sand filters (Tyagi et al.,
2009); and polishing ponds (Sato et al., 2006), etc. Other studies of the development of
swim-bed technology demonstrated that swim-bed-attached growth bioreactors showed
excellent performance in organic wastewater post-treatment (Cheng et al., 2006). With
respect to the use of PVA-based biomass carriers, recently developed anammox reactors
have been reported as providing a promising nitrogen removal process (Ge et al., 2009;
Quan et al., 2011). These results show that further study is needed to evaluate
cost-effective systems for the post-treatment of UASB reactor effluents.
2.4 Discussion
It is widely known that temperature is an important factor in anaerobic treatment of
domestic wastewater. In addition, temperature shifts may cause higher suspended solids
levels in effluents and a decrease in the removal efficiencies of soluble COD (Morgan
and Allen, 2003; Ndon et al., 1997); the accumulation of suspended solids present in
domestic wastewater may decrease the methanogenic activity of the sludge, and also
causes formation of scum layers. Sudden washout of sludge may occur if these scum
layers are not stabilized within the reactor. In this situation, long HRTs and relatively
low organic loading rates are needed, thus the scope for high-rate wastewater treatment
is limited.
The UASB reactor showed the ability to sustain shock loads; however, it should be
prevented from overloading. In the present study, the recognition of COD overload
during each period of operation based on the drops of COD removal rate as showed in Fig.
2-2. Our findings must be viewed in the light of some limitations. One potential limitation
is that temperature control of the UASB reactor was needed, even though operation at
ambient temperatures is preferred. This was because of large variations in the ambient
temperature; these variations may cause unexpected effects in the reactor performance
under extremely short HRTs. This study also did not cover temperatures below 10 °C,
which has been a challenge for many biological treatment processes. However, the results
from this study demonstrated the treatment feasibility of UASB reactors at low
temperatures.
32
The use of PVA-gel as the biomass carrier in UASB reactors has not been widely
documented. UASB reactors are required to operate under various temperatures,
depending on seasonal conditions. The present study addressed the effects of temperature
change on the treatment performance of a UASB reactor. It was found that the COD
removal rate of UASB reactor decreased by 50% for a temperature decrease of 10 °C.
Extremely short HRTs could not be used at low temperatures because COD overload
occurred. Also, the characteristics of matured PVA-gel beads were found to be affected
by the wastewater constituents.
This study presented trends for COD removal rate against COD loading rate in
agreement with those reported by El-Monayeri et al. (2007). The key feature of UASB
process that allows higher volumetric COD loadings than as in other anaerobic processes
is the development of a dense granulated sludge (Ghangrekar et al., 2005; Tchobanoglous
et al., 2003). Several months may be required to develop this granulated sludge. A seed is
often supplied from other facilities to accelerate the reactor start-up. The UASB reactor in
our study was seeded with cultivated PVA-gel obtained from a previous anaerobic
fluidizing bed reactor, resulting in a short start-up phase.
Recently, there has been increasing interest in the mechanisms of granule
development inside UASB reactors (Bhunia and Ghangrekar, 2007; Liu et al., 2003;
Vlyssides et al., 2008). Habeeb et al. (2011) assessed five key factors affecting UASB
granulation, namely (1) temperature, (2) organic loading rate, (3) pH and alkalinity, (4)
nutrients, and (5) cations and minerals. The present study covered the effects of
temperature and organic loading rate on PVA-gel carrier. Further work should assess the
development of granules in terms of the other factors. In addition, it has been
demonstrated experimentally that a high COD removal rate can be achieved by preparing
active microorganisms inside gel biomass carriers (Isaka et al., 2011; Quan et al., 2011).
These methods can be applied to the attached immobilization of useful microorganisms.
2.5 Conclusions
Two important findings were obtained from this study:
1) The effect of temperature on the treatment of low-strength wastewater in a UASB
reactor using PVA-gel carrier was investigated. The COD removal rate was reduced by
33
50% when the temperature was decreased by 10 °C;
2) The relationship between COD removal rate and treatment temperature was
experimentally evaluated. The average temperature coefficient (θ) was determined to be
1.07.
References
APHA, AWWA, WPCF (1995): Standard Methods for the Examination of Water and
Wastewater, 19th ed., American Public Health Association, Washington, DC.
Angenent, L.T., Banik, G.C., Sung, S. (2001): Anaerobic migrating blanket reactor
treatment of low-strength wastewater at low temperatures, Water Environment
Research, 73 (5), 567–574.
Bhunia, P., Ghangrekar, M.M. (2007): Statistical modeling and optimization of biomass
granulation and COD removal in UASB reactors treating low strength wastewater,
Bioresource Technology, 99, 4229–4238.
Cheng, Y.J., Watanabe, Y., Qiao, S., Koyama, T., Furukawa, K. (2006): Comparison of
treatment capacity of swim-bed technology and conventional activated sludge
process for domestic wastewater treatment, Japanese Journal of Water Treatment
Biology, 42 (3), 129–157.
Coolen, M.J.L., Hopmans, E.C., Rijpstra, W.I.C., Muyzer, G., Schouten, S., Volkman,
J.K., Sinninghe, D.J.S. (2004): Evolution of the methane cycle in Ace Lake
(Antarctica) during the Holocene: response of methanogens and methanotrophs to
environmental change, Organic Geochemistry, 35, 1151–1167.
El-Monayeri, D.S., Atta, N.N., El-Mokadem, S., Aboul-Fotoh, A.M. (2007): Effect of
organic loading rate and temperature on the performance of horizontal biofilters, In:
Proceedings of Eleventh International Water Technology Conference, IWTC11 2007,
Sharm El-Sheikh, Egypt, 671–682.
Ge, Y.S., Yamaguchi, A., Sakuma, H. (2009): Study on the performance of anaerobic
ammonium oxidation treatment using PVA gel as a carrier, Water Science and
Technology, 59 (5), 1037–1041.
34
Ghangrekar, M.M., Asolekar, S.R., Joshi, S.G. (2005): Characteristics of sludge
developed under different loading conditions during UASB reactor start-up and
granulation, Water Research, 39, 1123–1133.
Habeeb, S.A., Aziz Bin Abdul L.A.B., Zawawi, B.D., Zulkifli, B.A. (2011): A review
on granules initiation and development inside UASB reactor and the main factors
affecting granules formation process, International Journal of Energy and
Environment (IJEE), 2 (2), 311–320.
Isaka, K., Itokawa, H., Kimura, Y., Noto, K., Murakami, T. (2011): Novel autotrophic
nitrogen removal system using gel entrapment technology, Bioresource
Technology, 102 (17), 7720–7726.
Karakashev, D., Batstone, D., Angelidaki, I. (2005): Influence of environmental
conditions on methanogenic compositions in anaerobic biogas reactors, Applied and
Environmental Microbiology, 71 (1), 331–338.
Kongjan, P., O-Thong, S., Angelidaki, I. (2011): Performance and microbial community
analysis of two-stage process with extreme thermophilic hydrogen and
thermophilic methane production from hydrolysate in UASB reactors, Bioresource
Technology, 102, 4028–4035.
Kumar, A., Yadav, A.K., Sreekrishnan, T.R., Satya, S., Kaushik, C.P. (2007): Treatment
of low strength industrial cluster wastewater by anaerobic hybrid reactor,
Bioresource Technology, 99, 3123–3129.
Liu, Y., Xu, H.L., Yang, S.F., Tay, J.H. (2003): Mechanisms and models for anaerobic
granulation in upflow anaerobic sludge blanket reactor, Water Research, 37 (3),
661–673.
Moawad, A., Mahmoud, U.F., El-Khateeb, M.A., El-Molla, E. (2009): Coupling of
sequencing batch reactor and UASB reactor for domestic wastewater treatment,
Desalination, 242, 325–335.
Morgan, S.F., Allen, D.G. (2003): Effects of temperature transient conditions on aerobic
biological treatment of wastewater, Water Research, 37 (15), 3590–3601.
35
Ndon, U.J., Dague, R.R. (1997): Effects of temperature and hydraulic retention time on
anaerobic sequencing batch reactor treatment of low-strength wastewater, Water
Research, 31 (10), 2455–2466.
Phelps, E.B. (1944): Stream Sanitation, John Wiley & Sons, New York.
Quan, L.M., Khanh, D.P., Hira, D., Furukawa, K. (2011): Reject water treatment by
improvement of whole cell anammox entrapment using polyvinyl alcohol/alginate
gel, Biodegradation, 22, 1155–1167.
Sato, N., Okubo, T., Onodera, T., Ohashi, A., Harada, H. (2006): Prospects for a
self-sustainable sewage treatment system: A case study on full-scale UASB system
in India’s Yamuna River Basin, Journal of Environmental Manage, 80, 198–207.
Schmidt, J.E. and Ahring, B.K. (1996): Granular sludge formation in upflow anaerobic
sludge blanket (UASB) reactors, Biotechnology and Bioengineering, 49 (3),
229–246.
Schroepfer, G.J., Robins, M.L., Susag, R.H. (1964): The research program on the
Mississippi River in the Vicinity of Minneapolis and St.Paul, Advances in Water
Pollution Research, Vol. 1, Pergamon, London.
Seghezzo, L., Zeeman, G., van Lier, J.B., Hamelers, H.V.M., Lettinga, G. (1998): A
review: The anaerobic treatment of sewage in UASB and EGSB reactors,
Bioresource Technology, 65, 175–190.
Sekiguchi, Y., Kamagata, Y., Nakamura, K., Ohashi, A., Harada, H. (1999): Fluorescence
in situ hybridization using 16S rRNA-targeted oligonucleotides reveals localization
of methanogenes and selected uncultured bacteria in mesophilic and thermophilic
sludge granules, Applied and Environmental Microbiology, 65, 1280–1288.
Singh, K.S., Harada, H., Viraraghavan, T. (1995): Low-strength wastewater treatment by
a UASB reactor, Bioresource Technology, 55, 187–194.
Takahashi, M., Yamaguchi, T., Kuramoto, Y., Nagano, A., Shimozaki, S., Sumino, H.,
Araki, N., Yamazaki, S., Kawakami, S., Harada, H. (2011): Performance of a
pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a
36
down-flow hanging sponge (DHS) reactors combined system by sulfur-redox
reaction process under low-temperature conditions, Bioresource Technology, 102,
753–757.
Tatara, M., Yamazawa, A., Ueno, Y., Fukui, H., Goto, M., Sode, K. (2005): High-rate
thermophilic methane fermentation on short-chain fatty acids in a down-flow
anaerobic packed-bed reactor, Bioprocess and Biosystems Engineering, 27 (2),
105–13.
Tchobanoglous, L., Burton, F.L., Stensel, D.H. (2003): Wastewater Engineering:
Treatment and Reuse, 4th ed., Mc Graw-Hill, New York, ISBN 0-07-041878-0.
Tyagi, V.K., Khan, A.A., Kazmi, A.A., Mehrotra, I., Chopra, A.K. (2009): Slow sand
filtration of UASB reactor effluent: A promising post treatment technique,
Desalination, 249 (2), 571–576.
Uemura, S., Harada, H. (2000): Treatment of sewage by a UASB reactor under moderate
to low temperature conditions, Bioresource Technology, 72, 275–282.
Vlyssides, A., Barampouti, E.M., Mai, S. (2008): Granulation mechanism of a UASB
reactor supplemented with iron, Anaerobe, 14 (5), 275–279.
