Cloning and molecular characterization of vff1 gene...
-
Upload
truongkien -
Category
Documents
-
view
226 -
download
5
Transcript of Cloning and molecular characterization of vff1 gene...
-
Cloning and molecular characterization of vff1 gene encoding Forisomes of Vicia faba
Von der Fakultt fr Mathematik, Informatik and Naturwissenschaften der Rheinisch-Westflischen Technischen Hochschule Aachen zur Erlangung des akademischen
Grades einer Doktorin der Naturwissenschaften genehmigte Dissertation
vorgelegt von
M. Sc. Maria Eugenia Fontanellaz
aus Rosario, Argentinien
Berichter: Universittsprofessor Dr. rer. nat. R. Fischer Universittsprofessor Dr. rer. nat. D. Prfer Tag der mndlichen Prfung: 7. Dezember 2006
Diese Dissertation ist auf den Internetseiten der Hochschulbibliothek online verfgbar.
-
Contents ___________________________________________________________________________
I
I INTRODUCTION
I.1 Phloem structure and function 1
I.1.1 Sieve element-companion cell complex 1
I.1.2 P-Proteins and regulation of phloem transport 2
I.1.3 Forisomes 5
I.1.4 Ca2+-binding motifs and secondary protein structures 7
I.1.4.1 EF-hand 7
I.1.4.2 Coiled-coil domains 8
I.2 Promoter sequences and regulation of transcription 9
I.2.1 Phloem-specific promoters 9
I.3 Aim of this thesis 12
II MATERIALS AND METHODS 14
II.1 Materials 14
II.1.1 Chemicals and consumables 14
II.1.2 Enzymes and reaction kits 14
II.1.3 Buffers, media and solutions 15
II.1.4 Matrices and membranes 15
II.1.5 Primary antibodies, secondary antibodies and substrates 15
II.1.6 Biological material 15
II.1.6.1 Bacterial strains 15
II.1.6.2 Plants 16
II.1.6.3 Animals 16
II.1.7 Vectors 16
II.1.7.1 Bacterial expression vector 16
II.1.7.2 Plant expression vectors 17
II.1.8 Oligonucleotides 17
II.1.9 Equipment and applications 18
II.2 Methods 20
II.2.1 Plant material and isolation of Forisomes 20
II.2.2 Peptides sequencing 20
II.2.3 Isolation of genomic plant DNA 21
-
Contents ___________________________________________________________________________
II
II.2.4 RNA isolation 21
II.2.5 Libraries construction and screening strategies 22
II.2.5.1 cDNA expression library 22
II.2.5.2 cDNA libraries 22
II.2.6 PCR technologies 24
II.2.6.1 Cloning of 5 and 3 ends of full-length cDNAs using
RACE-PCR 24
II.2.6.2 PCR amplification of cDNA 25
II.2.6.3 Identification of introns and genomic DNA cloning by
LD PCR 26
II.2.6.4 Genome Walking 26
II.2.7 Recombinant DNA technologies 27
II.2.7.1 Isolation of plasmid DNA from E.coli 27
II.2.7.2 Quantification of DNA 27
II.2.7.3 PCR amplification 27
II.2.7.4 Agarose gel electrophoresis of DNA 28
II.2.7.5 Preparative agarose gel electrophoresis 28
II.2.7.6 DNA sequence analysis 29
II.2.8 Preparation and transformation of E. coli 29
II.2.8.1 Preparation of electro-competent E. coli 29
II.2.8.2 Transformation of E. coli by electroporation 29
II.2.8.3 Culturing of E. coli and glycerol stock preparation 29
II.2.9 Preparation and transformation of Agrobacterium tumefaciens 30
II.2.9.1 Preparation of electro-competent Agrobacterium cells 30
II.2.9.2 Transformation of Agrobacterium by electroporation 30
II.2.9.3 Determination of the efficiency of recombinant bacteria
transformation 31
II.2.9.4 Growth of recombinant A. tumefaciens and preparation
of glycerol stocks 31
II.2.10 Generation and characterisation of transgenic plants 31
II.2.10.1 Transient transformation of tobacco leaves 31
II.2.10.2 Preparation of recombinant Agrobacteria 31
II.2.10.3 Vacuum infiltration of tobacco leaves 32
II.2.10.4 Stable transformation of tobacco plants 32
-
Contents ___________________________________________________________________________
III
II.2.10.5 Growth of N. tabacum cv. Petite Havana SR1 33
II.2.10.6 Measurement of GUS activity and histochemical analysis 33
II.2.11 Expression and purification of recombinant proteins 34
II.2.11.1 Expression and purification of Forisome-GST fusion
proteins from E. coli 34
II.2.11.2 Fermentation at 4-liter scale 35
II.2.12 Protein analysis 36
II.2.12.1 Quantification of proteins 36
II.2.12.2 SDS-PAGE and Coomassie brillant blue staining 36
II.2.12.3 2D-PAGE analysis 37
II.2.12.4 Immunoblot analysis 38
II.2.13 Polyclonal antibodies production 38
II.2.13.1 Mouse immunization 38
II.2.13.2 Chicken immunization 39
II.2.13.3 Rabbit antisera 39
II.2.14 Determination of antisera titers 39
II.2.15 Confocal immunofluorescence microscopy 41
III RESULTS 41
III.1 Molecular characterization of Forisome genes 41
III.1.1 Analysis of isolated Vicia faba Forisomes by SDS-PAA
gel electrophoresis 41
III.1.2 Generation and characterization of Forisome-specific
polyclonal antibodies 41
III.1.2.1 Immunoblot analysis of isolated Vicia faba Forisomes 41
III.1.2.2 Immunoblot analysis of isolated Vicia faba Forisomes
on 2D-gel electrophoresis 42
III.1.3 Screening of cDNA Libraries 43
III.1.4 Immunoscreening of cDNA expression library 45
III.1.5 PCR screening of cDNA expression library 46
III.1.6 Cloning full-length Forisome cDNA 46
III.1.7 Isolation of total RNA from Vicia faba 51
III.1.8 Identification of the transcription start sites for vff1 52
III.1.9 Molecular characterisation of the vff1 genomic clone 53
-
Contents ___________________________________________________________________________
IV
III.2 Molecular cloning and characterization of the vff1 promoter 54
III.2.1 Construction of genome walking libraries 54
III.2.2 Identification and cloning of vff1 gene 5-flanking region 54
III.2.3 Potential regulatory sequences in the vff1 promoter 56
III.2.4 Characterization of vff1 promoter in transgenic tobacco 58
III.2.4.1 Cloning of vff1 promoter into the pTRAk-GUS vector 58
III.2.4.2 Expression of vff1 Promoter-GUS fusions in tobacco
plants 60
III.2.4.2.1 Tissue specificity of vff1 promoter in transgenic
plants 60
III.2.4.2.2 Developmental regulation of vff1 promoter in
transgenic plants 63
III.2.4.3 Deletion analysis of vff1 promoter in transiently
transformed tobacco leaves 65
III.3 Bacterial expression and characterization of VFF1 66
III.3.1 Cloning of vff1 into the bacterial expression vector
pGEX-5X-3 66
III.3.2 Bacterial expression and purification of VFF1 66
III.3.3 Characterization of GST-VFF1 fusion protein by
immunoreativity toward Forisome-specific mouse and
chicken antisera 68
III.4 Immunological characterization of native and recombinant
Forisomes 70
III.4.1 Reactivity of polyclonal anti-GST-VFF1 antibodies to isolated
Forisomes 70
III.4.2 Characterization of native Forisomes by immunofluorescence 71
III.4.2.1 Reactivity of Forisome-specific polyclonal antibodies to
native Forisomes 71
III.4.2.2 Reactivity of VFF1-specific polyclonal antibodies to native
Forisomes 73
IV DISCUSSION 75
IV.1 Molecular characterization of Forisome genes 75
IV.1.1 Analysis of Vicia faba Forisome subunits 75
-
Contents ___________________________________________________________________________
V
IV.1.2 Cloning and characterization of vff1 gene 76
IV.1.2.1 Screening of cDNA libraries 76
IV.1.2.2 Database search and cloning of vff1 gene 78
IV.1.2.3 Sequence analysis of vff1 gene 78
IV.1.2.4 Motifs identified within the vff1 gene 79
IV.1.3 Immunological evidence of vff1 gene encoding a Forisome
protein 82
IV.1.3.1 Expression and purification of recombinant VFF1
protein 82
IV.1.3.2 Immunoreactivity of Vicia faba Forisome-specific
polyclonal antibodies to recombinant VFF1 proteins
and native Vicia faba Forisomes 83
IV.1.3.3 Immunoreactivity of VFF1-specific polyclonal antibodies
to recombinant VFF1 proteins and native Vicia faba
Forisomes 84
IV.2 Molecular characterization of vff1 promoter 85
IV.2.1 Sequence analysis of vff1 promoter 85
IV.2.2 Phloem-specific expression pattern driven by vff1 promoter 86
IV.2.3 Differential expression pattern driven by vff1 promoter in the
sieve element-companion cell complex 88
IV.2.4 Developmental expression pattern of vff1 promoter in different
maturation stages 90
IV.2.4.1 Vff1 promoter expression pattern in roots of N. tabacum 90
IV.2.4.2 Vff1 promoter expression pattern in leaves of N. tabacum 91
IV.2.5 Vff1 promoter activation during the sink-source transition 92
IV.2.6 Vff1 promoter expression induced upon wounding 93
IV.2.7 Deletion analysis 94
IV.3 Conclusion and future prospects 95
V SUMMARY 97
VI REFERENCES 99
VII APPENDICES 116
VII.1 List of abbreviations 116
-
Contents ___________________________________________________________________________
VI
VII.2 Schematic presentation of vectors maps 119
VII.3 Figures 121
VII.4 Tables 122
-
Chapter I Introduction ___________________________________________________________________________
1
I Introduction
I.1 Phloem structure and function
In higher vascular plants, phloem is a highly specialized tissue for long distance transport of
metabolites and signaling components. In contrast, water and inorganic nutrients flow from
roots to shoots and leaves in the xylem. Topologically, xylem flux takes an apoplastic, i.e.,
extracellular path, as the xylem vessels consist of the lignified walls of dead cells. On the
other hand, products of photosynthesis travel from source to sink tissues in the sieve tubes of
the phloem, following a symplastic pathway (Behnke and Sjlund, 1990). Moreover, a wide
variety of other material is also transported through the phloem, including proteins, amino
acids, solutes, viruses, and various signaling molecules.
