Bile Acid Receptor Agonist GW4064 Regulates PPARγ Coactivator-1α Expression Through Estrogen...

Bile Acid Receptor Agonist GW4064 Regulates PPAR�

Coactivator-1� Expression Through EstrogenReceptor-Related Receptor �

Shailendra Kumar Dhar Dwivedi,* Nidhi Singh,* Rashmi Kumari,* Jay Sharan Mishra,Sarita Tripathi, Priyam Banerjee, Priyanka Shah, Vandana Kukshal, Abdul Malik Tyagi,Anil Nilkanth Gaikwad, Rajnish Kumar Chaturvedi, Durga Prasad Mishra,Arun Kumar Trivedi, Somali Sanyal, Naibedya Chattopadhyay, Ravishankar Ramachandran,Mohammad Imran Siddiqi, Arun Bandyopadhyay, Ashish Arora, Thomas Lundåsen,Sayee Priyadarshini Anakk, David D. Moore, and Sabyasachi Sanyal

Endocrinology Division (S.K.D.D., A.M.T., D.P.M., So.S., N.C.), Drug Target Discovery and DevelopmentDivision (N.S., R.K., J.S.M., A.N.G., A.K.T., Sa.S.), Molecular and Structural Biology Division (S.T., P.S., V.K.,R.R., M.I.S., A.A.), and Central Drug Research Institute, and Developmental Toxicology Division (R.K.C.),Indian Institute of Toxicological Research, Council of Scientific and Industrial Research, Lucknow 226001,India; Cell Biology and Physiology Division (P.B., A.B.), Indian Institute of Chemical Biology, Council of Scientificand Industrial Research, Kolkata 700032, India; Center for Endocrinology, Metabolism, and Diabetes (T.L.),Department of Medicine, Karolinska Institutet, Karolinska University Hospital, SE-14186 Stockholm, Sweden; andDepartment of Molecular and Cellular Biology (S.P.A., D.D.M.), Baylor College of Medicine, Houston, Texas 77030

Peroxisome proliferator-activated receptor � coactivator-1� (PGC-1�) is induced in energy-starved conditionsand is a key regulator of energy homeostasis. This makes PGC-1� an attractive therapeutic target for met-abolic syndrome and diabetes. In our effort to identify new regulators of PGC-1� expression, we found thatGW4064, a widely used synthetic agonist for the nuclear bile acid receptor [farnesoid X receptor (FXR)]strongly enhances PGC-1� promoter reporter activity, mRNA, and protein expression. This induction inPGC-1� concomitantly enhances mitochondrial mass and expression of several PGC-1� target genesinvolved in mitochondrial function. Using FXR-rich or FXR-nonexpressing cell lines and tissues, wefound that this effect of GW4064 is not mediated directly by FXR but occurs via activation ofestrogen receptor-related receptor � (ERR�). Cell-based, biochemical and biophysical assays indicateGW4064 as an agonist of ERR proteins. Interestingly, FXR disruption alters GW4064 induction ofPGC-1� mRNA in a tissue-dependent manner. Using FXR-null [FXR knockout (FXRKO)] mice, wedetermined that GW4064 induction of PGC-1� expression is not affected in oxidative soleus musclesof FXRKO mice but is compromised in the FXRKO liver. Mechanistic studies to explain these differ-ences revealed that FXR physically interacts with ERR and protects them from repression by theatypical corepressor, small heterodimer partner in liver. Together, this interplay between ERR�-FXR-PGC-1� and small heterodimer partner offers new insights into the biological functions of ERR� and FXR,thus providing a knowledge base for therapeutics in energy balance-related pathophysiology. (Molec-ular Endocrinology 25: 922–932, 2011)

NURSA Molecule Pages: Nuclear Receptors: ERR-� � FXR-� � SHP; Coregulators: PGC-1; Ligands:GW4064 � 4-Hydroxytamoxifen � Bisphenol A.

Peroxisome proliferator-activated receptor � coactiva-tor-1� (PGC-1�) is a transcriptional coactivator that is

enriched in tissues with high energy demand, such as brownfat, “slow-twitch” oxidative skeletal muscles, and heart (1–3). Unlike most of the constitutively expressed coactivators,

PGC-1� expression is inducible by exercise, fasting, orexposure to cold (4). PGC-1� has been implicated inthe regulation of fatty acid oxidation, mitochondrialrespiratory function, glucose utilization, and hepaticgluconeogenesis (5, 6).

ISSN Print 0888-8809 ISSN Online 1944-9917Printed in U.S.A.Copyright © 2011 by The Endocrine Societydoi: 10.1210/me.2010-0512 Received December 8, 2010. Accepted March 29, 2011.First Published Online April 14, 2011

* S.K.D.D., N.S., and R.K. contributed equally to this work.Abbreviations: CDCA, Chenodeoxycholic acid; COX-II, cytochrome C oxidase II; CT, cyclethreshold; CYP7A1, cholesterol-7�-hydroxylase; DMSO, dimethylsulfoxide; ERR, estrogenreceptor-related receptor; F, forward; Fex, Fexaramine; FXR, farnesoid X receptor; FXRKO,FXR knockout; Gal-Luc, luciferase reporter driven by yeast GAL 4 response element;

O R I G I N A L R E S E A R C H

922 mend.endojournals.org Mol Endocrinol, June 2011, 25(6):922–932

The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 September 2014. at 06:40 For personal use only. No other uses without permission. . All rights reserved.

Farnesoid X receptor (FXR) regulates a multitude ofgenes in bile acid biosynthesis and transport, including therate-limiting enzyme for bile acid biosynthesis, cholesterol-7�-hydroxylase (CYP7A1) (7). FXR interacts withPGC-1� and mediates PGC-1� actions in hepatic glu-coneogenesis and lipid metabolism (8 –10). Due to itsimportance in glucose and lipid homeostasis, FXR isconsidered a promising therapeutic target. GW4064, asynthetic FXR ligand (11, 12), has been reported toameliorate lithogenic diet-induced cholesterol gall-stone disease in mice (13) and favorably affect glucoseand lipid homeostasis in obesity and diabetes (8). Due topoor bioavailability, the promise of GW4064 as a candidatedrug is diminished. However, it is extensively used as a ref-erence compound to deduce FXR function since the pastdecade. Studies on the mechanism of FXR action have re-vealed that a part of the FXR action is mediated by inductionof the atypical corepressor small heterodimer partner (SHP)(11, 14), which binds to coactivator binding surface of anumber of nuclear receptors and recruits corepressor com-plex proteins (15).

The estrogen receptor-related receptors (ERR) that in-clude ERR�, ERR-�, and ERR-� also interact with PGC-1�

(16–18). ERR� in particular mediates a number of PGC-1�

functions, such as regulation of mitochondrial mass, func-tion, and hepatic glucose oxidation (16). FXR, PGC-1�,ERR, and SHP share a common tissue distribution and arefound in liver, kidney, stomach, and intestine (19), althoughERR are also enriched in other PGC-1�-expressing tissues,including brown fat, skeletal muscle, and heart (19).

The present study was designed to identify and char-acterize new regulators of PGC-1� expression. From ourscreening, we identified GW4064, a well-known syn-thetic agonist of FXR as a regulator of PGC-1� expres-sion. We demonstrate that this PGC-1� induction is me-diated through ERR�, and GW4064 is an agonist for allERR isoforms. Further, we show that FXR via physicalinteraction with ERR� contributes to hepatic PGC-1�

regulation. Given that FXR is important for cholesteroland carbohydrate metabolism and ERR are principal to en-ergy homeostasis, our findings suggest that these physiolog-ically related but distinct pathways converge through thisERR and FXR interplay.