Yetilmezsoy, K., Iihan, F., Sapci-Zengin, Z., Sakar, S., Gonullu, M.T. (2009):
Decolorization and COD reduction of UASB pretreated poultry manure wastewater
by electrocoagulation process: A post-treatment study, Journal of Hazardous
Materials, 162, 120–132.
Zhang, W., Wang, D., Koga, Y., Yamamoto, T., Zhang, L., Furukawa, K. (2008a):
PVA-gel beads enhance granule formation in a UASB reactor, Bioresource
Technology, 99, 8400–8405.
Zhang, W. (2008b): Applications of PVA-gel beads as biomass carrier for anaerobic
wastewater treatment, Ph.D. thesis, Kumamoto University, Kumamoto, Japan.
http://reposit.lib.kumamoto-u.ac.jp/handle/2298/11953
37
Chapter 3 Response of poly(vinyl alcohol)-gel and
poly(ethylene glycol)-gel biogranular sludges in two identical
UASB reactors
3.1 Introduction
UASB reactor has been employed in industrial and municipal wastewater treatment
for decades. It exhibits positive features such as high organic loadings, low energy
demand, short hydraulic retention time and easy reactor construction (Alphenaar et al.,
1993; Bhunia et al., 2007; El-Kamah et al., 2011; Fang et al., 1994; Ghangrekar et al.,
2005; Lettinga et al., 1980; Mahoney et al., 1987; Schmidt et al, 1996; Zhang et al., 2008).
Important parameters affecting the treatment efficiency of UASB reactors include the
granulation process in the reactor, the characteristics of the wastewater to be treated, the
selection of inoculum material, the influent of nutrients and several other environmental
factors. Among these parameters, the granulation process is believed to be the most
critical one (Fang et al., 1994; Show et al., 2004). Different mechanisms and models for
anaerobic granulation in UASB reactors were reviewed by Liu et al. (2004). Of those,
some authors have been in agreements that one of the contributing factors to the
development of granules is the presence of nuclei (or bio-carriers) for microbial
attachment. The attachment of cells to these particles has been proposed as the initiation
step for granulation. Since the second step is the formation of a dense and thick biofilm on
the cluster of the inert carriers, this step could be considered as biofilm formation. One
the initial aggregates are formed, subsequent granulation could be regarded as an
increment of biofilm thickness. Several investigators have studied the effect of inert
particles in the granulation. Hulshoff Pol et al. (1989, 2004) demonstrated the importance
of inert support particles in the granulation process. When the inert particles with a
diameter of 40-100 µm were removed from the inoculated sewage sludge, granulation
was not observed within the period of time required for granulation in the seed sludge. Yu
et al. (1999) proposed the guidelines for the selection of inert materials to be used in order
to enhance sludge granulation as (i) high specific surface area, (ii) specific gravity similar
to anaerobic sludge, (iii) good hydrophobicity, and (iv) spherical shape.
38
In chapter 1, PVA-gel beads supplied by Kuraray Corporation (Japan) were applied
for treatment of low-strength wastewater. PVA-gel performed itself as a potential biomass
carrier in UASB reactor (Khanh et al., 2011; Zhang et al., 2008; Zhang et al., 2011). Of
polymer gel particles, poly(ethylene glycol) (PEG), which is very similar to PVA beads,
has been considered as a possible biomass carrier (Hashimoto et al., 1998; Isaka et al.,
2007; Isaka et al., 2011; Xiangli et al., 2008). In the present study, the feasibility of
applying PEG gel as a bio-carrier in UASB reactor was investigated. PEG gel beads were
applied as support materials for the treatment of low-strength wastewater and compared
with PVA gel in two identical UASB reactors.
3.2 Materials and methods
3.2.1 Reactor setup
Two identical bioreactors (UASBPVA and UASBPEG), made of Plexiglas® having
effective volume 1 L, internal diameter 60 mm, and effective height 380 mm, were used
in the study. The reactors were inoculated with 50% of sludge collected from bottom of a
UASB reactor (Zhang et al., 2008) and 200 mL gel carrier. Temperature controller was set
at 30±1oC. Influent was supplied at the bottom-end of the reactors. HRTs ranging from
12 to 2 h was applied, collaborating with different loading rates (Table 3-1).
Table 3-1 Operational parameters of the two identical UASB reactors
Period
(day)
HRT
(h)
Flow rate
(L h-1)
Upflow velocity
(m h-1)
Organic loading rate
(kg-COD m-3d-1)
0-49 12 0.08 0.03 0.64-0.70
50-69 10 0.10 0.04 0.72-0.78
70-84 8 0.13 0.05 0.90-0.95
85-99 6 0.17 0.06 1.24-1.30
100-114 4 0.25 0.09 1.84-2.00
115-130 2 0.50 0.18 3.71-3.88
39
Fig. 3-1 Schematic of two identical 1L-cylinder-shaped UASB reactors
3.2.2 Substrates
Synthetic feed having peptone and bonito extract as carbon source was used as
influent. Substrates was mainly consisted of 0.6 g bonito extract, 1.0 g peptone, 1.2 g
NaHCO3, 0.15 NaCl, 0.005 g KCl, 0.005 g CaCl2·2H2O, 0.003 MgSO4·7H2O per g of
COD. Trace metals (Fe, Ni, Mn, Zn, Co, Cu and Mo) were added as per composition
suggested by Ghangrekar et al. (2005). The influent COD concentrations were between
300 mg L to 350 mg L and pH ranged of 7.3±0.1.
3.2.3 Biomass carrier
The reactors were filled up to 20% of its working volume by the original PVA beads
Biogas Temperature controller
Influent Effluent
Biogas Temperature controller
UASBPEG UASBPVA
PVA
PEG
40
(4-mm diameter, Kuraray Corporation) or PEG beads (4-mm-diameter, Ebara
Corporation). The characteristics of these beads were shown in Table 3-2.
Table 3-2 Properties of the original PVA/PEG beads
Inert material PVA bead PEG bead
Macrostructure Porous Nonporous
Density 1.04 g cm-3 1.08 g cm-3
Specific gravity 1.025 1.050
3.2.4 Analytical methods
Soluble COD concentrations (filtered through a 1.0-μm membrane) were measured
by the closed reflux colorimetric method (APHA, 1995). The evolved gas was collected
through a gas–solid separator and captured into plastic bags. Methane analyses were
performed using a GC-14B gas chromatograph (Shimadzu, Kyoto, Japan).
SEM observations of the gel structure were conducted as described in Chapter 2.
DNA extraction and PCR amplification were shown in Chapter 2. Sludge samples
attached to gel beads were taken from the bottom of the reactors (day 130). Cloning and
sequencing of 16S rDNA gene were represented in Chapter 2.
The Shannon-Wiener diversity index (H) was calculated based on the equation H
= ∑ ln where N is the total number of selected positive clones, and ni is the
number of clones in each OTU group (Xing, 2008).
3.3 Results and discussion
3.3.1 Reactor performance
The reactors were started with a low influent COD of 300 mg L-1 and HRT 12 h.
Organic loading rates were approximately 0.65 kg-COD m-3 d-1, associated with a flow
rate of 0.8 L h-1.
41
Table 3-3 Treatment performance of UASB reactors using PVA/PEG-gel carriers
Period
(day) HRT (h)
Inf. COD
(mg L-1)
UASBPVA UASBPEG
Eff. COD
(mg L-1)
CH4 yield
(m3 kg-1-CODremoved)
Eff. COD
(mg L-1)
CH4 yield
(m3 kg−1-CODremoved)
0-49 12 325±25 135±20 0.15±3 140±15 0.14±2
50-69 10 315±15 115±15 0.22±3 120±15 0.19±1
70-84 8 310±10 65±10 0.28±2 110±10 0.24±2
85-99 6 315±15 40±10 0.42±2 90±5 0.35±2
100-114 4 320±15 40±10 0.66±2 90±5 0.55±4
115-130 2 315±10 30±5 1.35±2 80±5 1.14±4
Fig. 3-2 Time course of COD removal efficiency in UASB treatment using PVA
and PEG gel bio-carriers
Fig. 3-2 Time courses of COD removal by UASBPVA and UASBPEG reactors
0
2
4
6
8
10
12
0
50
100
150
200
250
300
350
HR
T (
h)
CO
D c
once
ntr
atio
n (
mg
L-1
)
Time (day)
Influent UASBpva effluent
UASBpeg effluent HRT (h)
0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0 18.0
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
0 5 8 10 13 19 29 61 70 79 88 97 108 120
Sp
ecif
ic r
emov
al r
ate
(kg-
CO
Dre
mov
edm
3 -ge
l-1d
-1)
CO
D r
emov
al r
ate
(kg-
CO
D m
-3d
-1)
Time (day)
Removal rate (UASBpva)Removal rate (UASBpeg)Specific removal rate (PVA)Specific removal rate (PEG)
42
During the first 50 days, COD removal rate increased slightly from 0.35 to 0.45
kg-COD m-3 d-1 in UASBPVA and 0.33 to 0.41 kg-COD m-3 d-1 in UASBPEG. From day 51,
HRT was gradually shortened in order to increase the loadings. Organic loading rate
(OLR) was increased to 2 kg-COD m-3 d-1 while HRT was decreased stepwise from 10 to
4 h in two-week periods. At OLR of 0.75 kg-COD m-3 d-1, more COD removal was
tentatively identified in UASBPVA. At higher OLR of 2.0 kg-COD m-3 d-1, the efficiency
of UASBPVA was 87 %, which was greater than 74% in UASBPEG. By increasing the flow
rate to 0.5 L h-1, HRT was further decreased and fixed to 2 h, associated with OLR up to
3.9 kg-COD m-3 d-1 was achieved. Stable COD removal efficiencies of as high as 90%
were obtained in UASBPVA. COD removal rate of UASBPVA reached 3.5 kg-COD m-3 d-1,
compared with 2.9 kg-COD m-3 d-1 obtained by UASBPEG which reached 77% COD
removal at last. The operational strategy and running performance are shown in Table 3-3
and Fig. 3-2. Specific removal rates of the two carriers reached 17.5 and 14.9
kg-CODremoved m3 gel-1 d-1 for PVA beads and PEG beads, respectively, which were
approximately 2 kg-CODremoved m3 gel-1 d-1 during the first 10 days.
3.3.2 Characteristics of attached growth
The sludge granulation process in UASB reactors with added inert particles might be
interpreted as a biofilm-forming phenomenon (Yu et al., 1999). With continuous growth
and multiplication of the bacteria in the embryonic granules, some disperse bacteria in the
medium may adhere to the embryonic granule and be integrated into bacterial consortia.
This will result in the formation of well-organized bacterial consortia as mature granules.
Although much attention in granulation theories goes to the conditions affecting bacterial
adhesion, still the selective wash-out of dispersed sludge, resulting in an increase growth
of retained heavier sludge agglomerates which is more crucial for the granulation process.
The presence of inert particles serving at surfaces on which bacteria can adhere is clearly
advantageous. Nevertheless, the particle should be settleable, if not it may cause
unwanted sludge wash out. During the experimental periods, all gel beads accumulated in
the reactor bottom, no wash-out occurred. The PVA and PEG granules on day 130 had
settling velocities of 145 and 137 m h-1, greater than the values of 100 m h-1 and 110 m h-1
at the start-up. In order to observe the morphology and inner structure of the granules,
scanning electron microscopy (SEM) observation was carried out. Fig. 3-3 exhibited the
Z且延○0。ユ毎℃江呼盈zZn81mロローXBBニョロコ
anaerobicsludgeattachedtoamaturedPWL-gelbead.