Sieve tubes consist of sieve elements (SEs), terminally differentiated cells that undergo
exceptional cytoplasmic reorganization to become functional phloem conductive cells capable
of long-distance translocation. Mature sieve elements are characteristically devoid of most of
the intracellular organelles, nuclei, central vacuole, Golgi bodies and dictyosomes (Oparka
and Turgeon, 1999; Cronshaw, 1981) as well as most of the ribosomes and microtubules that
are lost during the course of differentiation (Sjlund, 1997). Microfilaments also vanish
during sieve element maturation (Parthasarathy and Pesacreta, 1980). Reorganization of the
endomembrane system results from degeneration of the tonoplast and dictyosomes and
changes in the endoplasmic reticulum (Sjlund and Shih, 1983).
Having a common boundary, arranged end-to-end sieve elements develop numerous pores in
the cell walls between them. Plasmodesmata (PD) connecting SEs across the end walls
become greatly modified giving rise to the sieve plates that are characteristic of this tissue
(Behnke, 1989). Sieve plates ensure cytoplasmic continuity of the entire sieve-tube network,
enabling pressure-driven mass flow throughout the plant body (Knoblauch and van Bel, 1998;
van Bel et al., 2002). According to the mass flow concept of phloem transport (Mnch, 1930),
the transport of materials through phloem sieve tubes is passive, nonselective, and driven
entirely by pressure gradients that are maintained by active loading of photosynthetic products
in source tissue and unloading of materials in sink tissue.
I.1.1 Sieve element-companion cell complex
After the first description of the SE by Hartig (1837) the typical sieve element/companion cell
complex of the phloems, became center of numerous investigations. Typically, each sieve
element in angiosperms is accompanied by one or more companion cells (CCs), which
interact intimately with the sieve element and play a crucial role in regulating phloem loading
and unloading and in the turnover of sieve element proteins and other components (Oparka
and Turgeon, 1999). Sieve elements and companion cells are derived from unequal
-
Chapter I Introduction ___________________________________________________________________________
2
longitudinal division of a single fusiform mother cell (Esau, 1969). During the course of
differentiation, cytoplasmic degeneration include a disintegration of the nucleus together with
the loss of ribosomes which hinders its protein biosynthesis (Thompson and Schulz, 1999).
Thus, the cell that becomes the sieve element, gradually lose genetic and metabolic control.
As a consequence, these elongated conducting elements of the phloem, the SEs, become
intimately (structurally, developmentally, and functionally) associated with adjacent
companion cells between which are capable of exchanging information via specialized pore
plasmodesmata units (PPUs; van Bel and Kempers, 1996). These PPUs are different from
other plasmodesmata. The lateral (axial) plasmodesmata that connect the SE and CC (PPUs)
are always branched on the CC side of the shared wall only, thereby comprising one broader
pore-like channel at the sieve element side while several narrower branching out at the
companion cell side (Esau and Thorsch, 1985). The PPUs form a continuity between the sieve
element plasma membrane and that of the companion cell, hence, connecting their
cytoplasms. Because of these intimate structural and functional connections between SE and
CC, the SE-CC complex is frequently viewed as a single functional entity within the phloem.
During the differentiation of phloem sieve elements, the endoplasmic reticulum undergoes
unique modifications to form the sieve element reticulum (SER; Sjlund and Shih, 1983)
which persists in mature, functioning sieve tubes. Cisternae of the SER lack ribosomes and
are restricted to the periphery of the sieve element at late stages of development. Some of the
SER are seen as single cisternae in close contact with the sieve element plasma membrane.
Probably the companion cell ER is also in contact with the sieve element reticulum held
together by the PPUs. Both the PPUs and the SER possibly ensure the protein transport of the
companion cell to the sieve element (Fisher et al., 1992; Imlau et al., 1999).
I.1.2 P-Proteins and regulation of phloem transport
More than a hundred proteins were detected in phloem exudates of Cucurbita maxima,
Triticum aestivum, Ricinus communis and Oryza sativa (Eschrich and Heyser, 1975; Fisher et
al., 1992; Nakamura et al., 1993; Sakuth et al., 1993). These phloem proteins were considered
to maintain the physiological functions of sieve tubes, such as sieve plate occlusion, signal
transduction, redox regulation, and phloem loading, among others (Hayashi et al., 2000).
Mature sieve elements retain a modified endoplasmic reticulum (ER), mitochondria,
numerous types of proteins, and specialized sieve element plastids. Most of these components
are arranged along the lateral walls of the sieve element and collectively constitute a system
known as the parietal layer (Ehlers et al., 2000). Based on electron micrographs and
descriptions of plastids from the sieve elements of many different species, two types of sieve
element plastids are distinguished (Behnke, 1991a). S-type plastids contain only starch
inclusions, while P-type plastids contain mainly protein inclusions along with some starch
inclusions. Furthermore, crystalloid proteins were present in these sieve elements. Behnke
-
Chapter I Introduction ___________________________________________________________________________
3
(1991b) referred to nondispersive versus dispersive protein bodies, also called P-proteins
or structural sieve element proteins. These terms arose because of changes that are observed
during sieve element ontogeny. Early in the maturation process, many protein bodies are often
observed, some of which disperse as the sieve element matures and some that remain
unchanged in mature sieve elements. Early stages of sieve element differentiation are
characterized by the appearance of structurally distinct cytoplasmic proteins, in reference to
the P-proteins. Ultrastructural investigations originally defined P-proteins as idiosyncratic
components of the structural architecture of sieve elements (Cronshaw and Esau, 1967).
Depending upon the plant species, P-proteins form fibrillar, tubular, or crystalline inclusions
whose accumulation and structural state appear to be strictly controlled during differentiation.
Figure I-1 In vivo structure of sieve elements in Vicia faba (Knoblauch and van Bel, 1998). Sections of two sieve tubes with CCs, mostly in staggered position are depicted. SEs and CCs are mostly connected through numerous pore plasmodesma units. P-plastids, mitochondria, and ER are parietally positioned and evenly distributed. Parietal proteins are locally aggregated. Parietal proteins and ER are sometimes located on the sieve plates or the margins of the sieve pores but do not impede mass flow. A large spindle-shaped crystalline protein cluster rests close to the sieve plate. The massive protein body is a specialty of the Fabaceae. C, callose; CC, companion cell; CP, crystalline protein body; CW, cell wall; ER, endoplasmic reticulum; M, mitochondria; N, nucleus; P and Pl, plastids; PP, parietal protein; PPU, pore plasmodesma unit; SE, sieve element; SP, sieve plate; V, vacuole.
There are many shapes of non-dispersive fibrous and crystalloid protein bodies, also called P-
proteins, which may be quite large and are often observed in the lumen of sieve elements
(Figure I-1). Electron micrographic images sometimes show masses of fibrous or amorphous
protein located directly in front of or within the pores of sieve plates and that appear to block
transport through the pores. To date, the large crystalloid P-protein bodies that occur
exclusively in Fabaceae were classified as being non-dispersive (Behnke, 1991b).
Confocal laser scanning microscopy (CLSM) allowed the direct visualization of fluorescent
dyes moving in sieve tubes of V. faba (Knoblauch and van Bel, 1998), which provided
definitive evidence of unimpeded mass flow in intact plants. This study also reported that P-
-
Chapter I Introduction ___________________________________________________________________________
4
type plastids in V. faba actually exploded upon injury of sieve elements, releasing their
protein contents, which, together with the dispersed crystalloid protein, rapidly occluded the
sieve plate pores. Furthermore, it was observed that crystalloid P-proteins of V. faba rapidly
disperse and occlude sieve plate pores after injury or osmotic shock (Knoblauch et al., 2001).
This process is rapidly reversible and controlled by calcium fluxes. Protein from the large
crystalloid protein bodies in V. faba sieve elements dispersed to plug the sieve plate pores
after injury from micropipette injection (Figure I-2) or osmotic shock induced by various
osmolytes.
Figure I-2 Conformational change of crystalline P-protein bodies in Vicia faba as a response to injury (Knoblauch et al., 2001). Crystalloid P-protein bodies were observed in CDMFDA-stained phloem tissue of broad bean (V. faba) by CLSM. (A) Condensed conformation before insertion of a micropipette (not visible; tip diameter of 2 mm). (B) Dispersed conformation after injury. Micropipette insertion triggers the transformation of the dense, elongate crystalloid into a sieve tube plug. Asterisks, crystalline P-protein bodies; CC, companion cell.
Addition of the chelating agent EDTA completely prevented crystalloid P-protein dispersal,
and repeated exchanges of Ca2+ and EDTA-containing media induced the alternate dispersal
and reassembly, respectively, of crystalloid P-proteins in injured sieve tubes. Furthermore, it
was also observed that the Ca2+ response could be mimicked partly by unphysiological pH
values (Knoblauch et al., 2003). Plugging of sieve plates to maintain turgor pressure within
the sieve tube after injury to a sieve element is the most generally accepted role for these
proteins, although other functions in pathogen and pest defence have been proposed (Read
and Northcote, 1983).