Results

FXR-independent induction of PGC-1� by GW4064To identify new factors regulating PGC-1� expression,

2.6-kb mouse PGC-1� and 1-kb human PGC-1� promoterreporters (mouse PGC-1luc and human PGC-1luc) werescreened in Huh7 hepatoma cells using commercially avail-able ligands for various nuclear receptors. Among thecompounds tested, FXR agonist GW4064 strongly in-duced the reporter activities (Fig. 1A). Surprisingly,GW4064 also activated PGC-1luc in COS-7 cells (Fig.1B), which were used as a negative control in secondaryscreening, because they do not express FXR (Fig. 1C)(20). Moreover, chenodeoxycholic acid (CDCA), a nat-ural FXR ligand, failed to activate PGC-1luc (Fig. 1D).Introduction of FXR or FXR fused to herpes simplexvirus protein VP16 activation domain (VP16FXR) failed toaugment basal or GW4064 induction of PGC-1luc activity(Fig. 1D), whereas they strongly enhanced a SHP promoterreporter (SHP-luc) (Fig. 1E). Further, 9-cis retinoic acid hadno effect on GW4064 activation of PGC-1luc (Supplemen-tal Fig. 1, published on The Endocrine Society’s JournalsOnline web site at http://mend.endojournals.org). These re-sults indicate that the GW4064 effect on PGC-1luc may beFXR independent. Interestingly, GW4064 also activatedSHP-luc in Cos-7 cells in the absence of exogenous FXR, andthis activation was equivalent to the activity of VP16FXR inabsence of FXR ligand (Fig. 1E).

Next, the effect of GW4064 on PGC-1� mRNA ex-pression was investigated in a number of cell lines thatexpress endogenous PGC-1� (we did not detectPGC-1� in Huh7 and Cos cells). GW4064 significantlyinduced PGC-1� mRNA in HepG2 cells, which areknown to express relatively high amounts of FXR.GW4064 also induced PGC-1� mRNA in L6, C2C12myocytes, and primary rat calvarial osteoblasts (Fig.1F), which we assumed to be lacking FXR, becauseearlier studies did not detect FXR expression in skeletalmuscle and bone (19). Further, GW4064 inducedPGC-1� protein expression in both C2C12 and HepG2(Fig. 1G). These results indicate that GW4064 activatesPGC-1� promoter and induces its expression in both FXR-nonexpressing and FXR-rich cells. Consistent with mito-chondrial role of PGC-1�, GW4064 enhanced mitochon-drial mass and activity in C2C12 cells (Supplemental Fig. 2).The induction of PGC-1� by GW4064 was replicated invivo. GW4064 significantly enhanced PGC-1� mRNA andprotein in both liver (FXR-rich) and skeletal muscles (doesnot express FXR) of BALB/C mice (Fig. 1, H and I) and, asexpected, induced SHP and suppressed CYP7A1 mRNA inliver (Fig. 1H).

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GST, glutathione S-transferase; HA,hemagglutinin; ITC, isothermal titration calorimetry; Ka, association constant; Kd, dissociationconstant; LBD, ligand binding domain; mt-TFA, mitochondrial transcription factor; NRF, nu-clear respiratory factor; OHT, 4-hydroxytamoxifen; PGC-1�, peroxisome proliferator-activatedreceptor � coactivator-1�; QRT-PCR, quantitative RT-PCR; R, reverse; SHP, small heterodimerpartner; siRNA, small interfering RNA; TR-FRET, time-resolved fluorescent resonant energytransfer;WT, wild type.

Mol Endocrinol, June 2011, 25(6):922–932 mend.endojournals.org 923


FXR differentially contributes to PGC-1�

expression in liver and skeletal musclesAlthough GW4064 activated PGC-1luc independent of

FXR and induced PGC-1� mRNA in vitro and in vivo (Fig.1), the reported alterations of PGC-1� expression in liver offed, short-term- and long-term-fasted FXR knockout(FXRKO) mice (21, 22), and a tendency for increased PGC-1�

expression in FXRKO skeletal muscle (23), prompted us toexamine the role of FXR in regulation of PGC-1� in liverand skeletal muscle. FXRKO or wild type (WT) mice wereadministrated GW4064 by oral gavage, and gene expressionanalyses were performed in liver and type I “slow-twitch”fiber-enriched soleus muscle (soleus muscle was chosen, be-cause it exhibits high energy demand, and therefore,PGC-1� plays a critical role in this tissue). Consistent withprevious reports (21, 23), FXR disruption strongly sup-

pressed basal PGC-1� expression in fedliver, whereas PGC-1� expression in so-leus muscles was increased (Fig. 2A). In-triguingly, FXR disruption eliminatedthe GW4064 induction of hepatic PGC-1�, which is contrary to our finding inFig. 1 that GW4064 induction of PGC-1is FXR independent. However, in soleusmuscle of FXRKO mice, GW4064 in-duction of PGC-1� expression wasmaintained (Fig. 2A). As expected,GW4064 induced SHP and repressedCYP7A1 expression in WT but not inFXRKO liver.

Together, these results demonstratethat GW4064 induction of PGC-1�

may occur through FXR-independentpathways both in vitro and in vivo;however, FXR contributes to this effectin liver. Further, because SHP-luc wasalso activated by GW4064 in absenceof FXR in Cos-7 cells (Fig. 1E), it ap-pears that this FXR-independent effectprobably is mediated through a com-mon factor that regulates both SHPand PGC-1� expression.

GW4064 induction of PGC-1�

expression is routed through ERR�

ERR regulate both PGC-1� and SHPpromoters (24, 25) and share similar tis-sue distribution and induction patternwith PGC-1� (16, 26). Therefore, we ex-amined whether GW4064 induction ofPGC-1� occurs through ERR. In Cos-7reporter assays, XCT790 (Fig. 3A), anERR� inverse agonist (27), reduced basal

PGC-1� luc activity and abolished the GW4064 induction ofthis reporter. However, ERR� inverse agonist, 4-hydroxyta-moxifen (OHT) (28) or guggulsterone (that in addition tobeing an FXR antagonist affects multiple nuclear receptors)(29, 30), failed to affect GW4064-mediated PGC-1� lucactivity (Fig. 3A). Guggulsterone successfully inhibited theactivity of pMFXR on a luciferase reporter driven by yeastGAL4 response element (Gal-luc) (Supplemental Fig. 3), andXCT790 did not affect pMFXR activity on Gal-luc (Supple-mental Fig. 4). Gene expression analysis revealed ERR� butnot ERR� expression in Cos, Huh7, and HepG2 (Fig. 3B).Wealso foundstrongERR� expression inall thecell linesandtissues where GW4064 induction of PGC-1� mRNA was ob-served by RT-PCR (Fig. 3B) or quantitative RT-PCR (QRT-PCR) [cycle threshold (CT) values for ERR�, HepG2: 24.29 �

FIG. 1. GW4064 activates PGC-1� promoter reporter and induces its expression in cell andin vivo. A and B, GW4064 activates PGC-1luc in Huh7 (A) and Cos-7 cells (B). Cells weretransfected with indicated plasmids and treated for 24 h. After lysis, luciferase activities weredetermined, normalized with GFP fluorescence, and plotted as fold activity over vehicle-treated PGL3-basic transfected controls. C, Relative expression levels of FXR in indicated celllines as detected by RT-PCR. All primer information is provided in Supplemental ExperimentalProcedures. D, Exogenous FXR fails to augment GW4064 activity on PGC-1luc. E, ExogenousFXR enhances GW4064 activation of SHP-luc. Reporter assays were performed in Cos-7 cellsas in A, and data are plotted as fold activity over vehicle-treated controls. Data representmean � SD from three independent experiments. F, GW4064 induces PGC-1� expression;24 h after treatment of indicated cell lines with vehicle (V) or 1 �M GW4064, QRT-PCR wereperformed. Data represent mean � SEM from three independent experiments. Average FXRCT values from three independent QRT-PCR are shown at the top. H, GW4064 induces PGC-1� expression in vivo. Eight-wk-old male BALB/C mice were fed once with vehicle (gumacacia; n �5) or GW4064 (50 mg/kg body weight in gum acacia; n �6). After 24 h, RNA wasextracted from liver and pooled hind limb skeletal muscle, and QRT-PCR was performed intriplicates. Top panel shows average CT values for FXR mRNA. G and I, GW4064 inducesPGC-1� protein expression as detected by immunoblotting. RCO, Rat calvarial osteoblasts;P, plasmid control; n, negative control; GW, GW4064; WB, Western blot; Sk., skeletal.