一コ津JZCz罰“ユユ"E≦
xZg0Qe】EOewggkg』0膜。■‘句風XqH型8韮一89声■亮冷色zCX9鰐呼狸
尾Z.“。墾二⑤WユgエZ』u恒往.転巨ユ6日誕噂1
■■■■■RE
Fig.3-3SEMoftheanaerobicsludgeattachedtoamaturedPVAbead:
Outerpart,30x(A1),innerpart,30x(A2);
magnificationoftheouterstrucmre,1000X⑬1),z000xOB2),5000X⑯3);
magmlification0ftheinnerstructure,1000x(C1),2000x(C2),5000x(C3)
ThemacrostmctureoforiginalPEGbeadandanaerobicsludgeattachedtothe
maturedPEG-gelwasshowninFig.3-4andFig.3-5,respectively・PVAgelbeadshave
porousandreticulatemacrostructurethatpromotetotrapandcarrymicroorganlsms・As
showninFig、3-3,mamredPVAgelbeadwascoveredindensesludgeandthebiomass
developed丘omsurfacetointeriorofthebead、OnthecontraryうPEGgelhasnonporous
macrostructIなe・Hence,thebiomassattachmentwasonlyatouterpartofthematuredbead・
AsillustratedinFig、3-5(C1-C3),nosludgeattachedwasobservedinsidethematured
PEGgel,whichwasfbundverysimilartoinnerpartoftheoriginalbead,Fig.3-4
(C1-C3).
43
再ZdOOOエ8.pW魂エ剥k画さ・写ーユ6日部唖又恥0㈹1$C甜盈Z茜nA1⑭Qpー“B呂包】茎sBOOe町Oew8gk勘0》。■‘~エqa型8率
PVA
一叱勾諏印“畠■凸。
噸《:義鶴〃押鐸:
即“P叩』●■肥■・守■■》。
Q■■■●■卸幸酔い■p■》牢。
C3-
L・う
宮...
/“必か,岬‐
絶”ユ8.CWgエt皿I曙■二=ユ飾塑 ユ ロ随101gIgrWgZXZ』EロロP~-ngg1uaロ
、且
誤語。。
IF。p、”澱D9ky蛇Z画』"Ubpq竃Qユ6・翠41
可寒
ーZ戸j面念ら倉含Z釘1”趣鷺きり酷3鰹Owd狂8皿画9--ユ2-工合1
●一毎争。会合zarH
44
’、
ThearchaealcommunitiesfbrthetwoUASBsludgesareshowninTable3-4,Six
differentoperationaltaxonomicunits(OTUs)wereidentifiedinthearchaealclonelibrary
ofthesludgesamples(dayl30).OTU3waspreviouslyidentifiedinthearchaealcloneof
anaerobicsludgeobtainedftom3.9L-UASBreactorasshowninChapter2.TheDNA
analysisalsoindicatedthatM2rルα"o6acrerj""waspredominantarchaea・Theabundance
ofMg伽"o6acieが”speciesshowedthathydrogen-utilizingmethanogensweremainly
responsiblefbrmethanefbrmationinthetwobioreactors。
Fig.3-4SEMofthemacX・Ostrucmreofanoriginal]PEGbead:
Outerpart,30x(A1),imlerpart,30x(A2);
magnificationoftheouterstructure,1000x⑬1),2000x⑯2),5000x(B3);
magnmificatio皿oftheimlerstrucmre,1000x(C1),2000x(C2),5000x(C3)
PE
G
正エ.9包含
|門C21へ
h
fE律
8淫-
1リ!③鴇
←
4号壇
r詞
冨寺
月諭
。 、亀三
J悶整
肉
・ひ
塾 I垂.-.1-一一一一
一札や鈍竺話2”稗興な-39=ざ配色星gZwユM哩二醒矛ユ、四A画■.ー28F”R“王室 _名目a垂&盟弾曾史管、4…■_一令■.。■
口唖書
、3唖
4
守り、
、浄串■
■
i)α町里
③
へ乃一
及銀へ
津一
戯軸零
託【喝町司凸玲
局《錦句
鯉箪溌缶
■■エ901画罪C島”80ハユノ岨1塁E工型【8口ロー色守=又E241-畑
1
伊
I
,。‘層へノル譜
■
㎡r
謂禽Na
Cf‘銅‘、曇劉.覇踊黒晶副電d、可.画‘
.ごく,』”ずr》一:割守’・空地
の目&由
‘‘-憾鋤菊.、剛”#4凸
’,贈『。.@
…蜜:;一ずA型
■犯ユョ.9KV写璽g4flのロロ函もユEUqO,Zn
一旦G詞Fw強▼.。qlqJnWlE
腿2。ユZOkU
ー …尭 自色 三麺 ご里 写徳 TzB・齢。羽ロgh岬ニェエ動8宮Fー主4.4Qg4Q
Xユ、09コユz、cWgZXZM画ロC画2Q24ロロ唖
FortheconstructionofthearchaealclonelibraryoftheUASBpEGsludgesample,
threeofthearchaealOTUsrepresentM2油α"o6ac花が"腕,accountingfbr36%ofthetotal
library,TheShannon-Wienerindex側,representingthemethanogenicarchaeal
communityofthesludgesamplediversityうwascalculatedas1.07.Theportionofclones
associatedwithmethanogenicspecieswasl6/28(57%).
45
Fig.3-5SEMoftheanaerobicsludgeattachedtoamatured]PEGbead:
Oute]rlpart,30x(A1),iImerpart,30x(A2);
magmflcationoftheouterstructure,1000x⑯1),2000x(B2),5000x田3);
magnificatiionoftheinnelrstructure,1000x(C1),2000x(C2),5000x(C3)
FortheconstructionofthearchaealclonelibraryoftheUASBwAsludgesample,
twoofthearchaealOTUsrepresentM2r〃α"o6ac花”加,accountingfbr54%ofthetotal
library,TheShannon-Wienerindex〃,representingthemethanogenicarchaeal
communitydiversityoflhesludgesample,wascalculatedas1.04.Ofthe39clones,thiriyウ
accountedfbr77%,wasassociatedwithmethanogemcspecies.
PEG
〃‘~,。竜.‐。:c3顎.『、.割‘蕊,。蔑
碁愈壷卦鋪簿編"緬繰吟雲島_ザ堂刊
…‘‘率.蝦=ェ塗‘、画…‘‘….…。。…暴唾電‘霧葬…鰯卿
ドケ●蕊
HQ13310799
Table3-4ArchaealcommumitiesinUASBpvAandUASBpEGsludges
NUmberof
clOnes
PMA
NUmberof
clones
PEG
GenRank
AcceggiOnIdentity(%)
OTU T泡xon
9
(9/39)
Unculturcd」Mも"bgmo6“jEPf岬sp・cloneSWA3
Mセ肋α"o6“陀減脚加sp、8-1
雌Zル”o6“jErj脚腕/b”cjC”strainFCam
EU888014 100
100
100
9
(9/39)
3
(3/28)
1 GU569395
AFO28689
UnculturedarchaeoncloneMP12
UnculturedMセル”o“cメセri"”sp・cloneSWA4
jMセ肋”o6acだ〃”sp・T11
雌肋”o6ac陀伽"ん”jcjc"腕strainMG-l34
EU888013
AB288281
HQ591420
100
100
100
12
(12/39)
2
(2/28)2
ArchaeonemichmentculturecloneC4-15CA
UnCulturedamhaeon44A-1
UnculturBdmethanogenicamhaeonisolateSSCP
bandAsll
UnculturedarChaeoncloneLTA53
Mセ"hq77o6acj巴減z"P2Sp・emichmentcultmeclone
A1499
DQ682559100
0
(0/39)
5
(5/28)HQ330679993
511
(11/28)
ArChaeonemichmentculturecloneC3-18C-A
UncultmEdMセ肋”o6acjE河口℃EzzeardD狸⑪n
clone:SP-H2-A
GQ47058799
UnculturedarchaeoncloneSSADMAG10
6
(6/28)AB236058994
UncultuIedcrenarchaeotecloneAGS8
UnculturedcrenarchaeotecloneF31
UnculturedamhaeoncloneBRl-84
GUO6033598
HQ336505
EU910616
HQ440107
Shannon-WienerDiversitylndex〃
GU19616299
AF42476599
AYl6126199
9
(9/39)
nles1udgesample廿omUASBpEGwasobservedwithahigherdiversityindexin
compansonwiththesludgesample廿omUASBpvA、Howeventhelowerportionofclones
relatedtomethanogenswascalculate。、Besides,thegroupachievedthehighestnumber
ofclones(11/28)presentedbyOTU5wasoutofmethanogemcspecies,Asnlustratedin
Fig、3-5,themethanogenicamhaealcommunitymaynotlocateattheinnerpartbutthe
outerpartofthematuredPEGbead・Onthecontrary§thematuredPMdLbeadwasfbund
46
998
999
(声,_6)‐鴎'、釜一重莞1,発=1.04=1.07
1
(l/28)
0
(0/39)6
●
withaJnaembicsludgeattachedtotheinnerpart,Wheremethanogenlcspeciesmay
accumulated
3.4C⑪皿clusi0ns
TWoidenticalUASBreactorsusmgpolymergelbio-caIrierswereoperatedtoan
organicloadingrateof4kg-CODmF3dlat30・CunderHRrof2h・UASBwAwasfbund
tobemorecompetitivethanthetreatmentofUASBpEG・Ittookl20daystoreaCh90%
CODremoval,whileCODremovalefficiencybyUASBpEGwas77%・Itwasbecauseof
themacrostructureofthesegelcaniers、jl化肋”o6ac花”腕wasfbundaspredominant
archaeainbothreactors・OurclonedataindicatedthatPVA戸gelcaIrierwasmoresuitable
fbrattachedgrowthofmethanogemccommunities.
References
APHA,AWWA,WPCF(1995):StandardMethodsfbrtheExaminationofWaterand
Wastewate喝l9thed、AmericanPublicHealthAssociatio、,Washington,DC.
AlphenaaLRA.,Visse喝A、,Lettinga,G、(1993):Theeffectofliquidupwardvelocityand
hydraulicretentiontimeongranulationinUASBreactorstreatingwastewaterwitha
higilsulphatecontent,BioresourceTbChnolo邸3,960-968.
Bhunia,R,Ghangrek“M、M、(2007):Statisticalmodelingandoptimizationofbiomass
granulationandCODremovalinUASBreactorstreatinglowstrengthwastewate喝
BioresourCe兜chnology§99,42294238.
Coolen,MJL.,Hopmans,E、C、,Rijpstra,W1.C、,Muyz“G、,Schouten,S、,Vblkman,
JK.,SinningheDamst6,J.S・(2004):EvolutionofthemethanecycleinAceLake
(Antarctica)duringtheHolocene:responseofmethanogensandmethanotrophsto
envlronmentalchange,OrganicGeochemistry§35,1151-1167.
El-Kamah,H、,Mahmoud,M,Tblwfik,A・(2011):Perfbrmanceofdown-flowhanging
sponge(DHS)reactorco叩ledwithupflowanaerObicsludgeblanket(UASB)
reactorfbrtreatmentofoniondehydrationwastewat“BioresourceTEchnologyJO2
(14),7029-7035.