It has been suggested that not only these crystalloid P-proteins but also P-protein originating
from all sources within V. faba sieve elements (e.g., P-plastids, parietal proteins, and larger
crystalloid P-proteins) takes part in the occlusion of sieve plate pores after injury to cells
(Knoblauch and van Bel, 1998). Moreover, proteins in V. faba are much more sensitive to
perturbation than are the P-type plastids. Unlike the reversibility of crystalloid protein
dispersal, explosion and dispersal of the P-type plastids appears to be irreversible. Dispersal
-
Chapter I Introduction ___________________________________________________________________________
5
of parietal proteins after injury has also been observed and was found to be more sensitive to
perturbation than was the explosion of P-type plastids (Knoblauch and van Bel, 1998).
P-protein, as a structural entity, has been observed in sieve elements of all dicotyledons
examined (Evert, 1990) and in the majority of monocotyledons, although conspicuously
absent in families such as the Poaceae (Eleftheriou, 1990). The lack of P-protein also appears
to be a consistent feature of gymnosperms (Schulz, 1990) and seedless vascular plants.
Large crystalloid P-proteins are a particular characteristic of the Fabaceae (legumes). Analysis
sieve elements of Urtica dioica (Urticaceae) and Rubus fruticosus (Rosaceae) in response to
wounding showed that the P-protein bodies present in these species failed to disperse and
occlude sieve pores, even when severely damaged in the presence of free Ca2+. P-type plastids
also appear to have somewhat limited distribution. Proteinaceous P-type plastids were
observed in just 64 of 382 dicot families studied by Behnke (1991a); the majority of families
contained starch-filled S-type plastids.
I.1.3 Forisomes
The conformational regulatory properties of the crystalline P-proteins in Vicia faba sieve
elements are the most remarkable in the field of long-distance transport in plants. Their
reversible change between a dispersed and a condensed condition adjusts the permeability of
the sieve plates and disposed the authors to give to these protein bodies the name Forisome
(lat. foris: gate, greek soma: body; Knoblauch et al., 2003).
In contrast to P-plastids that are long-establish organelles in the SEs of dicotyledons (Bhenke,
1981), Forisomes are not organelles in the strict sense, as they are not separated from the
cytosol by a membrane (Knoblauch and Peters, 2004). In vivo studies using a transient
fluorescence dye on the dispersed conformation adopted by the Forisomes (Knoblauch et al.,
2001) evidenced the presence of a distinctive protein body instead of a complete dissolution
into unordered fibrils observed by electronmicrographs. This implies that Forisomes consist
of fibrils that are organized quite differently in the condensed (longitudinally expanded) and
the dispersed (longitudinally contracted) state, however, held together after the induced
conformational change. In the latter, the fibrils form an irregular, loose network.
In addition, electronmicrographs of condensed Forisomes showed longitudinally arranged
fibrils with a perfectly regular perpendicular cross-striation (wavelength 12 to 15 nm)
(Knoblauch et al., 2001). This striation is always visible in longitudinal sections of expanded
Forisomes, regardless of the plane of section (radial or tangential). Therefore, the protein(s) in
expanded Forisomes must be organized in a series of transversal planes. The regular striation
pattern consistently has been found in earlier studies (Lawton, 1978a; Arsanto, 1982), and the
disordered appearance of Forisomes in the plug-forming state was documented as well.
Lacking any knowledge of the dynamics of Forisomes, these two conditions had been
-
Chapter I Introduction ___________________________________________________________________________
6
interpreted as different stages of sieve element differentiation (Wergin and Newcomb, 1970;
Palevitz and Newcomb, 1971; Arsanto, 1982), or as preparation artefacts of little
physiological significance (Fisher, 1975; Lawton, 1978b). However, in the context of recent
findings (Knoblauch and Peters, 2004), available ultrastructural data rather seem to document
a remarkable example of rigorously regulated, rapid, and reversible molecular self-assembly.
The parallelization of fibrils and the establishment of the perpendicular striation during
Forisome expansion point to a lateral co-alignment of at least two types of structural domains
that alternate on each fibril. These domains might differ in physicochemical parameters such
as hydrophobic or electrical charge patterns, causing them to organize in alternating planes
that are oriented normal to the Forisome axis. If so, fibril co-alignment might actually play a
role in driving Forisome expansion. A paradigmatic example of such a process can be found
in nematode sperm cells, in which pH-controlled lateral interactions between MSP (major
sperm protein) subfilaments initiate the assembly of MSP filaments and filament bundles.
Notably, the reversible lateral coalignment of MSP filaments appears to provide the driving
force for nematode sperm motility (Bottino et al., 2001).
Further in vitro studies in Forisomes isolated from individual cells by micro-dissection
indicated that Ca2+ above a threshold of less than 100 nM induces a reversible doubling of
Forisome diameter and a reduction of Forisome length by almost one third (Knoblauch et al.,
2003). This anisotropic response results in a decrease of aspect ratio from 10 to 3 combined
with a more than threefold volume increase, which is the geometric basis for sieve tube
plugging. Contraction/expansion cycles can be induced in vitro by exchanging the incubation
medium. Therefore, no soluble factors are required for Forisome action, implying also that
reversible depolymerization, an important mechanism of motility in many cell types
(Mogilner and Oster, 2003), does not occur. Both Ca2+-induced contraction and chelator-
mediated expansion can be completed in less than 0.1 sec. Forisomes can be fixed between
pairs of glass fibers to form Forisome-powered micro-forceps. In such setups, they develop
forces of up to 0.1 N in both contraction and expansion (Knoblauch et al., 2003).
Calcium is an important component of many signal transduction pathways, and calcium
regulation has been implicated in phloem function. Knoblauch et al. (2001) showed that an
influx of calcium into legume sieve elements stimulates the rapid and reversible dispersal of
crystalloid P-protein to occlude sieve plate pores. The concentration of free calcium in sieve
tubes of R. communis has been found to be significantly higher than that in surrounding tissue
(Brauer et al., 1998), and calcium-dependent protein kinases have been detected in rice
phloem sap (Nakamura et al., 1993). Volk and Franceschi (2000) showed evidence of a
calcium channel in the sieve element plasma membrane of tobacco and of the aquatic plant
Pistia stratiotes using immunolabeling with antibodies to a calcium channel protein. These
authors proposed that calcium channels become activated during wounding or pathogen
attack, facilitating calcium influx into phloem tissues. McEuen et al. (1981) detected a
-
Chapter I Introduction ___________________________________________________________________________
7
calcium binding protein distinct from calmodulin in phloem exudates of C. maxima and
speculated that it might be associated with P-protein function.
On the other hand, given that in general the presence of ATP is a requirement for the majority
of motor-like biomolecules, it become evident that Forisomes might represent a previously
unknown class of mechano-proteins since their reversible conformational change is not driven
by ATP but energized by changes of the free Ca2+ concentration or pH variations. ATP-driven
motor proteins, the actuator of living cells, possess promising characteristics in micro- and
nanodevices, however, their dependence on a strictly defined chemical environment can be
disadvantageous. ATP-independency, together with a periodic reversible motion, are difficult
properties to ascertain. These two remarkable features are found in Forisomes, making them
one of the most promising proteins in the field of biomimetic engineering.
The wide range of applications for biomimetic smart materials underscored the need for the
molecular and biological investigation of the Forisome described in the available work.
I.1.4 Ca2+-binding motifs and secondary protein structures
I.1.4.1 EF-hand
The EF-hand is the most frequent motif found in Ca2+-binding proteins (Nakayama and
Kretsinger, 1994; Muranyi and Finn, 2001). The EF-hand family is a large class of Ca2+-
binding proteins that contain homologous Ca2+-binding sites within a characteristic helix-
loop-helix motif (da Silva and Reinach, 1991; Kawasaki and Kretsinger, 1994; Falke et al.,
1994; Chazin, 1995). EF-hands are generally found back-to-back in anti-parallel pairs with -sheet-like hydrogen bonding occurring between the loops of the coupled sites. These coupled
sites are often found to have cooperative metal ion binding, as in the case of calmodulin.
Within this characteristic helix-loop-helix motif, the Ca2+ is enclosed in the loop between two
-helices, in a pentagonal, bipiramidal configuration.
Proteins containing the EF-hand Ca2+-binding motif, such as calmodulin and calcineurin B,
function as regulators of various cellular processes that are sensitive to Ca2+ (Nakayama and
Kretsinger, 1994; Kawasaki and Kretsinger, 1995; Ikura, 1996; Polans et al., 1996; Schafer
and Heizmann, 1996). Many essential cellular processes, such as cell cycle control, nucleotide
metabolism and signal transduction, are tightly regulated by calcium. In certain Ca2+-binding
proteins, regulatory domains undergo large conformational changes upon ion binding, and
this response modulates their overall intramolecular conformation and their interaction with
other proteins, including aggregation and dissociation (Rashidi, H.H. et al., 1999; Nakashima,
K. et al., 1999; Pal, G.P. et al., 2001).
Despite the dominance of the EF-hand motifs, other known Ca2+-binding motifs (Muranyi, A.
and Finn, B.E., 2001; Swairjo, M.A. and Seation, B.A., 1994; Nalefski, E.A. and Falke, J.J.,
1996; Rizo, J. and Sdhof, T.C., 1998; Weis, W.I., 1996) are found in Ca2+-binding proteins.
-
Chapter I Introduction ___________________________________________________________________________
8
I.1.4.2 Coiled-coil domains
The rodlike -helical coiled-coil is one of the simplest yet most common structural motifs occurring in proteins. Consisting of two to five -helices twisted into a left-handed supercoil, the occurrence of this structure is well documented, occurring in a wide variety of proteins
including motor proteins, DNA binding proteins, extracellular proteins, and viral fusion
proteins (Lupas, 1996; Kohn et al., 1997; Burkhard et al., 2001). The presence of a
continuous interface of hydrophobic amino acids along the length of the helices provides a
major source of stability to the fold as the hydrophobics pack in a knobs-into-holes fashion
shielded from the bulk solvent (Crick, 1953). The pattern of repeating hydrophobic residues at
positions a and d of the heptad repeat (denoted abcdefg) that are responsible for coiled-coil
formation was first identified by Hodges et al. (1972) from the amino acid sequence of
tropomyosin. Later, a dimerization domain of a family of transcription factors, the leucine
zipper (Landschulz et al., 1988), was also described comprising this structural motif.