924 Dhar Dwivedi et al. GW4064 Induces PGC-1� Through ERR� Mol Endocrinol, June 2011, 25(6):922–932


0.26; C2C12: 23.48 � 0.62; liver: 25.85 � 0.92; skeletal mus-cle: 26.80 � 1.15]. These results suggest that GW4064 induc-tion of PGC-1� may occur through ERR�.

Because XCT790 degrades ERR� protein (27), we stud-ied the effect of XCT790-mediated depletion of endogenousERR� in GW4064 regulation of endogenous PGC-1� andSHP in HepG2 cells. XCT790 significantly reduced bothbasal and GW4064-induced expressions of PGC-1� andSHP (Fig. 3C). Further, XCT790 repression of GW4064activity on PGC-1luc could be rescued with the introductionof exogenous ERR� (Supplemental Fig. 5), indicating thatthe observed GW4064 effect on PGC-1� expression maysolely be through ERR�. This finding was further substan-tiated using an RNAi approach. As demonstrated in Fig. 3D,GW4064 induction of PGC-1� as well as ERR� (which isautoregulated by ERR�) was abolished in presence of ERR�

small interfering RNA (siRNA). This finding was also sub-stantiated in FXR-nonexpressing C2C12 cells, whereGW4064 induced mRNA levels of a number of genes in-volved in mitochondrial functions that also are validatedERR� targets (31, 32), including cytochrome C somatic,nuclear respiratory factor (NRF)-2 (NRF-2), and ERR�

(Fig. 3E). Consistent with PGC-1� induction, GW4064 alsoinduced validated PGC-1� targets (33), NRF-1, mitochon-drial transcription factor (mt-TFA), and cytochrome C ox-idase II (COX-II) (Fig. 3E).

We next studied the effect of GW4064 on XCT790degradation of ERR� in Cos-7 cells, because it expressesendogenous ERR� but not FXR. As shown in Fig. 3F,XCT790 strongly depleted endogenous ERR� protein inCos-7 cells, whereas GW4064 abolished this effect. The

same pattern was replicated in presence of protein syn-thesis inhibitor cycloheximide (Fig. 3F), indicating thatGW4064 can reverse the degradation of ERR� byXCT790. Further, GW4064 treatment reduced ERR in-teraction with immobilized SHP in an in-cell glutathioneS-transferase (GST) pull-down assay (Fig. 3G), whereas itenhanced ERR� interaction with coactivator transcrip-tional intermediary factor 2 (Fig. 3H), indicating thatGW4064 may activate ERR� by reducing its interactionwith SHP and enhancing its interaction with coactivators.

Together, these data demonstrate that PGC-1� expres-sion is regulated by GW4064 through ERR� and that thisregulation may occur due to a direct interaction betweenGW4064 and ERR� and concomitant increase in ERR�

protein stability and reduction in interaction with core-pressor SHP and enhancement of coactivator interaction.

GW4064 is an ERR ligandWe next investigated whether GW4064 activates ERR

group of proteins. To answer this, we used mammaliantwo hybrid-based ERR-cofactor interaction studies withor without GW4064 or DY131, an ERR�/� agonist (34).All three ERR isoforms, being constitutive transcriptionalactivators, interacted with steroid receptor coactivator 2in absence of added agonist, and GW4064 further aug-mented these interactions (Supplemental Fig. 6). Further,GW4064 strongly activated pMERR� and showed com-parable augmentation of pMERR� activity with DY131(Fig. 4, A, C, and D), whereas another FXR agonist Fexa-ramine (Fex) failed to do so (Fig. 4C). GW4064 also ac-tivated ERR-responsive ERE-luc (estrogen response ele-ment driven luciferase reporter) in ER and FXR-nullCos-7 cells, and this activity was enhanced by full-lengthERR� but not ERR�dAF2 (ERR� deletion mutant lack-ing the activation function 2) (Fig. 4B). Furthermore,GW4064 activation of pMERR� or �ERR� was com-promised by their respective inverse agonists, XCT790and OHT (Fig. 4D). GW4064 dose dependently enhancedpMFXR, pMERR�, or pMERR� activity on Gal-luc, andthe EC50 were determined to be 17.46 nM for ERR�,13.32 nM for ERR�, and 152.7 nM for FXR.

To explore whether GW4064 is a ligand for ERR isoforms,a comparative docking study was performed. BecauseGW4064 could activate all ERR (Fig. 3 and SupplementalFig. 5), and ERR� is structurally the more well-studied iso-form, it was chosen for structural analysis. The dockinganalyses were performed for known ERR� ligands, includ-ing, OHT, Bisphenol A, DY131, GSK4716, and GW4064.It was observed that all the compounds occupy the samespatial position with similar binding mode as the cocrystal-lized OHT and Bisphenol A in ERR� active site. A thoroughexamination of top scoring binding mode of GW4064 re-

FIG. 2. PGC-1� induction by GW4064 is FXR dependent in liver butindependent in skeletal muscle. A and B, Ten- to 12-wk-old FXRKO orage- and sex-matched WT mice were given GW4064 or vehicle (V) byoral gavage (50 mg/kg body weight) for 3 d (WT: V, n � 3; GW4064,n � 4; FXRKO: V, n � 3; GW4064, n � 4). To eliminate fasting-mediated PGC-1� induction, animals were killed under fed condition.Total RNA was isolated from indicated tissues, and QRT-PCR wasperformed in triplicates. Data represent mean � SEM and are plotted asfold change over vehicle-treated WT controls.



vealed that docking conformation of GW4064 is involved inaromatic interaction with aromatic ring of Trp305, Tyr326,and Phe435, whereas nonbonded Van der Waal interactionsare mainly provided by Cys269, Ala272, Met306, Leu309,

Ile310, Val313, and Leu440. Hydrogenbonds exist between carbonyl oxygenof Glu275 and carbonyl oxygen ofGW4064 and NH2 of Arg316 and car-bonyl oxygen of GW4064 to stabilizethe complex whereas polar groups ofGlu441 lie in close vicinity of Cl31 ofGW4064 (Supplemental Fig. 7).

To confirm the physical interactionbetween ERR and GW4064, an in vitrotime-resolved fluorescent resonant en-ergy transfer (TR-FRET) assay was per-formed with ERR� and a coactivatorpeptide. Because ERR� shows strongconstitutive coactivator interaction, the as-say was modified as a competitor assay us-ingOHT.AsshowninFig.4E,OHTaloneconcentration-dependently inhibited theconstitutive ERR-coactivator peptide in-teraction, and both DY131 and GW4064concentration-dependently rescued the in-hibition caused by 500 nM OHT.

To determine the thermodynamicproperty of ERR�-GW4064 interaction,isothermal titration calorimetry (ITC) wasperformed. As shown in Fig. 4F, a down-ward position of the ITC titration peaks(Fig. 4F, top panel) and the resultant neg-ative integrated heats (Fig. 4F, bottompanel) demonstrated that the associationbetween ERR� ligand binding domain(LBD) and GW4064 is an enthalpicallydriven process at these experimental con-ditions, characterized by the equilibriumdissociation constants (Kd) for the first andsecondbinding site equal to8.13�1.0 �M

(Kd1) and 292.4 � 29.92 �M (Kd2),respectively.