Fang,HH.R,Chui,H・K.,Li,YY:(1994):MicrObialstructureandactivityofUASB
47
granulestreatingdi能rentwastewaters,WaterScienceandTbcmolo邸30(12),87ー
96.
GhangrekarbMM.,Asolek“S、R,Joshi,S、G、(2005):Characteristicsofsludge
developedunderdifferentloadjngconditionsduringUASBreactorstart-叩and
granulation,WaterResearch,39,1123-1133.
Hashimoto,N,Sumino,正(1998):Wastewatertreatmentusingactivatedsludge
entrappedinpolyethyleneglycolp岬olymerうJOumalofFermentationand
Bioengineering,86(4),424-426.
HulshoffPol,LW(1989):Thephenomenonofganulationofanaerobicsludge,Ph.D、
Thesis,AgricultureUniversityofWageningen,Wageningen,TheNetherlands.
HulshoffPol,L、W,deCastroLopes,S,I.,Lettinga,G、,Lens,RN.L、(2004):Anaembic
sludgegranulation,WaterResearch,38,1376-1389.
Isaka,K、,Date,Y,Sumino,T,mneda,S・(2007):Ammoniumremovalperfbrmanceof
anaerobicammomum-oxidizingbacteriaimmobilizedinpolyethyleneglycolgel
carrieLAppliedMicrobiologyBiotechnologyb76,1457-1465.
Isaka,K、,Itokawa,H,,Kimura,Y,Noto,K、Murakami,T(2011):Novelautotrophic
removalsystemusinggelentrapmenttechnolo邸BiresourceTbchnolo部102,
772卜7726.
Khanh,,.R,Quan,LM.,Zhang,W,HiraD.,Furukawa,K・(2011):E能ctof
temperatureonlow-strengthwastewatertreatmentbyUASBreactorusing
poly(vinylalcohol)-gelcarrier,BioresourceTechnology,102,11147-11154.
Lettinga,G、,vanVelsen,AF.M、,Hobma,S、W,deZeeuwうW,Klapwijk,A・(1980):Use
oftheupflowsludgeblanket(USB)reactorconceptfbrbiologicalwastewater
treatment,speciallyfbranaerobictreatment,BiotechnologyandBioengineering,22
(4),699-734.
Liu,Y,Xu,H、L,Yan9,s.F、,T既』.H、(2003):Mechanismsandmodelsfbranaerobic
granulationinupflowanaerobicsludgeblanketreactoLWaterResearch,37,661-
673.
48
MahoneybE.M,,Varangu,LK.(1987):Thee艶ctofcalciumonmicrobialaggregation
duringUASBreactorstart-up,WaterScienceand晩chnologyJ9,249-260.
Schmidt,』.E,Ahring,B、K・(1996):GranularsludgefbImationin叩flowanaerObic
sludgeblanket(UASB)reactors,BiotechnologyBioengineering,49(3),229-246.
ShowbK.Y,Wang,Y,Foong,S、E,mybJ.H・(2004):Acceleratedstart-upandenhanced
ganulationinupflowanaerobicsludgeblanketreactors,WaterResearch,38,2293-
2304.
Xiangli,Q、,Zhenjia,Z.,QingXuan,C、,Yajie,C,(2008):Nitrificationcharacteristicsof
PEGimmobilizedactivatedsludgeathighammoniaandCODloadingrates,
Desalination,222,340-347.
Xing,W,Zuo,』.E,Dai,N、,Chen9,J.,Li,』.(2008):Reactorperfbrmanceandmicrobial
communityofanEGSBreactoroperatedat20andl5oC,AppliedMicrobiologyblO7
(3),848-857.
YU,H、Q,,T間y§』.H,Fang,H、HR(1999):E舵ctsofaddedpowderedandgranular
activatedcarbonsonstart-upperfbrmanceofUASBreactors,Environmental
Tbchnologyb20(10),1095-1101.
Zhang,W、,Wang,,.,Koga,Y、,Yamamoto,T、,Zhang,L、,Furukawa,K、(2008):PVA
gelbeadsenhancegranulefbrmationinaUASBreactor,BioresourceTechnology,
99,840卜8405.
Zhang,W,Zhang,X、,Wang,,.,Koga,Y、,Rouse,』.,.,Furukawa,K・(2011):nace
elementsenhancebiofilmfbrmationinUASBreactorfbrsolosimplemolecule
wastewatertreatment,BioresourceTechnology,102,929f9299.
49
ChaPter4Substraterem0valkineticsinaUASBreactorusing
poly(vinylalcohoD-gelcarrieroperatedatl5oC
4.1Intr0duction
TheUASBprocessisdemonstrablyeEfectivefbrremovaloforganicsubstances
fiomsewageundermoderatetemperatureconditions、ThetreatmentofsewagebyUASB
atl5oCwasinvestigatedbyBandaraetal.(2011),Mahmoudetal.(2004),Tawfiketal.
(2006).Basedontheseresults,theUASBreactorscouldbeappliedsuccessfUllyunder
I丑R耐fom6tolOhwithareasonableCODremovaleBficiency70to90%・Inmoderate
climatecountries,sewagetreatmentinUASBreactorshasrecentlyincreased,sothe
understandingofprocesskineticsisessentialinthedevelopmentandoperationofUASB
reactors.
BasedonthebiochemistryandmicrObiologyofanaerobicprocesses,kinetics
providesajudiciousbasisfbrprocesscontrolanddesign(Bhuniaeta1.,2008).Various
kineticmodelsarereportedfbranaerobicprocesses(BuyuldKamacieta1.,2002;Castilloet
a1.,1999;Isiketa1.,2005;Lokshinaeta1.,2001;Pavlostathiseta1.,1991;Sandhyaeta1.,
2006).HoweverbtheampleofinfbrmationObligatoryfbrmanyofthesemodelslimits
theirfieldapplication・Areviewofliteraturerevealsthatmostofthekineticmodelsare
nonlinearinnature、Thus,onemayanticipateanonlinearregessiontechniquewouldbe
morecompetentfbrevaluationofkineticconstantsimbeddedinthemodels(Ongeta1.,
1990).Thekineticmodelsgivingacorrelationcoefficient(R2)valueclosesttounityare
consideredbest-fit.
Inthisstudybtwokineticmodels,namelyGrausecond-ordermulti-substrateremoval
modelandmodifiedStoverKincannonmodelhavebeenscrutinized・Thesemodelsare
testedfbrtheircapabilitytodemonstratethesUbstrateremovalandmicroorganism,s
厚owthratekineticsofUASBreactorusingPVAgelbio-canierintreatinglow-strengdl
wastewaterwithCODconcentrationsof430mgL~latl5oC,whichwasachallenging
temperaturefbrtheoperationofUASBreactortreatinglow-CODcontainingwastewater
aspreviouslydescribedinChapter2.
50
51
4.2 Materials and methods
4.2.1 Experimental setup
The cylinder-shaped UASB reactor was 60 mm in diameter, 930 mm in length and
had an effective volume of 2.5 L (Fig. 4-1). The reactor was made of Plexiglas® and
equipped with a thermometer for temperature control and was maintained at 15±1oC.
Sampling ports (SP-1, SP-2) were located at heights of 200 and 900 mm above the reactor
bottom. Compared to the cuboid-shaped UASB reactor as described in Chapter 2, this
reactor is ease to clean-up and got the better gas-solids separation device. The reactor was
also operated under a decrease of HRT but with longer ranges in order to improve COD
removal rates.
Fig. 4-1 Schematic diagram of 2.5 L-cylinder-shaped UASB reactor
Influent
SP-1
SP-2
Gas collector
Temperature controller
Effluent
52
Table 4-1 Operational parameters of 2.5 L-cylinder-shaped UASB reactor
Period
(day)
HRT
(h)
Flow rate
(L h-1)
Upflow velocity
(m h-1)
Organic loading rate
(kg-COD m-3d-1)
0-14 6.0 0.4 0.2 1.69-1.71
15-29 5.0 0.5 0.3 1.99-2.06
30-44 4.0 0.6 0.4 2.51-2.58
45-59 2.5 1.0 0.5 4.08-4.14
60-80 2.0 1.3 0.6 5.04-5.17
4.2.2 Synthetic influent
The substrates were descripted in Chapter 2.
4.2.3 Seed sludge
The detail description of PVA granules was shown in Chapter 2. 1L granular sludge
was transferred from the 3.9L-cuboid-shaped UASB (Khanh et al., 2011) to this
cylinder-shaped UASB reactor, no start-up process was needed.
4.2.4 Analytical methods
Analytical method was shown in Chapter 2.
4.3 Results and discussion
4.3.1 Reactor performance
The operational strategy and running performance are shown in Table 4-2 and Fig.
4-2. The reactors were operated with a stable influent COD of 430±20 mg L-1 and HRT
from 6 to 2 h. The upflow velocities increased stepwise from 0.4 to 1.3 L h-1. Loading rate
was in the ranged of 1.7 to 5.2 kg-COD m-3 d-1. Stable COD removal efficiency of as high
as 80% was obtained during Period I (HRT 6h) and it was achieved 75% under HRT 2h
during Period V. Specific removal rate reached 12 kg-CODremoved m3-PVA- gel-1 d-1.
53
Table 4-2 Treatment performance of 2.5 L-cylinder-shaped UASB reactor
Period
(day)
HRT
(h)
Inf. COD
(mg L-1)
Eff. COD
(mg L-1)
Removal rate
(kg-COD m-3 d-1)
CH4 yield
(m3 kg-1-CODremoved)
0-14 6.0 425±3 86±4 1.36±0.02 (80%) 0.23
15-29 5.0 422±7 94±4 1.57±0.03 (77%) 0.22
30-44 4.0 425±6 102±3 1.93±0.03 (76%) 0.22
45-59 2.5 428±3 109±3 3.06±0.05 (75%) 0.22
60-80 2.0 425±5 111±6 3.74±0.10 (75%) 0.22
Fig. 4-2 Time courses of COD removal by 2.5 L-cylinder-shaped UASB reactor
0
5
10
15
20
25
30
35
40
45
50
0
50
100
150
200
250
300
350
400
450
Loa
din
g ra
te (
kg
CO
D m
-3d
-1)
Rem
oval
rat
e (k
g C
OD
m-3
d-1
)S
pec
ific
rem
oval
rat
e (k
g-C
OD
rem
oved
m3 -
PV
A-g
el-1
d-1
)
CO
D c
once
ntr
atio
n (
mg
L-1
) Influent COD
Effluent COD
COD loading rate
COD removal rate
Specific removal rate
0.00
0.05
0.10
0.15
0.20
0.25
0
1
2
3
4
5
6
0 10 20 30 40 50 60 70 80
Met
han
e yi
eld
(m3
kg-1
-CO
Dre
mov
ed)
HR
T (
h)
Time (day)
HRT (h)
Methane yield
54
Table 4-3 shows the COD removal by two lab-scale UASB reactors operated at 15oC
using the same PVA-gel carrier. The performance of 3.9L-cuboid-shaped UASB reactor
was described in Chapter 2. The 2.5L-cylinder-shaped UASB reactor was found to be
more efficient for COD removal than the previous UASB reactor. It was explained by
application of the longer HRTs in earlier periods of operation.