Figure I-3 Structures of parallel coiled coils (Mller, K.M. et al., 2000). (A) Helical wheel diagram of a parallel, dimeric coiled coil illustrating the disposition of the characteristic heptad repeat. (B-C) X-ray crystal structures of dimeric and trimeric GCN4 leucine zipper variants. The backbone and interface residues are shown superimposed on the ribbon representation of the helices.
-
Chapter I Introduction ___________________________________________________________________________
9
The coiled-coil domain is responsible for oligomerization of protein subunits and concomitant
folding of the proteins. The versatility of coiled coils for oligomerization derives from their
diversity of oligomeric structures. Coiled coils are gently twisted, ropelike bundles containing
two to five -helices in parallel or antiparallel orientation. The N and C termini of the helices are easily accessible, facilitating linkage to other proteins. Parallel dimers and trimers are by
far the most commonly observed coiled coils (Figure I-3).
I.2 Promoter sequences and regulation of transcription
The regulation of gene expression at the level of transcription is a key control point affecting
gene expression in response to a variety of extra- and intracellular signals, during
developmental processes and for tissue specificity. In eukaryotes, there are tens of thousands
of protein-coding genes, each of which has its unique program of transcription. The cis-acting
DNA sequences that encode these transcriptional programs include transcriptional enhancers,
proximal promoters, and core promoters also called minimal promoters. A typical eukaryotic
promoter consists of a minimal promoter and upstream cis-elements. The minimal promoter is
essentially a TATA box, an A/T-rich region located about 30 nucleotides (nt) upstream of the
transcription start site where RNA polymerase II, TATA-binding protein (TBP), and TBP-
associated factors (TAFs) bind to initiate transcription. However, minimal promoters alone
have no transcriptional activity. The cis-elements, to which tissue-specific or development-
specific transcription factors bind, individually or in combination, determine the spatio-
temporal expression pattern of a promoter at the transcriptional level. Enhancers and proximal
promoters are recognized by sequence-specific DNA-binding proteins that regulate
transcription (Blackwood and Kadonaga, 1998; Lee and Young, 2000; Lemon and Tjian,
2000; Malik and Roeder, 2000). Enhancers are often located many kilobase pairs (kbp)
upstream or downstream of the transcription start site, whereas proximal promoters are
typically within a couple hundred base pairs (bp) of the start site. Core promoters encompass
the transcription start site and specify the site of transcription initiation by the basal
transcriptional machinery (Orphanides et al., 1996; Smale, 1997; White, 2001). The core
promoter is at a unique and important position in the transcription process, as it is the eventual
target of the action of the many sequence-specific factors and co-regulators that control the
transcriptional activity of each gene.
I.2.1 Phloem-specific promoters
Regulation of transcription is achieved by the activity of multiple proteins that bind to
regulatory elements, many of which are upstream of the promoters and alter basal rates of
transcription initiation and/or elongation (Roeder, R.G., 1991; Yankulov, K. et al., 1994). To
understand the mechanisms of tissue-specific and constitutive gene expression in plants, a
-
Chapter I Introduction ___________________________________________________________________________
10
number of promoters and transcription factors have been studied in recent years (Benfey, P.
N. and Chua, N.-H., 1989; Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994;
Suzuki, M, 1995; Faktor, O. et al., 1996; Yin, Y. et al., 1997b; Ringli, C. and Keller, B.,
1998; Niggeweg, R. et al., 2000). It was shown that constitutive promoters, such as the
Cauliflower mosaic virus 35S promoter (CaMV 35S; Odell et al., 1985), a double-stranded
DNA virus belonging to the Caulimoviridae family, and the promoter from Cassava vein
mosaic virus (CsVMV; Verdaguer, B. et al., 1998), a plant pararetrovirus from the
Caulimoviridae family, are modular in organization and multiple cis-elements. These
elements, with specific transcription factors, apparently interact in an additive and/or
synergistic manner to confer gene expression in all plant tissues. Similarly, tissue-specific
promoters contain multiple elements that contribute to promoter activity in both positive and
negative ways (Leyva, A. et al., 1992; Fujiwara, T. and Beachy, R. N., 1994; Suzuki, M. et
al., 1995; Ellerstrom, M. et al., 1996; Ringli, C. and Keller, B., 1998; Hauffe, K. D. et al.,
1993). Among tissue-specific promoters, several promoters from plants (Yang and Russell,
1990; Brears et al., 1991; DeWitt et al., 1991; Ohta et al., 1991; Martin et al., 1993; Hrouart
et al., 1994; Shi et al., 1994; Truernit and Sauer, 1995; Tornero et al., 1996), Agrobacterium
(Schmlling et al., 1989; Sugaya et al., 1989; Guevara-Garca et al., 1993) and viruses
(Medberry et al., 1992; Bhattacharyya-Pakrasi et al., 1993; Rohde et al., 1995) have been
reported to drive expression of reporter genes in the phloem of transgenic plants, thus
designated as phloem-specific promoters. These tissue-specific promoters include the
glutamine synthetase 3A (GS3A) gene promoter (Brears et al., 1991), the Arabidopsis H+-
ATPase isoform 3 (AHA3) gene promoter (DeWitt et al., 1991), the Agrobacterium rolC
promoter (Schmlling et al., 1989), the Arabidopsis sucrose synthase gene (Asusl) promoter
(Martin et al., 1993), the maize sucrose synthase-1 (Shl) gene promoter (Werr et al., 1985;
Yang and Russell, 1990) and the rice tungro bacilliform virus (RTBV) promoter
(Bhattacharyya-Pakrasi et aL, 1993; Yin and Beachy, 1995).
Brears et al. (1991) found that when the GS3A promoter is deleted to nucleotide -132 relative
to the transcriptional start site, it can still direct tissue-specific expression, and a 17 bp
imperfect palindrome was identified as a putative cis-element by virtue of the binding of a
nuclear protein complex (Brears et al., 1991). Later on, Hehn and Rohde (1998) identified a
phloem specific motif of 13 bp in length which has been described to be highly conserved
among four phloem-specific promoters, originating from a pea glutamine synthase gene
(GS3A), coconut foliar decay virus (CFDV), rice tungro bacilliform virus (RTBV), and an
Agrobacterium rhizogenes rolC gene as well as the a Robinia pseudoacacia inner-bark lectin
gene (Rplec2; Yoshida et al., 2002).
Furthermore, the rice tungro bacilliformbadnavirus (RTBV) promoter (Qu, R.D. et al., 1991;
Hay, J. M. et al., 1991) and the transcription factors that interact with it served as a model
system to study plant tissue-specific gene expression. The virus, which replicates solely in
phloem tissues, has a single promoter that is active in transfected protoplasts and is phloem-
-
Chapter I Introduction ___________________________________________________________________________
11
specific in transgenic rice plants (Yin, Y. and Beachy, R. N., 1995; Yin, Y. et al., 1997a;
Chen, G. et al., 1994; Klti, A. et al., 1999). Within the promoter sequence, multiple cis-
elements, including motifs associated with tissue-specific expression like GATA box (Lam E
et al., 1989), were identified as being required for phloem-specific gene expression (Yin, Y.
and Beachy, R. N., 1995; Yin, Y. et al., 1997b; He, X. et al., 2000; Meisel, L. and Lam, E.,
1997). The GATA A(N)3GATA motif is known to be important for phloem-specific gene
expression not only from the rice tungro bacilliform virus RTBV promoter (Yin et al., 1997a)
but also the same motif was found in the promoters of GS3A (Brears et al., 1991), the
Arabidopsis plasma membrane H+-ATPase gene (AHA3; DeWitt et al., 1991), a potato
invertase gene (Hedley et al., 2000) and the Rplec2 (Yoshida et al., 2002).
The 13bp and GATA motifs are conserved between virus and plant promoters, implying an
important role for these motifs for gene expression in the phloem.
Here, the cloning of a promoter sequence for the vff1 gene encoding Forisomes in Vicia faba
is described, and its expression pattern using promoter-reporter fusion in transgenic plants
further analysed.
-
Chapter I Introduction ___________________________________________________________________________
12
I.3 Aim of the thesis
The striking feature of Forisomes is the reversible and fast conformational change together
with their ATP-independency which make these structures interesting in the field of
nanotechnology biomaterials. Knoblauch et al. (2001) have reported that these conformational
changes are energized by modifications of the free Ca2+ concentration or pH variations.
Several other non-ATP based motors have been proposed, such as DNA-based nanoactuators
(Yurke, B. et al., 2000), flagella motors (Berg, H. C., 1974) and viral protein linear motors
(Dubey, A. et al., 2003). However, whereas all these have dimensions of the order of several
tens of nanometres, Forisomes are macroscopic assemblies whose size is in the order of
micrometers. Hence, although they could not be used to develop devices at the nanoscale,
they are easy to manipulate using current state-of-technology tools and their technological
readiness is therefore higher than that of other non-ATP-based motors.
Taken together, these unique characteristics of Forisomes built up the framework of this
thesis. Hence, the objective of the present study was to clone the gene/s encoding Forisomes
in Vicia faba and to identify specific calcium-binding motives. Subsequent recombinant
expression of the isolated gene/s with their concomitant molecular and biochemical
characterization were employed to confirm gene-struture-funtion relationships. Finally, the
promoter sequences regulating the expression of Forisome proteins were identified and
studied in greater detail.
A schematic overview of this thesis is presented in Figure I-4.