Together, Figs. 3 and 4 demonstratethat GW4064 may indeed be a pan-ERR ligand and that the observedGW4064 effects on PGC-1� expres-sion may be through ERR� activation.

FXR interacts with ERR andprotects it from SHP repression

Although Figs. 3 and 4 clearly dem-onstrated the role of ERR� in GW4064-mediated PGC-1� induction, decreased

basal PGC-1� transcript and absence of GW4064 effect inFXRKO liver (Fig. 2A) was still puzzling. We hypothesizedthat FXR may regulate ERR activity in liver.

FIG. 3. GW4064-mediated PGC-1� up-regulation occurs via ERR�. A, XCT790 repressesGW4064 activation of PGC-1luc. Cos-7 cells were transfected and treated as indicated. Incotreatment experiments, GW4064 treatment was preceded by 1-h treatment with indicatedinhibitors. Cells were processed as in Fig. 1A. Data represent mean � SD from three independentexperiments. B, mRNA Expression of ERR�. Total RNA was isolated from indicated cell lines, RT-PCR was performed and resolved by agarose gel electrophoresis. P, Plasmid control, N, no DNA.C, XCT790 represses basal or GW4064-induced PGC-1� and SHP expression. HepG2 cells weretreated with GW4064 and/or XCT790 as illustrated and were analyzed by QRT-PCR. Datarepresent mean � SEM from three independent experiments done in triplicates. D, ERR� depletioncompromises GW4064 induction of PGC-1� and ERR� mRNA. HepG2 cells were transfected withERRa or control (siPGL3) siRNA; 24 h after transfection, cells were treated with 1 �M GW4064 fora further 24 h. Cells were then lysed, and QRT-PCR were performed. Data represent mean � SEM

from three independent experiments. Inset shows percent ERR� knockdown (upper panel) andERR� protein level after 72 h of siRNA transfection is shown (lower panel). E, GW4064 inducesERR� targets in C2C12 myocytes. C2C12 myocytes were treated with 1 �M GW4064 asindicated, and QRT-PCR were performed. Data represent mean � SEM from at least sixindependent experiments. F, Reduction of ERR� protein stability by XCT790 is reversed byGW4064. Cos-7 cells were treated as illustrated. For cycloheximide treatment, 10 �M

cycloheximide was added 2 h before GW4064 treatment. A representative Western blotting ofthree independent experiments is shown. G, GW4064 reduces ERR�-SHP interaction in Cos-7cells. In-cell GST pull-down assay. After transfection with mammalian GST expression plasmidexpressing GST-SHP (pEBGSHP) and a plasmid encoding HAERR�, and indicated treatments,whole-cell extracts were immobilized on glutathione sepharose beads and analyzed by Westernblotting with indicated antibodies. Data represent one of two independent experiments. G-SHP,pEBGSHP; H-ERR�, HAERR�. H, GW4064 enhances ERRa-TIF-2 (transcription intermediary factor-2) interaction. As demonstrated above, in-cell GST pull-down assay was performed and detectedwith indicated antibodies. Data are representative of two independent experiments. V, Vehicle;GW, GW4064; WB, Western blot.



First, we investigated whether ERR interact with FXR.pMERR� strongly interacted with VP16FXR in a mam-malian two hybrid assay in absence of ligand, and thereporter activity was further enhanced in presence of both

DY131 and GW4064 (Fig. 5A). In-cellGST pull-down assay also showedstrong interaction between ERR�,�and FXR in absence of GW4064 (Fig.5B) and unlike in mammalian two hy-brid assay, in this system, GW4064failed to potentiate it (Fig. 5B). Thesedata indicate that the augmentation ofreporter activity in mammalian twohybrid interaction assay may reflect theincreased transcriptional activity of theERR-FXR complex but not the inten-sity of interaction between these twoproteins. Further, in vitro GST pull-down assays showed that FXR physi-cally interacts with ERR� and ERR�

with equal intensity in presence or ab-sence of ligand (Fig. 5C).

Because hepatic cells express SHP,which inhibits ERR activity (24, 25), weinvestigated whether FXR by interactingwith ERR could modulate ERR repres-sion by SHP. SHP strongly inhibited theconstitutive activity of pMERR� on Gal-luc (Supplemental Fig. 8), and this SHPrepression was relieved by FXR in a con-centration-dependent manner (Fig. 5D).Consistent with previous reports (11),SHP failed to affect pMFXR activity(Supplemental Fig. 8). FXR also affectedinteraction between immobilized SHP andERR� in in-cell pull-down assay, whereasno interaction between FXR and SHP wasobserved (Fig. 5E). Together these datademonstrate that FXR may protect ERRactivity by competing with SHP.

Discussion

Our study has identified that GW4064, asynthetic FXR agonist, is also a bona fideagonist for ERR isoforms, and throughERR�, it augments PGC-1� expressionin multiple tissues and cell lines. Al-though FXR does not regulate PGC-1�

directly, it is necessary in ERR�-medi-ated PGC-1� expression in SHP-positivehepatic cells through a unique mecha-

nism, whereby FXR interacts with ERR and protects themfrom SHP repression. Our results also demonstrate that,despite its absence in skeletal muscle, FXR inhibits PGC-1�

expression through yet unknown mechanisms.

FIG. 4. GW4064 is an ERR ligand. A, GW4064 augments pMERR� activity on Gal-luc. Cos-7 cellswere transfected and treated as indicated, and data were plotted as fold activity over vehicle (V)-treated controls. B, GW4064 enhances ERR� activity on ERE-luc. C, GW4064 but not Fex activatesERR� and ERR� on Gal-luc. D, XCT790 and OHT suppress GW4064-induced ERR� and ERR�activation of GAL-luc, respectively. For pMERR� studies, 50 ng of PGC-1� were added, becauseERR� is a weak activator of transcription in reporter assays. A–D, Data represent mean � SD fromthree independent experiments. Insets are Western blottings showing expression levels of thetransfected constructs. E, Dose response of GW4064 on ERR� and ERR�. Cos-7 cells weretransfected with Gal-luc and indicated expression plasmids and treated with indicated doses ofGW4064. Normalized luciferase values were further normalized by dividing the values withcorresponding values obtained from pM transfected cells. Data represent mean � SD from one ofthree independent experiments performed in duplicate. All the experiments exhibited identicalpattern. F, GW4064 relieves inhibition of ERR�-coactivator interaction by OHT. TR-FRET assay wasperformed using “Lanthascreen” ERR� coactivator assay kit. Y-axis represents ratio of fluorescenceintensity at 520 nm (signal) and 495 nm (background). X-axis represents ligand doses in �M. Datarepresent mean � SD of one experiment performed in quadruplets. One of two independentexperiments is shown. G, Probing GW4064-ERR�LBD interactions by ITC. ITC was performed asdescribed in Supplemental Materials and Methods. The negative peaks indicate an exothermicreaction. The area under each peak represents the heat released after an injection of GW4064 intoERR�LBD solution. Lower panel represents binding isotherms obtained by plotting peak areas againstthe molar ratio of ligand to ERR�LBD. The lines represent the best-fit curves obtained from least-squares regression analyses assuming a two set of sequential binding model. The raw data withintegrated baseline are represented in upper panel. In the lower panel, the integrated peaks arerepresented by a fitted curve, using the “two set of sequential sites model” from Origin 7 (MicroCal).GW, GW4064; WB, Western blot.