Table 4-3 Treatment performance of UASB reactors using PVA-gel at 15oC
Parameters 3.9 L-UASB 2.5 L-UASB
HRT 2.0 2.0
Influent COD (mg L-1) 425±7 425±5
Effluent COD (mg L-1) 226±5 111±6
Loading rate (kg-COD m-3 d-1) 6.55±0.1 5.1±0.04
Removal rate (kg-COD m-3 d-1) 2.95±0.05 3.74±0.1
Removal efficiency (%) 45 75
Specific removal rate (kg-CODremoved m3-gel-1 d-1) 14.5±0.4 11.8±0.2
Methane yield (m3 kg-1-CODremoved) 0.12 0.22
4.3.2 Characteristics of attached growth
The matured PVA-gel on day 80 of this experiment had average settling velocity of
213 m h-1, greater than the value of 201 m h-1 on day 270 of the earlier experiment as
represented in Chapter 2. The archaeal communities for attached sludges on PVA-gel are
shown in Table 4-4. Five different operational taxonomic units (OTUs) were identified in
the archaeal clone library of the sludge samples (day 80). Three first OTUs were
previously identified in 3.9L-UASB biogranular sludges (Khanh et al., 2011). These
OTUs plus OTU5 were confirmed in anaerobic granular sludges obtained from 1L-UASB
reactors as showed in Chapter 3. Most of the archaea fell within the hydrogenotrophic
genus of Methanobacterium. This result was in agreement with the experiment results on
COD removal by UASB reactors at 15 to 35oC as shown in Chapter 2.
55
Table 4-4 Archaeal communities in the granular sludge obtained from 2.5 L-UASB
OTU Taxon GenBank Accession
Identity (%)
Number of clones
Day 0 Day 80
1
Uncultured Methanobacterium sp. clone SWA3 EU888014 100 4
(4/33)
15
(15/31)Methanobacterium sp. 8-1 GU569395 100
Methanobacterium formicicum strain FCam AF028689 100
2
Archaeon enrichment culture clone C4-15C-A GU196162 100 12
(12/33)
12
(12/31)Uncultured archaeon 44A-1 AF424765 100
Uncultured archaeon clone SSADM_AG10 AY161261 99
3
Uncultured methanogenic archaeon isolate SSCP band As11 DQ682559 100 1
(1/33)
2
(2/31) Uncultured archaeon clone LTA53 HQ330679 99
Methanobacterium sp. enrichment culture clone A1499 HQ133107 99
4
Uncultured Methanobacterium sp. clone SWA4 EU888013 100 1
(1/33)
1
(1/31) Methanobacterium sp. T11 AB288281 100
Methanobacterium formicicum strain MG-134 HQ591420 100
5
Methanosaeta concilii GP-6 CP002565 99 0
(0/33)
1
(1/31) Uncultured Methanosarcinales archaeon clone YHN-4 JF495101 99
Uncultured Methanosaeta sp. clone MFC-G3arc HM043249 99
6
Uncultured Methanobacterium sp. clone WA1 EU888017 100 6
(6/33)
0
(0/31) Methanobacterium beijingense strain 4-1 AY552778 100
Archaeon enrichment culture clone C1-44C-A GQ465437 100
7
Uncultured Methanosarcinales archaeon clone QEEC1CH041 CU917466 99 1
(1/33)
0
(0/31) Uncultured Methanosarcinales archaeon clone QEEC1AB061 CU917434 99
Uncultured archaeon clone s13128 EU244175 99
8
Uncultured archaeon isolate ARC7_G07 FM162215 99 1
(1/33)
0
(0/31) Uncultured Methanosaeta sp. clone DI_C03 AY454761 97
Uncultured Methanosaetaceae archaeon MRR36 AY125711 96
9
Uncultured crenarchaeote clone F31 EU910616 99 7
(7/33)
0
(0/31) Uncultured crenarchaeote clone GoM_GC232_4463_Arch73 AM745241 94
Uncultured archaeon clone Hua0-s84 EU481569 94
Shannon-Wiener Index (H) (i=1-8) 1.4 1.2
56
The majority of the archaea fell within the hydrogenotrophic genus
Methanobacterium was also observed in studies on methane production from treatment of
grass silage by batch leach bed reactors (Wang et al., 2010). Similarly, a study on
microbial communities from an expanded granular sludge bed (EGSB) treating COD
concentrations of 5200 mg L-1 at 15oC (Xing et al., 2009) also indicated that
Methanobacterium was found as a predominant archaea. Some studies have shown that in
low temperature environments, acetate-utilizing methanogens were found to be less
abundance than hydrogen-utilizing methanogens, such as Methanobacterium strain AZ
(Adachi et al., 1999; Chauhan et al., 2004; Rooney-Varga et al., 2007). A possible
explanation for this bacterial distribution is that lower temperatures result in lower cell
membrane fluidity, therefore, reduced acetate permeability. The existence of acetotrophic
archaea Methanosaeta and Methanosarcina was found to be abundant on day 0, however,
they disappeared on day 80 (OTU7 and OTU 8), causing a decrease in Shannon-Wiener
index of diversity (H). Several researchers (Liu et al., 2003; Macleod et al., 1990;
Wiegant et al., 1986) have suggested that a loose structure of filaments of Methanosaeta
spp. cells is the precursor for granules. These filaments can function as a nucleation
center for further development of the aggregate. Other researches have suggested that
during initial granulation, Methanosaeta spp. colonized the central cavities of
Methanosarcina clumps (Demirel et al., 2008; Kovacik et al., 2010). This is supported by
co-existence of two acetotrophic genus Methanosaeta and Methanosarcina in OTU5.
The occurrence of Methanosaeta concilii (formerly known as Methanothrix
soehngenii), a key organism in anaerobic sludge granulation (Hulshoff Pol et al., 2004;
Schmidt and Ahring et al., 1996) was observed in the library of clones on day 80. It was
indicated that better matured PVA-gel beads were achieved.
4.3.3 Substrate removal kinetics in UASB reactor
There are several kinetic models such as Monod model, Contois model, First-order
model, Second-order model, Haldane model, Stover-Kincannon model, etc., which have
been used to described the overall kinetics of biological reactor. In this study, the Grau
second-order model and modified Stover-Kincannon model were applied to experimental
results for the UASB reactor operated at 15oC.
57
4.3.3.1 Grau second-order multicomponent substrate removal model
The general equation of Grau second-order kinetic model is exemplified in Eq. (1)
(Grau et al., 1975; Ozturk et al., 1998; Isik et al., 2005; Sadhya et al., 2006; Bhunia et al.,
2008; Raja Priya et al., 2009):
(1)
After integration and linearized, the equation is represented as follows:
(2)
If the second term of the right part of Eq. (2) was accepted as a constant, Eq. (3) will
be obtained as follows:
(3)
where S0 and S are the influent and effluent substrate concentration (mg L-1); (S0-S)/S0
expresses the substrate removal efficiency and is symbolized as E; θ is hydraulic retention
time (h); a = S0/ Ks2 X and b is a constant greater than unity; Ks2 is the Grau second-order
substrate removal rate constant (d-1) and X is the average biomass concentration in the
reactor (mg VSS L-1). Therefore, the last equation, Eq. (4), can be written as
(4)
Data used for Grau second-order kinetic model were given in Table 4-5 and (a) and
(b) values were obtained using Fig. 4-3 for UASB reactor.
From the figure, (a) and (b) values were found to be 0.003 and 0.0121, respectively,
with correlation coefficient of 0.99. Grau second-order substrate removal rate constant
(Ks2) were determined as 22 (d-1).
58
Table 4-5 Data for Grau second-order kinetic model for 2.5 L-UASB reactor
HRT, θ (h) S0 (mg L-1) S (mg L-1) E (%) θ/E
6.0 425 84 80 0.08
5.0 422 94 78 0.06
4.0 425 102 76 0.05
2.5 428 109 75 0.03
2.0 425 111 75 0.03
The average biomass concentration in the reactor (X) was 271 mg VSS L-1
Fig. 4-3 Grau second-order model application for 2.5 L-UASB reactor
Grau second-order substrate removal rate constant (Ks2) value obtained in this study
was higher than values found by other reports (Table 4-6). The substrate removal rate
constant was 22 per day for overall reactor. In previous studies, this value was 0.22 per
day for municipal wastewater (Ubay et al., 1994), 0.34 per day for textile wastewater (Isik
et al., 2005), 38.5 per day for landfill leachate (Ozturk et al., 1998) and 4.24 for synthetic
wastewater (Bhunia et al., 2008). The possible reasons for the differences may be
variation in reactor configuration (especially HRTs), wastewater characteristics and
microorganisms in the treatment systems.
y = 0.0121x + 0.003R² = 0.9986
0.00
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
0 2 4 6 8
θ/E
HRT (h)
59
Table 4-6 Comparison of kinetic parameters in the Grau second-order model
Substrate Reactor Inf. COD
(mg L-1)
HRT
(h)
Kinetic parameters
Reference a b
Ks2
(d-1)
Municipal
wastewater UASB 230-445 6-24 0.002 1.346 0.22 Ubay, 1994
Landfill
leachate UASB
9000-
25000 40-67 0.013 1.066 38.5 Ozturk, 1998
Molasses AHR 2000-
15000 12-48 0.033 1.192 10.81
Buyukkamaci,
2002
Textile
wastewater UASB 4214 6-100 0.562 1.095 0.34 Isik, 2005
Synthetic
wastewater UASB 300-600 4-8 0.558 1.043 4.24 Bhunia, 2008
Synthetic
wastewater UAFB 500 10-24 9.34 0.640 0.13
Raja Priya,
2009
Synthetic
wastewater UASB 430 2-6 0.003 0.0121 22 This study
4.3.3.2 Modified Stover-Kincannon model
In this model the substrate removal rate is expressed as function of the organic
loading rate by monomolecular kinetic for biofilm reactors. Equation of the modified
Stover-Kincannon model is as follows (Yu et al., 1998; Isik, 2005 et al.; Raja Priya et al.,
2009):
(5)
where dS/dt is defined as in Eq. (6)
(6)
where dS/dt is substrate removal rate (g L-1 d-1), Q is the flow rate (L d-1); V is the reactor
volume (L); Si and Se are the influent and effluent COD concentration (g L-1); Rmax is the
60
maximum substrate removal rate (g COD L-1 d-1); KB is the saturation value constant (g
L-1 d-1).
Eq. (7) obtained from linearization of Eq.(6) as follows:
(7)
Eq. (6) is a Monod model, while Eq. (5) results from a simple modification of
Stover-Kincannon model. Data used for modified Stover-Kincannon model were
represented in Table 4-7.
Table 4-7 Data for modified Stover-Kincannon model for 2.5 L-UASB reactor
Q (L d-1) Si (g L-1) Se (g L-1) V/(Q*Si) (g L-1 d-1) V/Q*(Si-Se) (g L-1 d-1)
10 0.425 0.084 0.59 0.73
12 0.422 0.094 0.49 0.64
15 0.425 0.102 0.39 0.52
24 0.428 0.109 0.24 0.33
30 0.425 0.111 0.20 0.27
Fig. 4-4 Modified Stover-Kincannon model application for 2.5 L-UASB reactor
y = 1.2032x + 0.0348R² = 0.9984
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
0.80
0.0 0.2 0.4 0.6 0.8
V/Q
*(S
i-Se )
V/(Q*Si )
61
From Fig. 4-4, (KB/Rmax) and (1/Rmax) were determined to be 1.20 and 0.03,
respectively with the high correlation coefficient of 0.99. The maximum removal rate
constant (Rmax) and the saturation value constant (KB) were determined to be 28.7 g L-1 d-1
and 35 g L-1 d-1, respectively.