-
Chapter I Introduction ___________________________________________________________________________
13
Generation and characterization of Forisome-specific
polyclonal Abs
Isolation of Vicia faba Forisomes
Peptides sequencing
Amplification of vff1 full-length cDNA and genomic sequence
Cloning of vff1 full-length cDNA in
bacterial expression vectors
Expression and purification of VFF1-
GST proteins
Generation and characterization of VFF1-GST-specific
polyclonal Abs
Immunological evidence of vff1 gene encoding a Forisome
protein
Amplification of vff1 promoter sequence
Cloning of vff1 promoter into plant expression vectors
Generation of transgenic
plants expressing GUS under control of
vff1 promoter
Differential expression pattern driven by vff1
promoter
Figure I-4 Schematic outline of the thesis
-
Chapter II Material and Methods ___________________________________________________________________________
14
II Material and Methods
II.1 Material
II.1.1 Chemicals and consumables
The chemicals used throughout the work were purchased from the following companies:
Amersham Bioscience (Freiburg, D), Axis-Shield PoC (Oslo, Norway), Boehringer
Mannheim (Mannheim, D), Duchefa (Haarlem, NL), Fluka (Neu-Ulm, D), Gibco BRL
(Eggenstein, D), Invitrogen (Karlsruhe, D), Merck (Darmstadt, D), Molecular Probes (Leiden,
NL), New England Biolabs (Frankfurt, D), Roche (Mannheim, D), Roth (Karlsruhe, D), Serva
(Heidelberg, D), and Sigma-Aldrich (Taufkirchen, D).
The consumables were from: Amicon (Witten), BioRad (Mnchen, D), Biozym (Hess.
Oldendorf, D), Eppendorf (Hamburg, D), Genetix (New Milton, UK), Greiner (Solingen, D),
Kodak (Stuttgart), MilliPore (Schwalbach, D), Qiagen (Hilden, D), Schleicher&Schuell
(Dassel, D), Whatman (Bender & Hobein, Bruchsal, D) and Zeiss (Oberkochem).
II.1.2 Enzymes and reaction kits
Restriction enzymes either from New England Biolabs (Schwalbach) or GibcoBRL were used
for DNA digestion. ExpandTM high fidelity DNA Taq polymerase from Roche or Advantage
2 Polymerase Mix from BD Biosciences Clontech were used for PCR amplification. TaqDNA
polymerase produced at the Fraunhofer IME (Aachen, D) was used for check-PCR
amplification.
The following kits were used:
Oligotex mRNA isolation kit from Qiagen,
QIAprep Spin Mini/Midiprep kit from Qiagen,
QIAquick gel extraction kit from Qiagen,
QIAquick PCR purification kit from Qiagen,
MinEluteTM PCR purification kit from Qiagen,
RNeasy mini kit from Qiagen,
SMART TM PCR cDNA Synthesis kit from BD Biosciences Clontech,
SMARTTM RACE cDNA Amplification Kit from BD Biosciences Clontech,
SUPERSCRIPTTM First-Strand Synthesis System for RT-PCR from Invitrogen,
Universal GenomeWalkerTM kit from BD Biosciences Clontech,
ECL Advance Western blotting detection kit from Amersham Biosciences,
Nucleon Phytopure Plant DNA extraction kit from Amersham Biosciences,
PCR-Select TM cDNA Subtraction kit from BD Biosciences Clontech.
-
Chapter II Material and Methods ___________________________________________________________________________
15
II.1.3 Buffers, media and solutions
All standard solutions, buffers, and media were prepared according to Sambrook et al. (1989),
Ausubel et al. (1995) and Coligan et al. (1995). Compositions of otherwise special media and
solutions or buffers are listed at the end of the respective method section. Media for bacterial
and plant tissue cultures were sterilized by autoclaving (121oC/1-2 bar). Thermolabile
components were filter sterilised by passing through a 0.2 m filter (Millipore) and added to
the autoclaved media or buffer after they were cooled down to 60-50C.
II.1.4 Matrices and membranes
Glutathione sepharose 4B from AmershamPharmacia Biotech was used for purification of
GST fusion proteins (II.2.11).
HybondTM-C nitrocellulose membrane (0.45m) from Amersham Life Science and Whatman no.1 paper from Whatman (Maidstone, England) were used in immunoblot analysis
(II.2.12.4).
II.1.5 Primary antibodies, secondary antibodies and substrates
Mouse anti-GST monoclonal antibody provided by Dr. Michael Monecke (RWTH Aachen,
Institut fr Biologie VII, Germany) was used for analyses of GST and GST fusion protein
expression. Alkaline phosphatase (AP) or horseradish peroxidase (HRP)-conjugated to goat
anti-mouse IgG (H+L, Fc), rabbit anti-chicken (Fc) and goat anti-rabbit (Fc) (Dianova)
antibodies were used as secondary antibody in immunoblot analysis (II.2.12.4) and ELISA
(II.2.14). NBT/BCIP (BioRad) and pNPP (BioRad) or ABTS-H2O2 [0.5 mg of 2,2-azinobis
(3-ethylbenzthiazolinesulfonicacid) (ABTS)/ml, 0.002% H2O2, 0.1 M citrate-phosphate
buffer (pH 4.3)] were used as substrate for detection of immobilized proteins in immunoblot
(II.2.12.4) and ELISA (II.2.14), respectively.
Goat anti-mouse Alexa Fluor 488 (Molecular Probes) was used as secondary antibody in
immunofluorescence studies.
II.1.6 Biological material
II.1.6.1 Bacterial strains
E. coli strains DH5 and XL1-Blue were used as a host cells for all intermediate cloning
constructs. The strain BL21(DE3) was used for expression of VFF1-GST-fusion proteins
(II.2.11).
-
Chapter II Material and Methods ___________________________________________________________________________
16
Agrobacterium tumefaciens GV 3101::pMP90RK (gentr, kanr), rifr (Koncz and Schell, 1986)
was used for Agrobacterium-mediated gene transfer into tobacco leaves (II.2.9) (Table II-1).
Table II-1 Name, suppliers and genotypes of bacterial strains used throughout this thesis
Strain Source Genotype
DH5 Ausubel et al., 1995 F- (f80d Lac 2M15) (LacZYA-argF) U169end A1 rec1 hsdR17(rk
- mk+) deoR thi-1
supE44 gyrA96 relA1 -
BL21(DE3) Novagen F- ompT hsdSB (rB mB -) gal dcm (DE3)
XL1-Blue Stratagene recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F proAB laclIq ZM15 Tn10 (Tetr)]
Agrobacterium Koncz and Schell, pMP90RK GmR, KmR, Rif R
tumefaciens 1986
GV 3101
II.1.6.2 Plants
Nicotiana tabacum L. cv. Petite Havana SR1 was used for transient protein expression after
vacuum infiltration of recombinant Agrobacteria (II.2.10.3) and for generation of stable
transformed plants (II.2.10.4).
II.1.6.3 Animals
6-8 weeks old female BALB/c mice as well as White Leghorn chicken about 12 weeks old
were used for immunization (II.2.13.1 and II.2.13.2) with isolated Forisomes from Vicia faba.
II.1.7 Vectors
II.1.7.1 Bacterial expression vector
pGEX-5X-3 from Amersham Pharmacia Biotech, modified at the multiple cloning site by
insertion of a NcoI site was used for subcloning the vff1 gene, together with partial fragments
(amino/carboxy terminus, center domains), and amplification of the resulting plasmids in E.
coli DH5. After confirmation of the DNA sequences, pGEX-VFF1 along with the plasmids harbouring the different protein domains were introduced into E. coli BL21 and expression of
the GST-fusion proteins was carried out.
-
Chapter II Material and Methods ___________________________________________________________________________
17
II.1.7.2 Plant expression vectors
pUC103 - GUS (K. Fritze, MPIZ, Kln, Deutschland) containing the GUS-term construct
(III.2.4.1) was used for subcloning of the GUS-term reporter gene.
pTRA (Thomas Rademacher, Institut fr Biologie VII, RWTH Aachen, Germany) is a
optimized plant expression vector containing the Cauliflower mosaic virus (CaMV) 35S
promoter with duplicated enhancer region (35SS) or the phloem-specific promoter of the
Coconut foliar decay virus (CFDV) and the pA35S untranslated region from Cauliflower
mosaic virus (CaMV). A matrix attachment region was introduced to improve transcription.
This binary vector was used for subcloning the vff1 promoter (III 2.4.1) as well as series of
thirteen truncated vff1 promoter fragments (III 2.4.3) in replacement of the 35SS promoter.
Schematic presentation of the vector maps are presented in the Appendix VII.2.
II.1.8 Oligonucleotides
Oligonucleotides used for sequence analysis and amplification of DNA are listed below
(Tables II-2, II-3, II-4) . All oligonucleotides were synthesized by Metabion International AG
(Martinsried, Germany).