These results are important, because they providemechanistic insights into a number of observations madeearlier. For example, GW4064 but not CDCA has beenreported to induce PGC-1� mRNA in HepG2 cells, al-though the mechanism was not elucidated (10). Further,structurally distinct FXR ligands CDCA, GW4064, andFex have been found to induce distinct gene expressionprofiles in microarray (35, 36), and our study indicatesthat this difference between GW4064 and Fex may atleast partly be due to GW4064 activation of ERR iso-forms. Our data that GW4064 is an ERR agonist alsogain an indirect support from an earlier report, wheremicroarray analysis of GW4064 or CDCA treated pri-mary rat hepatocytes revealed that 21 genes were up-regulated by 2-fold or more in GW4064 but not inCDCA-treated samples (36). Upon literature searches, wefound that eight of these 21 genes have been reported asERR� or ER targets by various methods, including phar-macological approaches, gene expression, and chromatinimmunoprecipitation-based assays. These genes includecarnitine palmitoyl transferase II (31), fatty acid trans-porter/CD36 (37), muscle LIM protein (37, 38), �4-3-ketosteroid 5�-reductase (39), multidrug resistance pro-tein 2 (40), heat shock protein 70 (41), UDP-glucuronosyltransferase 2B 15 (42), and SHP (25). We arecurrently pursuing detailed evaluation of these targets inreference to ERR-GW4064 in relevant tissues.

A puzzling observation, as witnessedhere (Fig. 3B) and earlier, has been thatSHP expression is remarkably reduced inFXRKO mice (8, 22, 43), despite the reg-ulation of SHP promoter by liver-abun-dant and robust constitutive transcrip-tional activator, liver receptor homolog-1(11, 14), and ERR (25). Our findings thatFXR protects ERR from SHP repressiongives a rational explanation to this phe-nomenon, where disruption of FXR mayincrease ERR-SHP interaction and sub-sequently cause stronger down-regula-tion of SHP promoter. A counter argu-ment may be that in FXRKO liver,CYP7A1 is increased and GW4064 failsto repress it, but it is important to notethat CYP7A1 repression by GW4064-FXR is routed through both SHP-depen-dent and SHP-independent pathways(44, 45). Further, using liver- or intestine-specificFXRKOmice,Kimetal. (46)dem-onstrated that in liver-specific FXRKOmice, GW4064 repression of hepaticCYP7A1 isnotaffected,whereas intestine-specific FXRKO eliminates GW4064 sup-

pression of hepatic CYP7A1, indicating that most of the acuteeffect of FXR on CYP7A1 transcription is mediated by induc-tion of fibroblast growth factor 15 in intestine.

Interestingly, a recent report has shown ER-FXR inter-action in breast cancer cells (47), and we believe it will beworth investigating whether all SHP interacting NR couldinteract with FXR. Moreover, recent genome-wide FXRbinding sites in liver and intestine revealed the presence ofhalf-sites (AGGTCA or TGACCT) adjacent to FXR bindingsequences (48). Further, another recent report showed thatFXR by binding to steroidogenic factor 1 response elementregulates aromatase expression in Leydig cells (49). Inciden-tally, these half-sites and steroidogenic factor 1 responseelement sequences represent typical ERR binding sites.

Together, FXR-ERR interaction, ligand sharing, and apossibility of sharing of target elements suggest that ERRand FXR pathways may converge in a multitude of physio-logical and disease pathways. Detailed dissection, which iscurrently in progress, of this intricate interplay under differ-ent experimental conditions may help in developing newtreatment regimens to various metabolic disease states.

Materials and Methods

ReagentsGW4064 was procured from Sigma (St. Louis, MO) and

Tocris Biosciences (Ellisville, MO) and compared. Both showed

FIG. 5. FXR interacts with ERR and protects them from SHP repression. A, ERR� and FXRinteract in Cos-7 mammalian two hybrid assay. Data represent mean � SD from threeindependent experiments. B, ERR� and ERR� interact with FXR in in-cell GST pull-down assay.In-cell GST pull down was performed as described elsewhere (20). One of two independentexperiments is shown. C, Ligand-independent interaction of ERR�, ERR�, and FXR in vitro. Invitro GST pull down was performed as described elsewhere (25). Representative figures out ofsix independent experiments are shown. D, FXR relieves SHP repression of ERR activity on Gal-luc. Data represent mean � SD from three independent experiments. E, FXR blocks ERR-SHPinteraction in in-cell GST pull-down assay. NS, Nonspecific; G, pEBG; G-SHP, pEBGSHP; G-ERR�, pEBGERR�; G-ERR�, pEBGERR�; H-ERR�, HAERR�; F-FXR, FlagFXR. V, Vehicle; PD, pull-down; GW, GW4064; WB, Western blot.



identical activities on PGC-1� expression, PGC-1luc activation,and ERR/FXR transactivation. Sigma GW4064 was used for allthe experiments in this report. CDCA, XCT790, and OHT werefrom Sigma. JC-1, LanthaScreen ERR� TR-FRET Coactivatorassay kit, cell culture media, and supplements were from Invit-rogen (Carlsbad, CA). Remaining chemicals were from Sigmaunless otherwise indicated.

Primers

Trans-species primers for RT-PCRTrans-species primers were designed from conserved regions of

indicated genes based on trans-species sequence alignment [usingBasic Local Alignment Search Tool (bl2seq) program from Na-tional Center for Biotechnology Information (Bethesda, MD)] be-tween Homo sapiens, Rattus norvegicus, Mus musculus, Macacamulata, and Pan troglodytes. In all the cases, the deduced productlengths were identical as checked by species specific primer blastsearches from National Center for Biotechnology Information.The primer sequences (5�-3�) are: glyceraldehyde-3-phosphate de-hydrogenase (GAPDH) forward (F), CACCATCTTCCAG-GAGCGAGA; GAPDH reverse (R), GCTAAGCAGTTGGTG-GTG CA; FXR F, AAAGGGGATGAGCTGTGTGT; FXR R,TTCAGCCAACATTCCCATCTC; PGC-1� F, GCTGAACAA-GCACTTCGGTCA; PGC-1� R, GCATCCTTTGGGGTCTTT-GAGA;ERR�F,CCTGACAGTCCAAAGGGTTC;ERR�R,ATG-GTCCTCTTGAAGAAGGC; ERR� F, AGTTCAACCATGAATG-GCCATCA; ERR� R, GCCTTGCAGGCTTCACATGA.

Mouse primers for QRT-PCRGAPDH F, GTGTCCGTCGTGGATCTGA; GAPDH R,C-

CTGCTTCACCACCTTCTTG; PGC-1� F, AGCCGTGAC-CACTGACAACGAG; PGC-1� R, CTGCATGGTTCTGAGT-GCTAAG; FXR F, TCCGGACATTCAACCATCAC; FXR R,TCACTGCATCCCAGATCTC; SHP F, CTGAAGGGCAC-GATCCTCTTC; SHP R, ACCAGGGCTCCAAGACTTCAC;CYP7A1 F, AGCAACTAAACAACCTGCCAGT ACTA;CYP7A1 R, GTCCGGATATTCAAGGATGCA; mt-TFA F,CTGATGGGTATGGA GAAGGAGG; mt-TFA R, CCAA-CTTCAGCCATCTGCTCTTC; NRF-1 F, GAACGCC ACCGATTTCACTGTC; NRF-1 R, CCCTACCACCCACGAAT-CTGG; NRF-2 F, GGCACAG TGCTCCTATGCGTG; NRF-2R, CCAGCTCGACAATGTTCTCCAGC; COX-II F, CCATAGGGCACCAATGATACTG; COX-II R, AGTCGGC-CTGGGATGGCATC; cytochrome C somatic F, TTGAC-CAGCCCGGAACGAAT; and Cytochrome C somatic R,GCTATTAGGTCTGCCCTTTCTCCC.

Human primers for QRT-PCRGAPDH F, GCAGGGGGGAGCCAAAAGGGT; GAPDH R,

TGGGTGGCAGTGATGGCATGG; PGC-1� F, TGAGAGGGC-CAAGCAAAG; PGC-1� R, ATAAATCACACGGCGCTCTT;SHP F, AGGGACCATCCTCTTCAACC; and SHP R,TTCACAGCACCCAGTGAG.