Table 4-8 shows the kinetic constants in the modified Stover-Kincannon model
application for various biofilm reactors. Stover-Kincannon et al. (1982), cited by Raja
Priya et al. (2009) have shown that the relationship developed from the laboratory scale
experiments could be used for all bio-carriers. The constants obtained in this study were
higher than the values for synthetic wastewater reported by Raja Priya et al. (2009). The
possible reason may be the difference in HRT. Even the short HRTs, the maximum COD
removal rate Rmax in this study was comparatively high.
Table 4-8 Comparison of kinetic parameters in the Stover-Kincannon model
Substrate Reactor Support
media
Inf. COD
(mg L-1)
HRT
(h)
Kinetic parameters
Reference KB
(g L-1 d-1)Rmax
(g L-1 d-1)
Soybean
wastewater AF
Fibrous
bundles
7520-
11450 24-35 85.5 83.3 Yu, 1998
Molasses AHR Hose
pieces
2000-
15000 12-48 186.23 83.3
Buyukkamaci,
2002
Textile
wastewater UASB - 4214 6-100 8.2 7.5 Isik, 2005
Synthetic
wastewater UAFB
Insulated
beads 500 10-24 4.6 3.4
Raja Priya,
2009
Synthetic
wastewater UASB
PVA
beads 430 2-6 35 28.7 This study
The two models applied in this study were used to predict the effluent COD
concentrations and compared with the tentative values obtained from the operation of the
lab-scale reactor. The COD concentrations predicted with the Grau second-order and
Stover-Kincannon models gave high correlation (99% and 97%, respectively) with actual
COD concentrations measured from the UASB reactor as shown in Fig. 4-5. Grau
second-order model was more suitable for predicting the COD concentrations in
62
comparison with the modified Stover-Kincannon model.
Fig. 4-5 Comparison of the predicted and the actual COD concentrations from
2.5 L-cylinder-shaped UASB reactor operated at 15oC
4.4 Conclusions
Treatment performance of the UASB reactor was evaluated at 15oC and different
hydraulic retention times using low-strength wastewater. COD removal efficiencies
ranging from 75 to 80% were achieved. Kinetic analyses of the reactor were carried out
according to the experimental results. Grau second-order model gave the higher
correlation coefficient of 0.99. The results of kinetic studies obtained from these lab-scale
experiments can be used for estimating treatment efficiency of pilot-scale or full-scale
UASB reactors if the low-strength wastewater was treated at similar operational
conditions.
References
Adachi, K. (1999): Isolation of hydrogenotrophic methanogenic archaea from a
subtropical paddy field, FEMS Microbiology Ecology, 30, 77–85.
Bandara W.M.K.R.T.W., Satoh, H., Sasakawa, M., Nakahara, Y., Takahashi, M., Okabe,
S. (2011): Removal of residual dissolved methane gas in an upflow anaerobic
y = 0.8692x + 11.675R² = 0.9907
y = 1.1405x ‐ 13.265R² = 0.9649
0
25
50
75
100
125
150
80 90 100 110 120
Pre
dic
ted
eff
luen
t C
OD
co
nce
ntr
atio
ns
(mg
L-1
)
Measured effluent COD concentrations (mg L-1)
Grau Stover‐Kincannon
63
sludge blanket reactor treating low-strength wastewater at low temperature with
degassing membrane, Water Research, 45, 3533–3540.
Bhunia, P., Ghangrekar, M.M. (2008): Analysis, evaluation and optimization of kinetic
parameters for performance appraisal and design of UASB reactors, Bioresource
Technology, 99, 2132 –2140.
Buyukkamaci, N., Filibeli, A. (2002): Determination of kinetic constants of an anaerobic
hybrid reactor, Process Biochemistry, 38, 73–79.
Castillo, A., Llabres, P., Alvarez, M.J. (1999): A kinetic study of a combined
anaerobic-aerobic system for treatment of domestic sewage, Water Research, 33,
1742–1747.
Chauhan, A., Ogram, A., Reddy, K.R. (2004): Syntrophic-methanogenic associations
along a nutrient gradient in the Florida Everglades, Applied and Environmental
Microbiology, 70, 3475–3484.
Coolen, M.J.L., Hopmans, E.C., Rijpstra, W.I.C., Muyzer, G., Schouten, S., Volkman,
J.K., Sinninghe, D.J.S. (2004): Evolution of the methane cycle in Ace Lake
(Antarctica) during the Holocene: response of methanogens and methanotrophs to
environmental change, Organic Geochemistry, 35, 1151–1167.
Demirel, B., Scherer, P. (2008): The roles of acetotrophic and hydrogenotrophic
methanogens during anaerobic conversion of biomass to methane: a review,
Reviews in Environmental Science and Biotechnology, 7, 173–190.
Grau, P., Dohanyos, M., Chudoba, J. (1975): Kinetics of multicomponent substrate
removal by activated sludge, Water Research, 9, 637–642.
Hulshoff Pol, L.W., Castro Lopes, S.I., Lettinga, G., Lens, P.N.L. (2004): Anaerobic
sludge granulation, Water Research, 38, 1376–1389.
Isik, M., Sponza, D.T. (2005): Substrate removal kinetics in an upflow anaerobic sludge
blanket reactor decolorizing simulated textile wastewater, Process Biochemistry,
40, 1189–1198.
Khanh, D.P., Quan, L.M., Zhang, W., Hira, D., Furukawa, K. (2011): Effect of
temperature on low-strength wastewater treatment by UASB reactor using
poly(vinyl alcohol)-gel carrier, Bioresource Technology, 102, 11147–11154.
Kovacik, W.P., Scholten, J.C.M., Culley, D., Hickey, R., Zhang, W., Brockman, F.J.
64
(2010): Microbial dynamics in upflow anaerobic sludge blanket (UASB) reactor
granules in response to short-term changes in substrate feed, Microbiology, 156,
2418–2427.
Liu, Y., Xu, H.L., Yang, S.F., Tay, J.W. (2003): Mechanisms and models for anaerobic
granulation in upflow anaerobic sludge blanket reactor, Water Research, 37,
661–673.
Lokshina, L.Y., Vavilin, V.A., Kettunen, R.H., Rintala, J.A., Hollinger, C.,
Nozhevnikova, A.N. (2001): Evaluation of kinetic coefficients using integrated
Monod and Haldane models for low temperature acetoclastic methanogenesis,
Water Research, 35, 2913–2922.
Macleod, F.A., Guiot, S.R., Costerton, J.W. (1990): Layered structure of bacterial
aggregates produced in an upflow anaerobic sludge bed and filter reactor, Applied
and Environmental Microbiology, 56, 1598–1607.
Mahmoud, N., Zeeman, G., Gijzen, H., Lettinga, G. (2004): Anaerobic sewage
treatment in a one-stage UASB reactor and a combined UASB-digester system, 38
(9), 2348–2358.
Oliveira, S.V.W.B., Moraes, E.M., Adorno, M.A.T., Varesche, M.B.A., Foresti, E.,
Zaiat, M. (2004): Formaldehyde degradation in an anaerobic packed-bed bioreactor,
Water Research, 38, 1685–1694.
Ong, L.S. (1990): A comparison of estimates of kinetic constants for a suspended growth
treatment system from various linear transformations, Research Journal of the Water
Pollution Control Federation, 62, 894–900.
Ozturk, I., Altinbas, M., Arikan, O., Demir, A. (1998): Anaerobic UASBR treatment of
young landfill leachate, In: Proceedings of the First International Workshop on
Environmental Quality and Environmental Engineering in the Middle East Region,
Konya, Turkey.
Pavlostathis, S.G., Giraldo-Gomez, E. (1991): Kinetics of anaerobic treatment, Water
Science and Technology, 24, 35–59.
Raja Priya, K., Sandhya, S., Swaminathan, K. (2009): Kinetic analysis of treatment of
formaldehyde containing wastewater in UAFB reactor, Chemical Engineering
Journal, 148, 212–216.
Rooney-Varga, J.N., Giewat, M.W., Duddleston, K.N., Chanton, J.P., Hines, M.E.
65
(2007): Links between archaeal community structure, vegetation type and
methanogenic pathway in Alaskan peatlands, FEMS Microbiology Ecology, 60,
240–251.
Sandhya, S., Swaminathan, K. (2006): Kinetic analysis of textile wastewater in hybrid
column upflow anaerobic fixed film reactor, Chemical Engineering Journal, 122,
87–92
Schellinkhout, A., Osorio, E. (1994): Long-term experiences with the UASB technology
for sewage treatment on large scale, The Netherlands, In: 7th International
Symposium on Anaerobic Digestion, 23-27 January 1994, 251–252.
Schmidt, J.E., Ahring, B.K. (1996): Granular sludge formation in upflow anaerobic
sludge blanket (UASB) reactor, Biotechnology and Bioengineering, 49, 229–246.
Stover, E.L., Kincannon, D.L. (1982): Proceedings of the First International Conference
on Fixed Film Biological Process, Kings Island, Ohio, 1–21.
Tawfik, A., Ohashi, A., Harada, H. (2006): Sewage treatment in a combined upflow
anaerobic sludge blanket (UASB)-downflow hanging sponge (DHS) system,
Biochemical Engineering Journal, 29 (3), 210–219.
Ubay, G. (1994): Anaerobic treatment of municipal wastewater, Ph.D. Thesis, Istanbul
Technical University, Turkey.
Wang, H., Vuorela, M., Keranen, A.L., Lehtinen, T.M., Lensu, A., Lehtomaki, A., Rintala,
J. (2010): Development of microbial populations in the anaerobic hydrolysis of
grass silage for methane production, FEMS Microbiology Ecology, 72, 496–506.
Wiegant, W.M., de Man A.W.A. (1986): Granulation of biomass in thermophilic
anaerobic sludge blanket reactors treating acidified wastewater, Biotechnology and
Bioengineering, 28, 718–727.
Xing, W., Zuo, J., Dai, N., Cheng, J., Li, J. (2009): Reactor performance and microbial
community of an EGSB reactor operated at 20 and 15oC, Journal of Applied
Microbiology, 107 (3), 848–857.
Yu, H., Wilson, F., Tay, J. (1998): Kinetic analysis of an anaerobic filter treating soybean
wastewater, Water Research, 32 (11), 3341–3352.
66
Chapter 5 Post-treatment of UASB effluents
by a swim-bed reactor
5.1 Introduction
The benefits of anaerobic wastewater treatment in UASB reactors are fully realized
if a post-treatment system is available. This process should be easy to operate, stable
under shock loads, and have low energy-requirement because the UASB reactor is
operated under various temperatures and hydraulic retention times. In this study,
swim-bed reactor using the novel biofringe material is presented for post-treatment of the
UASB effluents. The biofringe (BF) allows for attachment of large amount of biomass on
a flexible matrix in a fixed position. By this approach, flexing of the matrix induced by
wastewater flow creases a swimming motion that enhances mass transfer of nutrients to
the attached growth (i.e., biofilm). Thus, all the potential benefits of fluidized-bed
reactors stated above are retained without dependence on hydrodynamic conditions to
avoid settling or floating of the attachment medium and without the requirement of
screens or traps to prevent washout.