Table II-2 Primers used for PCR amplification in deletion analysis of vff1 Promoter in Vicia faba
forward f-P-pTRAk-1 5 -TTG GCG CGC CTT GAC TTG TAG ATA TGT TG- 3
f-P-pTRAk-2 5 -TGG GCG CGC CTC TAT AAA CGT TAA TGT TTG- 3
f-P-pTRAk-3 5 -TTG GCG CGC CTG AAA CAA CTC AAA CTT ATA- 3
f-P-pTRAk-4 5 -TTG GCG CGC CCA GTG GTG ACT CTT GCT ATC- 3
f-P-pTRAk-5 5 -TTG GCG CGC CCG GAT GAA AAT GGT ACT AAC- 3
f-P-pTRAk-6 5 -TTG GCG CGC CCT ACA TTC TCA ACG ATG CGA G- 3
f-P-pTRAk-7 5 -TTG GCG CGC CTT GTA TAC ATT CTC AAC GAT G- 3
f-P-pTRAk-8 5 -TTG GCG CGC CCA AAC ATT TTG TAT ACA TTC- 3
f-P-pTRAk-9 5 -TTG GCG CGC CAT ATA GTA CTA TCT AAA GG- 3
f-P-pTRAk-10 5 -TTG GCG CGC CTC CTC GAT GAC CCT TCA ATG- 3
f-P-pTRAk-11 5 -TTG GCG CGC CAT AAA ACA CTT TGC ACA CTT G- 3
f-P-pTRAk-12 5 -TTG GCG CGC CGT AAT AAC ATA TGA TAT TTA AA- 3
f-P-pTRAk-13 5 -TTG GCG CGC CAT TTC TCC TTC ATT TTT ATA TTT- 3
reverse r-P- pTRAk 5 -CAT GCC ATG GTG ACT CAA ATT TCA GAG AA- 3
-
Chapter II Material and Methods ___________________________________________________________________________
18
Table II-3 Primers used for cDNA amplification in RACE-PCR
5-RACE-GSP1 5 -CTC ACC TCC ATC ACA CGT CCA CAA GTA GGA TTT GG- 3
5-RACE-GSP2 5 -ACT CTT CAA TGC TCT GAA CCG TTC CTT GCG GAT ATC GTC- 3
5-RACE-GSP3 5 -CAC AAT GGG GAT CCA CAA AAT CTT GAA GTC TTC TTT CTT- 3
5-RACE-GSP4 5 -TGG GCT TAT CGA AGA TCT TCC TGC GGT TAA ATA AAT CGT- 3
5-RACE-GSP5 5 -GGA ATT TCC AAT TGG GTC TGT TGC TGT GAC CCT ATT AAG T- 3
3-RACE-GSP1 5 -GGT GTA GAA AGG AAG AAA CAA AAC AAG AAG CAT CAA G- 3
Table II-4 Primers used for PCR amplification and subclone Vicia faba forisome cDNA, N-terminal, C-terminal and central domains
Namec Sequencea Product size (kb) b
vff1 fw: 5- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3 2.1
bw: 5- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3
N- vff1 fw: 5- CAT GCC ATG GGA ATG TCC TTT TCT AAC TCA -3 1.2
bw: 5- TAA AGC GGC CGC GTT CCT TGC GGA TAT CGT -3
M- vff1 fw: 5- CAT GCC ATG GGT TCC TTG AGA CAA CTG AAT -3 1.1
bw: 5- TAA AGC GGC CGC ACG TTT CAG AGT CTC GTG -3
C- vff1 fw: 5- CAT GCC ATG GGA TTC AGA GCA TTG AAG AGT -3 0.9
bw: 5- TAA AGC GGC CGC AAC ACC AAA GTT ATT TGG -3
a letters in bold represent restriction endonuclease sites (NcoI and NotI) introduced into each primer to allow efficient cloning of the PCR product into the appropriate vector. b The product size is that resulting from PCR using the matching set of sense and antisense primers with the corresponding template. c Designation of the oligonucleotide as fw indicates the sense primer, whereas bw indicates the antisense primer. vff1, N-vff1, C- vff1 and M-vff1 stand for full-lengh forisome cDNA, NH3-terminal, COOH-terminal and central-domains respectively.
II.1.9 Equipment and applications
BioBench stainless steel reactor (Applikon Dependable Instruments, Schiedam, The
Netherlands).
Biomek 2000 with 384 High Density Replica Tool (HDRT) (Beckmann Coulter, Fullerton,
US).
Cameras and scanner: MP4 (Polaroid, Cambridge, MA, USA). E.A.S.Y 429K camera
(Herolab, Wiesloch), Arcus II Scanner with AGFA FotoLook 3.5 Software (AGFA, Kln),
Fujifilm LAS-1000 (Fujifilm, Tokyo, Japan).
-
Chapter II Material and Methods ___________________________________________________________________________
19
Centrifuges: AvantiTM 30, AvantiTM 20 and AvantiTMJ-25 (Beckman, California, USA),
Biofuge A (Heraeus, Hanau), Sigma 3-10 and Sigma 4-10 (Sigma, St. Louis, Missouri, USA),
RC5C and RC5B plus (Sorval instruments, Du Pont, Bad Homburg). Rotors: F0650, F2402H,
JLA 8.1000, JLA 10.500 and JA 25.50 (Beckman), #1140 and #11222 (Sigma), RLA-300,
SS-34 and GS-3 (Du Pont).
Confocal Fluorescence Microscope: Leica TCS SP (Leica, Wetzlar, Germany).
DNA gel electrophoresis apparatus: wide mini and mini cells for DNA agarose
electrophoresis and power supplies (BioRad).
DNA sequencer: ABI Prism 3730 DNA Analyzer and BigDyeTM cycle sequencing
terminator chemistry apparatus (Applied Biosystems, Foster, CA, USA).
Electroporation apparatus: Gene pulserTM, Pulse controller unit, Extender unit
(BioRad) and 0.2 cm cuvettes (BioRad).
Fluorescent Image Analyzer: Phosphorimager FLA-3000 (Fujifilm, Tokyo, Japan).
InnovaTM 4340 incubator shaker (New Brunswick Scientific, Nrtingen).
Light Microscope: Leica DMLFS (Leica, Wetzlar, Germany) with a JVC camera TK-C1360
(Tokio, Japan).
PCR Thermocyclers: Primus and Primus 96 plus (MWG-Biotech).
Photometer: Eppendorf biophotometer with Printer DPU 414 (Eppendorf, Hamburg), and
multi-channel spectrophotometer Spectromax 340 (Molecular Devices, Sunnyvale,
California).
Probe sonicator: Bandelin Sonoplus sonicator UW2070 with Titan Microtip MS72
(Bandelin Electronic, Berlin).
Protein gel electrophoresis and electroblotting equipment: Mini-PROTEAN IIITM
electrophoresis system (Bio-Rad), Mini Trans-Blot Cell (Bio-Rad), Gel Air, Dryer (Bio-Rad).
QPix picking/gridding robot (Genetix, New Milton, UK)
Software: Windows NT 4.0 operating system (Microsoft); Microsoft Office 2000
(Microsoft); Adobe Photoshop 6.0 (Adobe); Chromas; Origin 6.0 (Data analysis and technical
graphics, Microcal Software, Inc.); Align IR, version 1.2 (LI-COR); GCG (Wisconsin
Package v10.2 TM, Genetic Computer Group Madison, Wisc.).
Speed-Vac centrifuge: Eppendorf Concentrator 5301 (Eppendorf)
UV-Transilluminators: wavelength 302 nm and UVT-20M (Herolab). UV-chamber (Bio-
Rad).
Vibrating-blade Microtome: Leica VT 1000S (Leica Microsystems Wetzlar GmbH,
Germany).
-
Chapter II Material and Methods ___________________________________________________________________________
20
II.2 Methods
All experiments related to the genetic engineering were performed according to the
regulations of S1-Richtlinien and were officially approved by the Regierungsprsidium des
Landes NRW (RP-Nr.: 23.203.2 AC 12, 21/95) and BGA [AZ 521-K-1-8/98:AI3-
04/1/0866/88 (S1) and 55.8867/-4/93 (greenhouse)].
General recombinant DNA techniques, i.e. PCI (phenol/chloroform/isoamyl alcohol) and CI
(chloroform/isoamyl alcohol) extraction, DNA precipitation, restriction enzyme digestion,
DNA ligation, DNA agarose gel electrophoresis, were performed according to the standard
protocols described in Sambrook et al. (1989) and Ausubel et al. (1995).
II.2.1 Plant material and isolation of Forisomes
Vicia faba L. cultivar Witkiem major (Nunhem Zaden, Haelen, The Netherlands) were grown
in a greenhouse at 20 C and a 14/10 h light/dark period (daylight plus additional lamp light).
The first three internodes of up to 60 plants were excised 6 weeks after germination. The rind
was pulled off the central wood cylinder in two strips; the phloem tissue was then scratched
off these strips with scalpels and transferred to Ca2+-free medium (50 mM KCl, 10 mM, 10
mM of either HEPES or Tris/HCl, pH 7.3). The collected tissue was frozen in liquid nitrogen,
homogenized in a mortar, thawed in Ca2+-free medium, and passed through a 60-m-mesh
filter. The filtrate was centrifuged at 2,500g and 20 C for 30 min. The pellet was resuspended
in 11.25 ml Ca2+-free medium and 3.75 ml of an 80% Nycodenz (Axis-Shield PoC, Oslo,
Norway) solution were added. Using another 15 ml of the Nycodenz solution, a density
gradient (20 to 80% Nycodenz) was produced with a custom-built gradient mixer. The
gradient was centrifuged at 150,000g and 20 C for 3 h in an ultracentrifuge (OTD75B
Sorvall, Wilmington, Delaware, USA). Forisomes accumulated in a layer corresponding to
roughly 1.2 gml1. This layer was extracted and washed by adding a threefold volume of Ca2+-
free medium. The sample was centrifuged at 2,500g and 20 C for 30 min, and the pellet
containing the Forisomes was resuspended in a small volume of medium. With the aim of
avoiding the presence of membrane-bound proteins, which normally contaminate the isolation
of Forisomes, the sample was washed two times by adding a threefold volume of 1 mM Na2-
EDTA, 0,1% (v/v) Triton X-100 medium. The sample was centrifuged at 2,500g and 20 C
for 10 min after each washing step and the pellet was resuspended in 500 l of 1xPBS.
II.2.2 Peptides sequencing
A sample of the isolated Forisomes was separated by SDS-PAGE (sodium dodecyl sulfate-
polyacrylamide gel electrophoresis; II.2.12.2). Coomassie blue staining demonstrated two
-
Chapter II Material and Methods ___________________________________________________________________________
21
predominant bands migrating at ~ 70kDa. These bands were excised from the gel, digested
with trypsin and analyzed by peptide mass fingerprinting following nanoLC-ESI-MS/MS and
MALDI-TOF-MS. Peptide sequencing was done by different companies (Proteome Factory
AG, Berlin; TopLab, Munich; Fraunhofer IME, Aachen) and the sequences obtained were
subject to comparison against a Medicago truncatula public EST data base (http://medicago.
toulouse.inra.fr/Mt/EST).