Rat primers for QRT-PCRGAPDH F, TGGGAAGCTGGTCATCAAC; GAPDH R,

GCATCACCCATTTGATGTT; PGC-1� F, AGACGTGAC-CACTGACAACGAG; and PGC-1� R, TTGCATGGTT-CTGAGTGCTAAG.

AntibodiesPrimary antibodies used in this study were from Cell Signal-

ing Technology (Beverly, MA) (hemagglutinin, HA), Abcam(Cambridge, MA) (ERR�), Santa Cruz Biotechnology, Inc.,(Santa Cruz, CA) (Gal4, GST, and �-actin), Novus Biologicals(Littleton, CO) (ERR�), and Sigma (Flag). Anti-PGC-1� mousemonoclonal antibody (4C1.3) was from EMD Biosciences (SanDiego, CA) (this antibody was selected because it detects a singleband of �110 kDa and it does not detect any band in PGC-1�knockout tissues).

PlasmidsHuman (�992 to �90) and mouse (�2533 to � 78) PGC-1�

promoters were cloned in pGL3-Basic (Promega, Madison, WI)as described elsewhere (50, 51). pCMV3XHAERR� andpCMV3XHAERR� were subcloned from pcDNA3 ERR�/�into pCMV3XHA (20). Mammalian GST expression constructswere constructed by cloning respective fragments fromPCMV3XHAERR� and pGEX4TERR�LBD (25) into pEBG (agift from Bruce Mayer; Harvard Medical School, Boston, MA)(20). pMFXR was constructed by subcloning full-length humanFXR into pM vector (CLONTECH, Mountain View, CA).3XFlagFXR was a kind gift from Rayuchiro Sato (BiologicalScience Laboratories; Kao Corp., Tokyo, Japan). All the con-structs were confirmed by sequencing. Remaining plasmids usedare reported elsewhere (18, 20, 25).

Cell culture and transient transfection-basedreporter assays

All cell lines used were from American Type Culture Collec-tion (Manassas, VA) and maintained as par American TypeCulture Collection recommendations. Primary rat calvarial os-teoblast cells were cultured as described elsewhere (52). Trans-fections were carried out with lipofectamine LTX (Invitrogen).Total DNA in each transfection was adjusted to 700 ng byadding pcDNA3 empty vector. Luciferase activity was measuredin a GloMax-96 microplate luminometer (Promega) usingSteady-Glo Assay (Promega), GFP fluorescence was quantifiedin a fluorimeter (POLARstar Galaxy; BMG Labtech, Cary, NC).

RNAi, RNA isolation, RT-PCR, and QRT-PCRHuman ERR� siRNA and control siRNA (siPGL3) were

from Dharmacon (Lafayette, CO). HepG2 cells were transfectedwith 100 nM of siRNA using Dharmafect I transfection reagent(Dharmacon). RNA isolation, RT-PCR were performed as re-ported earlier (20). QRT-PCR was performed on a LightCycler480 System (Roche, Indianapolis, IN) and analyzed by ��CTmethod with GAPDH used as an internal control. To ensure thehomogeneity of the PCR products, melting curves were acquiredafter each reaction.

Protein extraction, protein-protein interactionassays, and Western blotting

These assays were performed as described elsewhere (20).

TR-FRET assayTR-FRET assays were performed in 384-well low-volume

assay plate, using lanthascreen TR-FRET assay kit (Invitrogen)in a final volume of 20 �l, as per manufacturer’s instructions,with minor modifications. Briefly, the GST-tagged ERR�LBD,



terbium-labeled anti-GST antibody, and fluorescein-labeledpeptide PGC-1� were added to indicated ligands in a white384-well assay plate for final assay concentrations of 5 nM LBD,5 nM antibody, and 0.5 �M peptide. Ligand volume was keptconstant for all wells. After 1-h incubation at 25 C, the terbiumemission at 495 nm and the FRET signal at 520 nm were mea-sured after excitation at 340 nm using a BMG FLUOstar Galaxy384 microplate reader. Data were plotted as ratio of emissionsat 495 and 520 nm.

Protein purification and isothermal calorimetryERR�LBD (amino acids 222–458) was amplified by PCR

using primers mouse ERR� F (5�-CCGGGATCCCTGAAC-CCTCAGCTGGTGCAGCCAG-3�) and mouse ERR� R (5�-GCCCTCGAGTCAGACCTTGGCCTCCAGCATTTCCA-3�)and was cloned into pGEX4T-1 at BamH1 and XhoI sites. Forprotein expression and purification, pGEX4T-1 ERR�LBD wasexpressed in Escherichia coli BL21 and purified on an affinitycolumn of glutathione-sepharose 4B (GE Healthcare Bio-Sci-ences Co., Princeton, NJ). GST was cleaved on the resin bythrombin (Calbiochem, San Diego, CA), for 12 h at 4 C. Afterincubation, ERR�LBD was eluted in 50 mM Tris-HCl (pH 8.0)and 50 mM NaCl, and its concentration was determined by theBradford method.

ITC experiments were performed on a MicroCal VP-ITCMicroCalorimeter (MicroCal, Northampton, MA) calibrated asper users protocol. Reference cell was filled with water. All ITCexperiments were conducted in 50 mM Tris-HCl buffer (pH8.0), containing 150 mM NaCl. To prepare the ligand solution,20 �l of a 10 mM compound stock in dimethylsulfoxide(DMSO) was added to 1 ml of buffer. A matched quantity ofDMSO was added to the protein sample, and the sample wasvortexed and centrifuged immediately before running the exper-iment. All solutions were degassed for 10–15 min at 20 C beforeloading the samples in the ITC cell and syringe. All titrationswere carried out at 25 C with a stirring speed of 351 rpm and180 sec spacing between each 10-�l injection of 20-sec duration.The titrand solution contained 0.2 mM of the compound DY131or GW4064, and the reaction cell contained 1.4359 ml of 5 �M

ERR�LBD. To correct for the heats of dilution, control experi-ments were performed by making identical injections of thetitrand solution into a cell containing only buffer with equalpercentage of DMSO. These control experiment values weresubtracted from their respective titration before data analysis.The fitting of ITC data to different binding models by nonlinearleast-squares approach (Levenberg-Marquardt algorithm) wasdone with MicroCal Origin software package version 7.0 (Or-igin Lab, Northampton, MA) provided with the instrument.Thermal titration data were fitted to one or more of the threeassociation models available in the software: single set of iden-tical sites, two sets of independent sites, and sequential bindingsites (53). The basic principal of these mathematical approachesare summarized elsewhere (54). The models were compared byvisual inspection of the fitted curves and by comparing the �2

values obtained after the computation. The model resulting inthe lowest value of �2 was considered the best model to describethe molecular mechanism of binding. A sequential two-sitebinding model, in which the Kd is a function of the number ofbinding sites occupied, provided a better fit to the data. Thisanalysis yielded thermodynamic parameters association con-stant (Ka) (Ka K1 and K2) and enthalpy of binding (�H1, �H2).

The free energy of binding (�G) and entropy change (�S) wereobtained using the fundamental equations of thermodynamics.

�G � �RT ln Ka (1)

Where, r � 1.9872 cal � mol�1 � K�1, T � 298 K.And

�G � �H � T�S (2)

The affinity of the ligand to protein is given as the Kd.

Kd � 1/Ka (3)

Duplicate titrations were performed for each sampleset to evaluate reproducibility.

Animal studiesAll animal experimentation described in the submitted man-

uscript was conducted in accord with accepted standards ofhumane animal care, as according to the Institutional AnimalEthical Guidelines. Mice were maintained under a standard12-h light, 12-h dark cycle with water and chow provided ad libi-tum. Eight-wk-old male BALB/C (1-d-treatment group) or 10- to12-wk-old male FXRKO and age- and sex-matched WT (3-d-treat-ment group) were given GW4064 (50 mg/kg body weight) or ve-hicle (gum acacia), by oral gavage. The animals were killed in fedcondition, tissues were isolated and used for RNA extraction.