The objective of this study is to investigate the treatment potential of a swim-bed
reactor as the subsequent biological treatment. Swim-bed reactor was connected with the
3.9L-cuboid-shaped UASB reactor operated under extremely short HRTs (as described in
Chapter 2). Next, it was followed the 2.5L-cylinder-shaped UASB reactor which was
operated at 15oC as represented in Chapter 4.
5.2 Materials and methods
5.2.1 Experimental setup
Swim-bed reactor was applied for the post-treatment of two lab-scale UASB reactor
(Fig. 5-1). The swim-bed reactor was constructed of Plexiglas®, having downdraft and
updraft sections in a parallel upright arrangement (Fig. 5-2). The cross-sections of
downdraft and updraft sections were 100x100 mm and 100x25 mm, respectively. Influent
was introduced deeply within the updraft section using a peristaltic pump. Air was
introduced near the base of the updraft section, which served to mix and oxygenate the
67
wastewater while circulating it through the reactor. Effluent port was located at a height
of 630 mm from the bottom of the reactor. Total liquid volume of the swim-bed reactor
was 7.7 L. The reactor temperature was maintained at 25±1oC.
Fig. 5-1 Schematic diagram of 7.7L- swim-bed reactor as the post treatment of
UASB effluents from 3.9 L-cuboid-shaped UASB reactor (A)
and 2.5 L-cylinder-shaped UASB reactor (B)
A
B
68
Fig. 5-2 Cross-sectional schematic diagram of swim-bed reactor
5.2.2 Seed sludge
The reactor was initially seeded using cultivated activated sludge from a lab-scale
fill-and-draw batch reactor. The synthetic medium used for the development and
maintenance of the seed sludge was the same as described in Chapter 2. After seeding, the
sludge was aerated for 72 hours without substrate feeding for allowing biomass
attachment to the BF carrier. Then, continuous-flow treatment experiments were initiated
as shown in Fig. 5-1. The settled sludge was gently mixed in settling tank and returned
back to the swim-bed reactor with 100% of recycling rate.
5.2.3 Biomass carrier
The BF biomass carrier consists of support filament and fringe yarns (diameter of 3
mm, NET Co. Ltd., Japan), which are made of polyester and hydrophilic acrylic fibers. It
has special configuration that the inner part is in high density and the outer part is in
rarefraction, so that sludge could attach to the BF carrier. In this study, the BF with length
of 0.5 m was used.
5.2.4 Analytical methods
COD was measured by the closed reflux colorimetric method according to Standard
Methods (5220 D; APHA, 1995). Ammonium (NH4+) was quantified by the phenate
69
method as described by Kanda (1995). Nitrite (NO2–), nitrate (NO3
–) ions were measured
using an ion analyzer (IA-100 system, TOA Electronics, Ltd., Tokyo, Japan), with
pretreatment by a 0.45-µm syringe filter for effluent samples. Total nitrogen (TN) was
determined by the persulfate method according to Standard Methods (4500-Norg D;
APHA, 1995). By the persulfate method all nitrogen is oxidized to NO3–, which was
measured using the UV spectrophotometric screening method according to Standard
Methods (4500- NO3–, APHA, 1995). The suspended solids (SS) content was
determined according to Standard Methods (2540 D; APHA, 1995).
PVA-gel beads (diameter of 4 mm, specific gravity of 1.025) were used to establish a
correlation between airflow rate and water flow velocity in the narrow updraft section,
which was then used to estimate the nominal average upflow velocities in the reaction
zone.
5.3 Results and discussion
5.3.1 Reactor startup
The swim-bed reactor was startup with 20 g of activated sludge was placed in the
reactor with tap water for an initial total sludge concentration of 2 g L-1 and air flow rate
was set at 3 L min-1 to circulate the solution through the reaction zone at a velocity of 5 cm
sec-1. Attachment of sludge to the BF carrier, which was determined by the decrease of
total sludge in the solution, proceeded as shown in Fig. 5-3.
Fig. 5-3 Time course of total sludge attachment to the BF carrier
0
2
4
6
8
10
0 5 10 15 20 25 30 35
Tot
al s
lud
ge (
g)
Time (h)
70
The attachment of 9 g of sludge during a 32-h period amounted to 18 g m-1 of BF
carrier. Following the sludge attachment periods, UASB effluent was supplied to the
downdraft section of swim-bed reactor with the flow rates as high as it was in UASB
reactor. Sludge solution became clear within two days. Following the first five days, the
reactor was considered acclimatized and airflow rate was increased to 6 L min-1.
5.3.2 COD removal performance
The swim-bed reactor was operated as post-treatment process of UASB reactor
during 350 days (Fig. 5-4). As post-treatment of the UASB effluents from 3.9
L-cuboid-shaped UASB reactor, which was operated under temperatures ranged from 35
to 15oC and short HRTs, the swim-bed reactor was also experienced the increase in
loading rates. COD removal rate up to 11.4 kg-COD m-3 d-1 was achieved by the end of
the first period. Under longer HRTs, COD removal rates were consistent at 0.6 kg-COD
m-3 d-1, associated with high removal efficiencies of as high as 90% was observed.
Fig. 5-4 Time courses of COD removal by swim-bed reactor
(dotted arrows: temperature of UASB effluents)
0
3
6
9
12
15
0
50
100
150
200
250
300
350
400
0 50 100 150 200 250 300 350 400
Loa
din
g ra
te (
kg
CO
D m
-3d
-1)
Rem
oval
rat
e (k
g C
OD
m-3
d-1
)H
RT
(h
)
CO
D c
once
ntr
atio
n (
mg
L-1
)
Time (day)
Influent COD Effluent COD Loading rate Removal rate HRT
Treatment of 3.9L-cuboid-shaped UASB effluent
35oC 25oC 15oC 15oC
Treatment of
2.5L-cylinder-shaped
UASB effluent
71
Table 5-1 Treatment performance of the swim-bed reactor
Temperature of UASB effluents
Period (day)
HRT (h)
Inf. COD
(mg L-1)
Eff. COD
(mg L-1)
Loading rate (kg-COD m-3 d-1)
Removal rate (kg-COD m-3 d-1)
Removal efficiency
(%)
35oC
0-17 3.9 44-176 6-18 0.27-1.07 0.23-0.90 85
18-24 3.1 16-22 3-4 0.12-0.17 0.10-0.14 81
25-30 1.7 44-48 8-9 0.53-0.62 0.42-0.49 79
31-36 1.2 48-53 11-12 0.97-1.07 0.75-0.83 77
37-41 1.0 52-56 13-14 1.30-1.40 0.97-1.05 75
42-51 0.8 81-86 23-24 2.52-2.68 1.81-1.93 72
52-60 0.6 90-104 25-29 3.37-4.54 2.43-3.27 72
61-70 0.4 118-192 35-56 5.52-10.77 3.88-7.63 71
25oC
71-91 3.1 146-162 25-28 1.14-1.27 0.91-1.07 83
92-112 1.7 151-163 32-36 2.12-2.29 1.67-1.78 79
113-133 1.2 161-170 36-38 3.26-3.44 2.53-2.69 78
134-153 1.0 166-178 40-45 4.14-4.44 3.09-3.32 75
154-179 0.8 170-185 45-51 5.30-5.74 3.99-4.27 73
180-190 0.6 201-268 60-80 6.89-11.69 4.83-8.20 70
15oC
191-205 3.1 281-287 42-47 2.19-2.24 1.84-1.91 85
206-223 1.7 291-299 55-59 4.07-4.19 3.24-3.39 81
224-239 1.2 305-309 64-69 6.18-6.26 4.80-4.90 79
240-262 1.0 305-313 75-79 7.61-7.80 5.71-5.91 76
263-269 0.8 333-340 83-88 10.38-10.60 7.79-7.85 75
270-280 0.6 349-364 100-106 13.05-15.88 9.20-11.43 72
15oC 327-406 3.9 83-117 9-17 0.50-0.71 0.43-0.64 90
Table 5-1 shows the operational strategy and running performance of swim-bed
reactor treating the UASB effluents. As post-treatment of UASB, the reactor was also
experienced a decrease of HRT and increase in COD loading rates. Under HRTs below 4h,
COD removal efficiency nearly 85% was achieved, and more than 80% of COD could be
removed by combination of swim-bed reactor with UASB. The final effluent COD
concentration (day 83-117) was very low.
72
The COD removal efficiencies were 85% and 90% at loading rates of 0.7 kg-COD
m-3 d-1 (HRT 3.9 h) during day 2-5 and day 389-392. Under HRT 3.1 h, COD removal
efficiencies were 81%, 83% and 85% at loading rates of 1.1-2.2 kg-COD m-3 d-1 on day
18-24, 71-91, 191-205, respectively, which were associated with the UASB effluents with
temperatures ranged from 35 to 15oC. The results showed that COD removal efficiencies
by swim-bed reactor could be greater if the same loading rates were applied. Besides, the
widely-ranged temperatures applied in the earlier UASB process could not affect to the
treatment by swim-bed reactor. With subsequent increases in COD loading rates, removal
rates increased in a linear manner as shown in Fig. 5-5. It indicated that COD overloads
did not occur in swim-bed reactor under a decrease of HRT.
Fig. 5-5 Linear relation between COD removal rate and COD loading rate
Fig. 5-6 The BF carrier with attached growth (day 50 and day 320)
y = 0.7147x + 0.1287R² = 0.9975
0
2
4
6
8
10
12
14
0 2 4 6 8 10 12 14 16
Rem
oval
rat
e (k
g-C
OD
m-3
d-1
)
Loading rate (kg-COD m-3 d-1)
73
Fig 5-6 shows the increasing biomass attachment on the BF carrier. Due to the
decrease of HRT, the suspended solids (SS) contents were increased stepwise during the
first period, with high flocculent SS levels appearing following day 61, 154 and 267 (Fig.
5-7). From day 340, the floc content diminished and in the following days the attached
growth became increasingly thick.
Fig. 5-7 Time courses of reactor SS concentration and linear uplow velocity
5.4 Conclusions
Swim-bed reactor using the BF carrier demonstrated effective treatment of UASB
effluent with 70-90% COD removal efficiencies under volumetric loadings up to 16 kg
COD m-3 d-1 and HRTs as short as 0.6 to 3.9 h. The widely-ranged temperatures applied
for UASB process could not affect to the treatment by swim-bed reactor.
References
APHA, AWWA, WPCF (1995): Standard Methods for the Examination of Water and
Wastewater, 19th ed., American Public Health Association, Washington, DC.
Aziz, H.A., Ling, T.J., Haque, A.A.M., Umar, M., Adland, M.N. (2011): Leachate
treatment by swim-bed biofringe technology, Desalination, 276, 278–286.
74
Cheng, Y. (2006): Advanced wastewater treatment using acyle-resin fiber biomass carrier.
Ph.D. Thesis, Kumamoto University, Kumamoto, Japan, 31–45.
Kanda, J. (1995): Determination of ammonium in seawater based on the indophenol
reaction with o-phenylphenol (OPP), Water Research, 29, 2746–2750.
Khan, A.A., Gaur, R.Z., Tyagi, V.K., Khursheed, A., Lew, B., Mehrotra, I., Kazmi, A.A.
(2011): Sustainable options of post treatment of UASB effluent treating sewage: a
review, Resources Conservation and Recycling, 55, 1232–1251.