II.2.3 Isolation of genomic plant DNA
Genomic DNA was isolated from young Vicia faba leaves using the Nucleon Phytopure Plant
DNA extraction Kit (Amersham).
II.2.4 RNA isolation
Total RNA was isolated from a powdered pool of young leaves and stems using hot borate
method with modifications, as described by Moser et al. (2004). 1g of the plant tissue was
extracted in 3.5 ml of pre-warmed (80C) RNA extraction buffer. The homogenate was mixed
thoroughly, incubated at 80C for 5 min and then distributed in 2 ml microcentrifuge tubes
(1.4 ml of sample per tube). To inactivate contaminating ribonucleases, 1 mg of proteinase K
(2.2 mg of proteinase K for 1 g of tissue) was added following incubation at 42C for 1 h.
After adding 2 M KCl to final concentration of 160 mM, the samples were kept on ice for 45
min. The samples were centrifuged at 13,000 rpm at 8C for 15 min to enable pelleting of
insoluble particulates. The supernatant was then transferred to a new 2 ml microcentrifuged
tube, where 8 M LiCl to a final concentration of 2 M was added to allow RNA precipitation.
The samples were incubated on ice at 4C overnight. The precipitated RNA was obtained by
centrifugation at 13,000 rpm at 8C for 25 min. After discarding the supernatant, the RNA
pellet was washed with 1 ml of ice cold 2 M LiCl and then centrifuged at 13,000 rpm and 8C
for 15 min. The RNA pellet was then resuspended with 600 l of 10 mM Tris-HCl (pH 7.5)
and mixed thoroughly at room temperature. For removal of polysaccharides, 1/10 vol. of 2 M
potassium acetate (pH 5.5) was added to each sample following incubation for 10 min on ice.
The samples were centrifuged at 13,000 rpm and 8C for 15 min. The supernatant was
transferred into new 1.5-ml microcentrifuge tubes, mixed with 0.9 vol of cold (4C)
isopropanol and then stored at -20C for 1 h to allow RNA precipitation. As a final step, the
RNA precipitate was centrifuged at 13,000 rpm and 8C for 25 min. After washing the
obtained RNA pellet with 1 ml of cold (4C) 80% (v/v) ethanol and centrifugation at 13,000
rpm and 8C for 10 min, the samples were dried out in ice under sterile flow cabinet. The
RNA was resuspended in 30-50 l of RNase-free water, pooled together in a new 1.5-ml
microcentrifuge tube and stored at -80C. The mRNA was isolated using the Oligotex mRNA
isolation kit (Qiagen USA, Valencia, CA).
-
Chapter II Material and Methods ___________________________________________________________________________
22
RNA extraction buffer: 0.2 M sodium tetraborate decahydrate, 0.03 M EDTA (pH 8.0), 1%
(w/v) SDS, 1% (w/v) deoxycholate acid sodium salt, 2% (v/v) -mercaptoethanol, 0.5% (w/v) spermidine, 2% (w/v) PVP (mol wt
40000), 1% (w/v) IGEPAL.
II.2.5 Libraries construction and screening strategies
II.2.5.1 cDNA expression library
A custom cDNA Expression Library of Vicia faba plant tips constructed in TriplEX2TM phagemid was purchased from Clontech (Cat. # CS1009u, BD Biosciences Clontech, Palo
Alto, USA). Total RNA was isolated from plant tips using the acid-guanidinium-phenol-
chloroform method (Sambrook et al., 1989) and 5g of poly(A)+ RNA was purified using Oligotex mRNA isolation kit (Qiagen USA, Valencia, CA). A library of 3.6x106 independent
clones was obtained with an average insert size of 1.5 kb and an insert size range between 0.5-
3.8 kb.
Library screening
The amplified cDNA expression library was subjected to immuno and PCR screenings as
described in the protocol suggested by the manufacturer (BD Biosciences Clontech, Palo
Alto, CA).
Polyclonal antiserum from chicken and mice was raised against isolated Forisomes (II.2.1).
Absorption of non-specific antibodies that react with E. coli proteins was carried out using a
lysate of E. coli XL-1Blue as described in the protocols provided with the picoBlue
immunoscreening kit (Stratagene). These pre-absorbed sera (dil. 1:30000) were used for
immunoscreening of the cDNA Expression Library using species-specific, horseradish
peroxidase-conjugated goat anti-mouse IgG (H+L, Fc) or rabbit anti-chicken (Fc) (Dianova)
antibodies as secondary antibody.
PCR screening of the amplified cDNA expression library was carried out using a mixture of
primers designed according to the Forisome sequenced peptides (II.2.2).
II.2.5.2 cDNA libraries
Construction of subtracted cDNA library
PCR-select cDNA subtraction was employed using PCR-SelectTM cDNA Subtraction Kit (BD
Biosciences Clontech, Palo Alto, CA) according to the manufacturer's protocol. The tester
(samples prepared from Vicia faba plant leaves) and driver (samples from the Vicia faba root
tips) cDNA were reverse transcribed from 2 g mRNA of leaves and root tips, respectively,
-
Chapter II Material and Methods ___________________________________________________________________________
23
digested with RsaI and then ligated to different adaptors. Two rounds of hybridization and
PCR amplification were performed to enrich the differentially expressed sequences.
Construction of not subtracted cDNA library
Total RNA was isolated from Vicia faba young root tips by the acid-guanidinium-phenol-
chloroform method (Sambrook et al., 1989) and used for cDNA library construction
following the SMART TM PCR cDNA Synthesis Kit protocol (BD Biosciences Clontech, Palo
Alto, CA).
The subtracted and non subtracted cDNAs were inserted directly into the TOPO TA Cloning
strategy (InvitrogenTM) followed by TOP10F transformation (InvitrogenTM), producing the
resultant cDNA libraries.
Both unamplified libraries were plated onto LB agar 230 mm x 230 mm Vented QTray with
cover plates (Cat. # X6023, Genetix, New Milton, UK) containing LB agar, 50 g/ml
kanamycin, spreaded with 40 l of 100 mM IPTG in addition to 40 l of 40 mg/ml X-gal on
each LB plate) and grown at 37oC overnight. Using a QPix (Genetix, New Milton, UK)
picking/gridding robot a blue/white screening was carried out and the white colonies were
arrayed into 384-well microtiter plates (384 Well Low Profile Microplate, flat bottom with
cover, Cat.#X6001, Genetix, New Milton, UK) containing LB medium supplemented with
freezing mix [0.4 mM Mg SO4, 1.5 mM Na3-citrate, 6.8 mM (NH4)2SO4, 3.6% (v/v) glycerol,
13 mM KH2PO4, 27 mM K2HPO4, pH 7.0]. Bacteria were grown in microtitre plates wells at
37oC overnight and the clones were gridded onto 222 mm x 222 mm Nylon filters membranes
(Hybond-N+, Amersham) in duplicate pattern for DNA hybridizations.
cDNA libraries screening
Hybridization screening was carried out on subtracted and non-subtracted Vicia faba cDNA
libraries using mixtures of isotope labeled ([32P]ATP) oligonucleotides designed according to Forisome sequenced peptides (II.2.2) as probes.
Approximately 30,000 clones from the subtracted cDNA library and 20,000 clones from the
not subtracted cDNA library were transferred using a Biomek 2000 with 384 High Density
Replica Tool (HDRT) (Beckmann Coulter, Fullerton, US) to Hybond-N+ (Amersham)
membranes placed over LB-Kan-X-Gal plates and incubated at 37C overnight. After 30 min
of incubation positioned face up onto Whatman 3MM paper soaked with denaturation buffer
(0.5 M NaOH; 1.5 M NaCl), the membranes were washed with neutralization buffer (1.5
NaCl; 0.5 M Tris-HCl pH 7.2) for another 5 min. Following softly cleaning of the cells debris
with a paper, the membranes were washed with 2XSSC buffer and air dried on Whatman
-
Chapter II Material and Methods ___________________________________________________________________________
24
3MM paper. The nylon filters were exposed at 50 mJoule under UV cross linker (GS Gene
Linker UV Chamber, Bio-Rad). Prehybridization was carried out with hybridization buffer
[5X SSC, 10X Denhardt solution, 1% (w/v) SDS and 10 g/ml of denatured salmon sperm DNA (Boehringer, Mannheim)] at 48C for 1 h with gentle shaking in waterbath and the
membranes were hybridized overnight in the same conditions upon addition of the labeled
probes in 300 l of hybridization buffer (90C). After hybridization, membranes were washed by gently shaking twice for 10 min in 2XSSC containing 0.1% (w/v) SDS at RT and another
two times at 48C. Radioactivity on the membranes was detected by placing the membranes
on a support, sealing them with Saran wrap and then exposing to imaging plates for 12 h.
Hybridization signals were detected by a phosphorimager (FLA-3000, FUJI).
100X Denhardt solution: 2% (w/v) Ficoll, 2% (w/v) PVP and 2% (w/v) BSA
II.2.6 PCR technologies
II.2.6.1 Cloning of 5 and 3 ends of full-length cDNAs using RACE-PCR
3- and 5- RACE-Ready cDNA populations were synthesized from mRNA using BD
SMARTTM RACE cDNA amplification kit (BD Biosciences Clontech, Palo Alto, CA).
Primer design and PCR for detection of expression of hypothetical Forisome gene
Gene-specific primers 3-RACE-GSP1 and 5-RACE-GSP1 were designed based on an EST
fragment from Medicago truncatula containing the identified Forisome peptides. These
primers were used for the first round of 3- and 5- RACE-PCR, repectively. The criteria for
primer design was that they should be 23 to 28 nucleotides long (optimum 25 nucleotides)
having 50% to 70% GC content with melting temperature ~ 70C, which enables touchdown
PCR. PCR conditions for detection of the gene expression from 3- and 5- RACE-Ready
cDNA populations were as follows: 5 cycles of 94C for 30 sec, 72C for 3 min, 5 cycles of
94C for 30 sec, 70C for 30 sec, and 72C for 2 min, 20 cycles of 94C for 30 sec, 67C for
30 sec, 72C for 2 min, followed by 72C for 10 min. The performance of each PCR reaction
was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.