StatisticsData are represented as mean � SD from three independent

experiments, unless otherwise indicated. Statistical analysis wasperformed using unpaired Student’s t test.

Acknowledgments

We thank Dr. Rayuchiro Sato and Dr. Bruce Mayer for kind giftof plasmids and Dr. Eckardt Treuter for critical reading of themanuscript.

Address all correspondence and requests for reprints to: Sab-yasachi Sanyal, Drug Target Discovery and Development Divi-sion, Central Drug Research Institute, Council of Scientific andIndustrial Research, Chattar Manjil Palace, Lucknow 226001,India. E-mail: [email protected].

Present address for So.S.: Department of Biotechnology, AmityUniversity, Viraj Khand 5, Gomti Nagar, Lucknow 226010, India.

This work was supported by a Grant-in-Aid project of Min-istry of Health, Government of India; Council of Scientific andIndustrial Research (CSIR) Network Projects NWP0032 andNWP0034; CSIR Grant SIP0007 (to A.B.); CSIR fellowshipgrants (S.K.D.D. and R.K.); the University Grants Commission(N.S. and J.S.M.); and CDRI communication number 8047.

Disclosure Summary: The authors have nothing to disclose.

References

1. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF,Puigserver P, Isotani E, Olson EN, Lowell BB, Bassel-Duby R,Spiegelman BM 2002 Transcriptional co-activator PGC-1� drivesthe formation of slow-twitch muscle fibres. Nature 418:797–801



2. Puigserver P, Wu Z, Park CW, Graves R, Wright M, SpiegelmanBM 1998 A cold-inducible coactivator of nuclear receptors linkedto adaptive thermogenesis. Cell 92:829–839

3. Knutti D, Kaul A, Kralli A 2000 A tissue-specific coactivator ofsteroid receptors, identified in a functional genetic screen. Mol CellBiol 20:2411–2422

4. Puigserver P, Spiegelman BM 2003 Peroxisome proliferator-acti-vated receptor-� coactivator 1� (PGC-1�): transcriptional coacti-vator and metabolic regulator. Endocr Rev 24:78–90

5. Finck BN, Kelly DP 2006 PGC-1 coactivators: inducible regulatorsof energy metabolism in health and disease. J Clin Invest 116:615–622

6. Handschin C, Spiegelman BM 2006 Peroxisome proliferator-acti-vated receptor � coactivator 1 coactivators, energy homeostasis,and metabolism. Endocr Rev 27:728–735

7. Lefebvre P, Cariou B, Lien F, Kuipers F, Staels B 2009 Role of bileacids and bile acid receptors in metabolic regulation. Physiol Rev89:147–191

8. Zhang Y, Lee FY, Barrera G, Lee H, Vales C, Gonzalez FJ, WillsonTM, Edwards PA 2006 Activation of the nuclear receptor FXRimproves hyperglycemia and hyperlipidemia in diabetic mice. ProcNatl Acad Sci USA 103:1006–1011

9. Stayrook KR, Bramlett KS, Savkur RS, Ficorilli J, Cook T, ChristeME, Michael LF, Burris TP 2005 Regulation of carbohydrate me-tabolism by the farnesoid X receptor. Endocrinology 146:984–991

10. De Fabiani E, Mitro N, Gilardi F, Caruso D, Galli G, Crestani M2003 Coordinated control of cholesterol catabolism to bile acidsand of gluconeogenesis via a novel mechanism of transcription reg-ulation linked to the fasted-to-fed cycle. J Biol Chem 278:39124–39132

11. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, MooreLB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR,Willson TM, Kliewer SA 2000 A regulatory cascade of the nuclearreceptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis.Mol Cell 6:517–526

12. Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plun-ket KD, Creech KL, Moore LB, Wilson JG, Lewis MC, Jones SA,Willson TM 2000 Identification of a chemical tool for the orphannuclear receptor FXR. J Med Chem 43:2971–2974

13. Moschetta A, Bookout AL, Mangelsdorf DJ 2004 Prevention ofcholesterol gallstone disease by FXR agonists in a mouse model.Nat Med 10:1352–1358

14. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J,Mangelsdorf DJ 2000 Molecular basis for feedback regulation ofbile acid synthesis by nuclear receptors. Mol Cell 6:507–515

15. Båvner A, Sanyal S, Gustafsson JA, Treuter E 2005 Transcriptionalcorepression by SHP: molecular mechanisms and physiologicalconsequences. Trends Endocrinol Metab 16:478–488

16. Giguere V 2008 Transcriptional control of energy homeostasis bythe estrogen-related receptors. Endocr Rev 29:677–696

17. Rangwala SM, Wang X, Calvo JA, Lindsley L, Zhang Y, DeynekoG, Beaulieu V, Gao J, Turner G, Markovits J 2010 Estrogen-relatedreceptor � is a key regulator of muscle mitochondrial activity andoxidative capacity. J Biol Chem 285:22619–22629

18. Sanyal S, Matthews J, Bouton D, Kim HJ, Choi HS, Treuter E,Gustafsson JA 2004 Deoxyribonucleic acid response element-de-pendent regulation of transcription by orphan nuclear receptor es-trogen receptor-related receptor �. Mol Endocrinol 18:312–325

19. Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM, MangelsdorfDJ 2006 Anatomical profiling of nuclear receptor expression re-veals a hierarchical transcriptional network. Cell 126:789–799

20. Sanyal S, Båvner A, Haroniti A, Nilsson LM, Lundåsen T, Rehn-mark S, Witt MR, Einarsson C, Talianidis I, Gustafsson JA, TreuterE 2007 Involvement of corepressor complex subunit GPS2 in tran-scriptional pathways governing human bile acid biosynthesis. ProcNatl Acad Sci USA 104:15665–15670

21. Duran-Sandoval D, Cariou B, Percevault F, Hennuyer N, GrefhorstA, van Dijk TH, Gonzalez FJ, Fruchart JC, Kuipers F, Staels B 2005

The farnesoid X receptor modulates hepatic carbohydrate metab-olism during the fasting-refeeding transition. J Biol Chem 280:29971–29979

22. Ma K, Saha PK, Chan L, Moore DD 2006 Farnesoid X receptor isessential for normal glucose homeostasis. J Clin Invest 116:1102–1109

23. Cariou B, van Harmelen K, Duran-Sandoval D, van Dijk TH, Gref-horst A, Abdelkarim M, Caron S, Torpier G, Fruchart JC, GonzalezFJ, Kuipers F, Staels B 2006 The farnesoid X receptor modulatesadiposity and peripheral insulin sensitivity in mice. J Biol Chem281:11039–11049

24. Wang L, Liu J, Saha P, Huang J, Chan L, Spiegelman B, Moore DD2005 The orphan nuclear receptor SHP regulates PGC-1� expres-sion and energy production in brown adipocytes. Cell Metab2:227–238

25. Sanyal S, Kim JY, Kim HJ, Takeda J, Lee YK, Moore DD, Choi HS2002 Differential regulation of the orphan nuclear receptor smallheterodimer partner (SHP) gene promoter by orphan nuclear recep-tor ERR isoforms. J Biol Chem 277:1739–1748

26. Schreiber SN, Knutti D, Brogli K, Uhlmann T, Kralli A 2003 Thetranscriptional coactivator PGC-1 regulates the expression and ac-tivity of the orphan nuclear receptor estrogen-related receptor �

(ERR�). J Biol Chem 278:9013–901827. Lanvin O, Bianco S, Kersual N, Chalbos D, Vanacker JM 2007