Rouse, J.D., Yazaki, D., Cheng, Y. (2004): Swim-bed technology as an innovative
attached-growth process for high-rate wastewater treatment, Japanese Journal of
Water Treatment Biology, 40 (3), 115–124.
Takahashi, M., Yamaguchi, T., Kuramoto, Y., Nagano, A., Shimozaki, S., Sumino, H.,
Araki, N., Yamazaki, S., Kawakami, S., Harada, H. (2011): Performance of a
pilot-scale sewage treatment: An up-flow anaerobic sludge blanket (UASB) and a
down-flow hanging sponge (DHS) reactors combined system by sulfur-redox
reaction process under low-temperature conditions, Bioresource Technology, 102,
753–757.
Tyagi, V.K., Khan, A.A., Kazmi, A.A., Mehrotra, I., Chopra, A.K. (2009): Slow sand
filtration of UASB reactor effluent: A promising post treatment technique,
Desalination, 249 (2), 571–576.
75
Chapter 6 Conclusions
COD removal by UASB reactor using PVA-gel beads as biomass carrier was
investigated in this study. This treatment process could successfully apply to the
treatment of low-strength organic wastewater. According to the experimental results
obtained in this study, the conclusions are summarized briefly below:
In the first part of this study, the effect of temperatures on the performance of UASB
reactor treating low-strength wastewater was investigated. Reactor temperatures ranged
from 35oC and 25oC to 15oC. The influent COD concentrations were approximately 430
mg L-1. As the temperature decreased by 10oC, COD removal rates were reduced by 50%.
Temperature coefficient (θ) in case of PVA-gel carrier was determined to be as 1.07,
consistent with the range of θ values for highly porous structure.
In the second part of this study, the comparison of two low-cost gel biomass carriers,
including poly(vinyl alcohol)-gel and poly(ethylene glycol)-gel beads was carried out.
The two identical UASB reactors using these gel carriers were operated at 30oC and
organic loading rate up to 4 kg-COD m-3 d-1. Influent COD concentrations of 300 mg L-1
were used to feed the reactors. The UASBPVA was found to be more competitive with
COD removal efficiency reached 90%, compared with 77% by the UASBPEG. Besides,
SEM images and DNA analysis showed that the macrostructure of PVA gel carrier
supported for deeper attached growth. Shannon-Wiener index (H) was applied to
investigate the diversity of methanogenic archaeal population in the anaerobic sludges
obtained from the two reactors.
In the third part of this study, the operation of UASB reactor treating
low-COD-containing wastewater (influent COD concentrations of 430 mg L-1) at 15oC, a
challenging temperature as identified in the previous study was conducted. Longer
hydraulic retention times (HRTs > 2 h) were applied. Compared to the earlier operation,
COD removal efficiency of as high as 75-80% was obtained. DNA analysis showed that
microbial population of UASB sludge was in a high diversity and became stronger with
the existence of Methanosaeta concilli. In addition, analysis of kinetic parameters for the
performance of UASB reactors was reported. Grau second-order kinetic model and
modified Stover-Kincannon kinetic model were applied to investigate the kinetic
76
parameters and predicting the effluent COD concentrations. With higher correlation of
99%, Grau second-order model was confirmed as reliable model to be used in the design
of the UASB reactor.
In the fourth part of this study, a swim-bed reactor was applied for the treatment of
UASB effluents. The reactor was operated up to 16 kg-COD m-3 d-1, reaching about
70-90% COD removal at comparatively short hydraulic retention times (HRTs < 4 h). The
experimental results indicated that swim-bed reactor suffered the pressures from
widely-ranged temperature of UASB treatment and decreased HRTs.
From the experimental results, it can be concluded that the UASB reactors using
PVA-gel carrier was suitable for treating low-strength wastewater under short hydraulic
retention times.
77
EXPERIMENTAL WASTEWATER TREATMENT SYSTEMS
THE FIRST PART THE SECOND PART
THE THIRD PART THE FOURTH PART
78
Appendix: Publications
Journal papers
1. Dophuong Khanh, Laiminh Quan, Wenjie Zhang, Daisuke Hira and Kenji Furukawa (2011): Effect of temperature on low-strength wastewater treatment by UASB reactor using poly(vinyl alcohol)-gel carrier, Bioresource Technology 102, 11147–11154.
2. Dophuong Khanh, Quan Lai Minh, Hiroaki Fujii and Kenji Furukawa (2012): Upflow anaerobic wastewater treatment using PVA/PEG beads as biomass carriers, International Journal of Earth Science and Engineering (IJEE). Cafet-Innova Publications, ISSN: 0974-5904. Vol.4, No.5, 222–229.
3. Dophuong Khanh, Laiminh Quan, Wenjie Zhang, Daisuke Hira and Kenji Furukawa (2012): Response of poly(vinyl alcohol) and poly(ethylene glycol)-gel biogranular sludges in two identical UASB reactors, Bioresource Technology (under peer review).
4. Dophuong Khanh, Laiminh Quan, Wenjie Zhang, Daisuke Hira and Kenji Furukawa (2012): Treatment of low-strength wastewater by UASB reactor using PVA-gel beads operated at 15oC, Bioresource Technology (under peer review).
5. Lai Minh Quan, Do Phuong Khanh, Daisuke Hira and Kenji Furukawa (2011): Reject water treatment by improvement of whole cell anammox entrapment using polyvinyl alcohol/alginate gel, Biodegradation 22, 1155–1167.
6. Lai Minh Quan, Tran Thanh Liem, Do Phuong Khanh and Kenji Furukawa (2010): High ammonium wastewater treatment of stirred tank anammox reactor using polyvinyl alcohol/alginate gel as biomass carrier, Japanese Journal of Water Treatment Biology 46 (2), 109–117.
International conference presentations
1. Do Phuong Khanh, Lai Minh Quan, Wenjie Zhang, Daisuke Hira and Kenji Furukawa. Effect of temperature on low-strength wastewater treatment by UASB reactor using poly(vinyl alcohol)-gel carrier, Minamata International Symposium on Environment and Energy Technology (MISSION 2011), Kumamoto, Japan. Best Poster Award. Proceedings, pp. 156–163.
2. Do Phuong Khanh, Lai Minh Quan, Wenjie Zhang, Daisuke Hira, Kenji Furukawa. COD removal in a UASB reactor using poly(vinyl-alcohol)-gel carrier, GelK-EDL-APIEL Joint International Symposium – Intergrated Approach to Environmental Challenges in Asia, 2011, Kumamoto, Japan. Oral presentation. Proceedings, p. 37.
3. Do Phuong Khanh, Lai Minh Quan, Zhang Wenjie and Kenji Furukawa. Effect of temperature on low-strength wastewater treatment by UASB reactor using poly(vinyl alcohol)-gel carrier. The 6th International Student Conference on
79
Advance Science and Technology (ICAST 2011), Jinan, China. Oral presentation. Proceedings, pp. 47–48.
4. Do Phuong Khanh, Lai Minh Quan, Wenjie Zhang, Daisuke Hira, Kenji Furukawa. Treatment performance of low-strength wastewater by UASB reactor using PVA-gel carrier. The 1st International Conference on Green Environmental Technology 2011, Busan, Korea. Oral presentation. Proceedings, pp. 61–62.
5. Khanh Do Phuong, Quan Lai Minh, Hiroaki Fujii, Kenji Furukawa. Upflow anaerobic wastewater treatment using PVA/PEG beads as biomass carriers. International Engineering Symposium, IES 2011, Kumamoto, Japan. Oral presentation. Proceedings, pp. C4-1-1–C4-1-7.
6. Khanh Do Phuong, Wenjie Zhang, Kazuya Kamishima, Quan Lai Minh, Hiroaki Fujii, Goro Kobayashi, Kenji Furukawa. Load maximization of an EGSB reactor using PVA carrier in low-strength wastewater treatment. Advanced Engineering Technology for Environment and Energy – The 3rd Joint Workshop between Kumamoto University, Pusan National University, Dalian University of Technology, 2010, Kumamoto, Japan. Oral presentation. Proceedings, pp. 53–54.
7. Do Phuong Khanh, Lai Minh Quan, Zhang Wenjie, Kenji Furukawa. Up-flow anaerobic wastewater treatment using PVA/PEG gel beads as biomass carriers. The 8th Kumamoto University Forum, 2010, Hanoi, Vietnam. Poster presentation. Proceedings, p. 93.
8. Do Phuong Khanh, Lai Minh Quan, Wenjie Zhang, Kenji Furukawa. High rate wastewater treatment by upflow anaerobic bioreactors using PVA gel beads. The 5th International Student Conference on Advanced Science and Technology (ICAST 2010), Kumamoto, Japan. Oral presentation. Proceedings, pp. 311–312.
9. Do Phuong Khanh, Doan Thu Ha, Kenji Furukawa. Renovation of water treatment process for effective ammonia removal from Hanoi groundwater. First International Symposium on Groundwater Environment (IGES 2010), Kumamoto, Japan. Poster presentation. Proceedings, pp. 99–102.
10. Do Phuong Khanh, Lai Minh Quan, Hiroaki Fujii, Goro Kobayashi, Kenji Furukawa. Up-flow anaerobic treatment of low-strength wastewater using PVA gel beads. First International Workshop on Environment, Energy and Innovative Technology in Minamata, 2010, Kumamoto, Japan. Poster presentation. Proceedings, p. 61.
11. Do Phuong Khanh, Kazuya Kamishima, Kenji Furukawa: Dilute wastewater treatment by anaerobic attached growth reactor using PVA-gel beads under high loading rates. The 3rd International Student Conference on Advance Science and Technology (ICAST 2009), Seoul, Korea. Poster presentation. Proceedings, pp. 267–268.
Domestic conference presentations
1. Do Phuong Khanh, Lai Minh Quan, Zhang Wenjie, Kenji Furukawa. Wastewater treatment by UASB reactors employing polyvinyl alcohol gel carrier. Annual
80
Meeting of Kyushu Branch, Japan Society of Material Cycles and Waste Management (JSMCWM). Fukuoka, Japan. Poster presentation. 平成 23 年 5 月.
2. Do Phuong Khanh, Lai Minh Quan, Hiroaki Fujii, Goro Kobayashi, Kenji Furukawa. Upflow anaerobic treatment of low-strength wastewater using PVA gel beads, Oral presentation.日本水処理生物学会 第47回大会 (筑波大学). 成 22 年 11 月, p. 68.
3. Do Phuong Khanh, Kazuya Kamishima, Hiroaki Fujii, Goro Kobayashi, Kenji Furukawa. Dilute wastewater treatment by anaerobic attached growth reactor using PVA-gel beads under high loading rates and temperature difference, Oral presentation. 第 44 回日本水環境学会年会 (福岡大学). 平成 22 年 3 月, p. 164.
4. Do Phuong Khanh, Zhang Wenjie, Yasunori Koga, Kenji Furukawa: Treatment capabilities of upflow anaerobic reactor using PVA gel beads for low strength wastewater, Oral presentation.日本水環境学会九州支部研究発表会(熊本大学). 平成 20 年 2 月. pp. 63–64.
5. Zhang Wenjie, Khanh Do Phuong, Kenji Furukawa: Treatment of low strength wastewater by anaerobic fluidized bed reactor, Oral presentation.日本水処理生物学会 第 45 回 大会 (秋田大会). 平成 20 年 11 月, p. 29.