5-RACE. The 5-most Forisome-related sequences were obtained by performing 5RACE
(rapid amplification of cDNA ends) with a SMART RACE cDNA amplification kit (BD
Biosciences). First-strand cDNA was synthesized from poly(A)+ RNA at 42C for 1 h with
PowerScript reverse transcriptase by using 5- RACE CDS primer [T25VN, where N is A, C,
G or T and V is A, G or C]. The SMART II A oligonucleotide (5-AAGCAGTGGTATCAAC
-
Chapter II Material and Methods ___________________________________________________________________________
25
GCAGAGTACGCGGG-3) was included. This oligonucleotide anneals to the C-rich cDNA
3 tail and serves as a primer for second strand DNA synthesis. After the first PCR
amplification with 5-RACE-GSP1 primer, different gene-specific backward primers (5-
RACE-GSP), derived from the hypothetical Forisome sequence obtained, were used to
perform four additional rounds of 5-RACE-PCR, along with a universal primer (5-
CTAATA CGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAG T-3) that can
anneal to the SMART II A oligonucleotide sequence.
3 RACE. The 3-most Forisome-related sequences were obtained by performing 3-RACE
with a SMART RACE cDNA amplification kit. First-strand cDNA was synthesized from
poly(A)+ RNA at 42C for 1 h with reverse transcriptase by using the oligo(dT)-based 3-
RACE CDS primer A [AAGCAGTGGTATCAACGCAGAGTAC(T)30VN, where N is A, C,
G, or T and V is A, C, or G]. Different gene-specific forward primers (3RACE-GSP) were
derived from the hypothetical Forisome sequence obtained in the first round of amplification.
These specific primers were used in the subsequent PCRs along with the universal primer that
can anneal to primer A.
After examination by gel electrophoresis (II.2.7.4), RACE reaction products were cloned into
pCR 2.1-TOPO (Invitrogen) (please refer to the appendices VII.2). White colonies were
selected and the verification of inserts was done by colony PCR. PCR conditions were as
follows: 94C for 4 min, 25 cycles of 94C for 30 sec, 53C for 30 sec, 72C for 1 min, and
72C for 10 min. Four to five independent clones for each of the 5- and 3-RACE products
were sequenced from both ends using generic sequencing primers. The assembled cDNA
sequences were aligned with the Forisome genomic sequence using the Wisconsin Package
v10.2, Genetics Computer Group (GCG), Madison, Wisc.
II.2.6.2 PCR amplification of cDNA
Polymerase chain reaction (PCR) was used for amplification of Forisome gene from a Vicia
faba RACE-Ready cDNA population (II.2.6.1). Double-stranded cDNA was amplified, based
on the protocol of Sambrook et al. (1989), using high fidelity DNA-polymerase and DNA
polymerase buffer from Roche. Two specific primers, 5-CATGCCATGGGAATGTCCTTTT
CTAACTCA-3 and 5-TAAAGCGGCCGCAACACCAAAGTTATTTGG-3 corresponding
to amino-terminal and carboxyl-terminal regions respectively (III.3.1), were used in the
amplification to introduce the NcoI and NotI restriction sites. The reactions were performed in
0.2 ml PCR reaction tubes (Biozym Diagnostik GmbH, Hessisch Oldendorf), using a DNA
thermal Cycler (MWG). PCR reactions were carried out in a total volume of 50 l under the following conditions: 95C for 2min, 35 cycles of 95C for 1 min, 53C for 1 min, 72C for 2
-
Chapter II Material and Methods ___________________________________________________________________________
26
min 50 sec, and 72C for 5 min. The performance of each PCR reaction was checked by
running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.
II.2.6.3 Identification of introns and genomic DNA cloning by LD PCR
Intron sequences were identified by LD PCR with the Expand Long Template PCR System
(Roche) using 100 ng of genomic DNA as a template; thermocycling was performed at 95C
for 2 min, 95C for 10 sec, 53C for 30 sec and 68C for 5 min, for 10 cycles; 95C for 15
sec, 53C for 30 sec and 68C for 5 min, for 25 cycles followed by 68C for 7 min. The
performance of each PCR reaction was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers. The amplified fragments were cloned into
pCR 2.1-TOPO (Invitrogen) (please refer to the appendices VII.2) and sequenced. Intron
delimitation within genomic sequences was done by comparing with the putative Forisome
cDNA sequence using the Wisconsin Package v10.2, Genetics Computer Group (GCG),
Madison, Wisc.
II.2.6.4 Genome Walking
Genomic DNA was extracted from Vicia faba young leaves as described before and was used
for genome walking experiments. Genome-walking PCR was performed using a Genome
Walker kit (BD Biosciences Clontech Laboratories, Palo Alto, CA) according to the
manufacturers manual. Briefly, Vicia faba genomic DNA was digested by DraI, HpaI and
SspI restriction enzymes. Adaptor DNA provided in the kit was ligated to the blunt-end DraI-,
HpaI- and SspI-digested genomic DNA fragments generating three Genome Walking
Libraries. The first PCR was conducted using an adaptor primer (5-GTAATACGACTCACT
ATAGGGC-3) provided by the kit and a GSP1 (5-CACAATGGGGATCCACAAAATCTT
GAA-3) that was complementary to the 5 region of Forisome cDNA. Second-round PCR
was done using the nested adaptor primer (5-ACTATAGGGCACGCGTGGT-3) and GSP2
(5-TCTGAACCGTTCCTTGCGGATATCGTC-3) complementary to the upstream
sequence of Forisome. The conditions used for the first and second PCR were 7 cycles at
94C for 25 sec and at 72C for 3 min, 32 cycles at 94C for 25 sec and at 67C for 3 min
followed by one cycle at 67C for 7 min, five cycles at 94C for 25 sec and at 72C for 3
min, and 20 cycles at 94C for 25 sec and at 67C for 3 min followed by one cycle at 67C for
7 min, respectively. The DNA amplified by PCR was cloned into pCR 2.1-TOPO
(Invitrogen) and was sequenced.
The performance of each PCR reaction was checked by running 5 l of each reaction on agarose gels (II.2.7.4), with appropriate DNA markers.
-
Chapter II Material and Methods ___________________________________________________________________________
27
II.2.7 Recombinant DNA technologies
All procedures for nucleic acid manipulation were done according to standard methods
(Sambrook et al., 1989) unless otherwise described.
II.2.7.1 Isolation of plasmid DNA from E.coli
Recombinant plasmid DNA was purified using QIAgen plasmid DNA Mini-and Midi- prep
kits according to the manufacturers instructions based on the alkaline lysis method
(Sambrook et al., 1989). Quality and yield of plasmid DNA was examined by
spectrophotometric analysis (II.2.7.2) and agarose gel electrophoresis (II.2.7.4). Isolated
plasmid DNA was stored at -20C.
II.2.7.2 Quantification of DNA
The DNA concentration was evaluated by optical density (1 OD260nm unit = 50 g/ml of
double stranded DNA) according to Sambrook and Russell (2000). The DNA purity was
determined by the OD260nm/OD280nm ratio of the measured optical density, which is 1.8 for
pure DNA.
II.2.7.3 PCR amplification
For rapid identification of recombinant E. coli and Agrobacteria control PCR was carried out
to detect plasmids as described by Jesnowski et al. (1995).
The optimal annealing temperature (Tp) of the primers was experimentally optimised or
calculated based on the empiric formula (Wu et al., 1991):
Tp = {22 + 1,46 [2X (G + C) + (A + T)]}
PCR reactions were carried out in a total volume of 50 l as described in table II-5.
Amplification was carried out under the following conditions: initial denaturation at 95C for
2 min, 35 cycles of denaturation at 95C for 1 min, primer annealing at 55C for 1 min,
primer extension at 72C for 1 min, and final extension at 72C for 5 min. The annealing
temperature and the time for denaturation were changed according to Tp value of primers and
the length of the target gene. The performance of each PCR reaction was checked by running
5 l of each reaction on agarose gels (II.2.7.4) with appropriate DNA markers.
-
Chapter II Material and Methods ___________________________________________________________________________
28
Table II-5 PCR reactions
Components Volume Final concentration 10X PCR buffer 5 l 1X
50 mM MgCl2 1.5 l 1.5 mM
10 mM dNTPs 1 l 0.2 mM each
10 pmol forward Primer 0.5-1 l 10 pmol
10 pmol backward primer 0.5-1 l 10 pmol
Template DNA 0.5-5 l 10-100 ng
Taq DNA polymerase (5U/l) 0.25 l 1.25 units
dd H2O to 50 l
II.2.7.4 Agarose gel electrophoresis of DNA
Plasmid DNA, and PCR-fragments were separated in 0.8-1.2% (w/v) agarose gels prepared in
TBE buffer containing 0.1 g/ml of ethidium bromide. Agarose gels and electrophoresis of the samples were carried out as described by Sambrook et al., (1989). Known amounts of
DNA molecular markers such as 1 Kb ladder (New England Biolabs), 100 bp ladder (New
England Biolabs) were used for evaluation and determination of DNA concentration and size.
The DNA samples were loaded onto the agarose gels after the addition of DNA loading
buffer. The visualization of the DNA bands and documentation of the gels was performed
using a UV transilluminator at 302 nm and a black and white E.A.S.Y 429K camera (Herolab)
together with a photo printer (Mitsubishi).
TBE buffer (pH 8): 90mM Tris base, 90mM boric acid, 0.2 M EDTA
DNA loading buffer: 1x TBE, 5% (w/v) sucrose, 0.04% (w/v) bromophenol blue, 2% (w/v)
SDS
II.2.7.5 Preparative agarose gel electrophoresis
Preparative gel electrophores