Potentiation of ICI182,780 (fulvestrant)-induced estrogen recep-tor-� degradation by the estrogen receptor-related receptor-� in-verse agonist XCT790. J Biol Chem 282:28328–28334

28. Coward P, Lee D, Hull MV, Lehmann JM 2001 4-Hydroxytamox-ifen binds to and deactivates the estrogen-related receptor �. ProcNatl Acad Sci USA 98:8880–8884

29. Urizar NL, Liverman AB, Dodds DT, Silva FV, Ordentlich P, YanY, Gonzalez FJ, Heyman RA, Mangelsdorf DJ, Moore DD 2002 Anatural product that lowers cholesterol as an antagonist ligand forFXR. Science 296:1703–1706

30. Burris TP, Montrose C, Houck KA, Osborne HE, Bocchinfuso WP,Yaden BC, Cheng CC, Zink RW, Barr RJ, Hepler CD, Krishnan V,Bullock HA, Burris LL, Galvin RJ, Bramlett K, Stayrook KR 2005The hypolipidemic natural product guggulsterone is a promiscuoussteroid receptor ligand. Mol Pharmacol 67:948–954

31. Dufour CR, Wilson BJ, Huss JM, Kelly DP, Alaynick WA, DownesM, Evans RM, Blanchette M, Giguere V 2007 Genome-wide or-chestration of cardiac functions by the orphan nuclear receptorsERR� and �. Cell Metab 5:345–356

32. Schreiber SN, Emter R, Hock MB, Knutti D, Cardenas J, PodvinecM, Oakeley EJ, Kralli A 2004 The estrogen-related receptor �

(ERR�) functions in PPAR� coactivator 1� (PGC-1�)-induced mi-tochondrial biogenesis. Proc Natl Acad Sci USA 101:6472–6477

33. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, MoothaV, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM 1999Mechanisms controlling mitochondrial biogenesis and respirationthrough the thermogenic coactivator PGC-1. Cell 98:115–124

34. Yu DD, Forman BM 2005 Identification of an agonist ligand forestrogen-related receptors ERR�/�. Bioorg Med Chem Lett 15:1311–1313

35. Downes M, Verdecia MA, Roecker AJ, Hughes R, Hogenesch JB,Kast-Woelbern HR, Bowman ME, Ferrer JL, Anisfeld AM, Ed-wards PA, Rosenfeld JM, Alvarez JG, Noel JP, Nicolaou KC, EvansRM 2003 A chemical, genetic, and structural analysis of the nuclearbile acid receptor FXR. Mol Cell 11:1079–1092

36. Pircher PC, Kitto JL, Petrowski ML, Tangirala RK, Bischoff ED,Schulman IG, Westin SK 2003 Farnesoid X receptor regulates bileacid-amino acid conjugation. J Biol Chem 278:27703–27711

37. Huss JM, Torra IP, Staels B, Giguere V, Kelly DP 2004 Estrogen-related receptor � directs peroxisome proliferator-activated recep-tor � signaling in the transcriptional control of energy metabolismin cardiac and skeletal muscle. Mol Cell Biol 24:9079–9091

38. de Lange P, Moreno M, Silvestri E, Lombardi A, Goglia F, Lanni A



2007 Fuel economy in food-deprived skeletal muscle: signalingpathways and regulatory mechanisms. FASEB J 21:3431–3441

39. Takahashi Y, Odbayar TO, Ide T 2009 A comparative analysis ofgenistein and daidzein in affecting lipid metabolism in rat liver.J Clin Biochem Nutr 44:223–230

40. Vollrath V, Wielandt AM, Iruretagoyena M, Chianale J 2006 Roleof Nrf2 in the regulation of the Mrp2 (ABCC2) gene. Biochem J395:599–609

41. Shimizu T, Yu HP, Suzuki T, Szalay L, Hsieh YC, Choudhry MA,Bland KI, Chaudry IH 2007 The role of estrogen receptor subtypesin ameliorating hepatic injury following trauma-hemorrhage.J Hepatol 46:1047–1054

42. Harrington WR, Sengupta S, Katzenellenbogen BS 2006 Estrogenregulation of the glucuronidation enzyme UGT2B15 in estrogenreceptor-positive breast cancer cells. Endocrinology 147:3843–3850

43. Cariou B, van Harmelen K, Duran-Sandoval D, van Dijk T, Gref-horst A, Bouchaert E, Fruchart JC, Gonzalez FJ, Kuipers F, Staels B2005 Transient impairment of the adaptive response to fasting inFXR-deficient mice. FEBS Lett 579:4076–4080

44. Holt JA, Luo G, Billin AN, Bisi J, McNeill YY, Kozarsky KF,Donahee M, Wang DY, Mansfield TA, Kliewer SA, Goodwin B,Jones SA 2003 Definition of a novel growth factor-dependent signalcascade for the suppression of bile acid biosynthesis. Genes Dev17:1581–1591

45. Song KH, Li T, Owsley E, Strom S, Chiang JY 2009 Bile acidsactivate fibroblast growth factor 19 signaling in human hepatocytesto inhibit cholesterol 7�-hydroxylase gene expression. Hepatology49:297–305

46. Kim I, Ahn SH, Inagaki T, Choi M, Ito S, Guo GL, Kliewer SA,Gonzalez FJ 2007 Differential regulation of bile acid homeostasisby the farnesoid X receptor in liver and intestine. J Lipid Res 48:2664–2672

47. Journe F, Laurent G, Chaboteaux C, Nonclercq D, Durbecq V,Larsimont D, Body JJ 2008 Farnesol, a mevalonate pathway inter-mediate, stimulates MCF-7 breast cancer cell growth throughfarnesoid-X-receptor-mediated estrogen receptor activation. BreastCancer Res Treat 107:49–61

48. Thomas AM, Hart SN, Kong B, Fang J, Zhong XB, Guo GL 2010Genome-wide tissue-specific farnesoid X receptor binding in mouseliver and intestine. Hepatology 51:1410–1419

49. Catalano S, Malivindi R, Giordano C, Gu G, Panza S, Bonofiglio D,Lanzino M, Sisci D, Panno ML, Ando S 2010 Farnesoid X receptor,through the binding with steroidogenic factor 1-responsive ele-ment, inhibits aromatase expression in tumor Leydig cells. J BiolChem 285:5581–5593

50. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM 2003 Anautoregulatory loop controls peroxisome proliferator-activated re-ceptor � coactivator 1� expression in muscle. Proc Natl Acad SciUSA 100:7111–7116

51. Daitoku H, Yamagata K, Matsuzaki H, Hatta M, Fukamizu A 2003Regulation of PGC-1 promoter activity by protein kinase B and theforkhead transcription factor FKHR. Diabetes 52:642–649

52. Bhargavan B, Gautam AK, Singh D, Kumar A, Chaurasia S, TyagiAM, Yadav DK, Mishra JS, Singh AB, Sanyal S, Goel A, Maurya R,Chattopadhyay N 2009 Methoxylated isoflavones, cajanin and iso-formononetin, have non-estrogenic bone forming effect via differ-ential mitogen activated protein kinase (MAPK) signaling. J CellBiochem 108:388–399

53. Wiseman T, Williston S, Brandts JF, Lin LN 1989 Rapid measure-ment of binding constants and heats of binding using a new titrationcalorimeter. Anal Biochem 179:131–137

54. Jelesarov I, Bosshard HR 1999 Isothermal titration calorimetry anddifferential scanning calorimetry as complementary tools to inves-tigate the energetics of biomolecular recognition. J Mol Recognit12:3–18

Become a member of The Endocrine Society and receive discounts on color and page charges

www.endo-society.org/join



Bile Acid Receptor Agonist GW4064 Regulates PPARγ Coactivator-1α Expression Through Estrogen...

Documents

Transcript of Bile Acid Receptor Agonist GW4064 Regulates PPARγ Coactivator-1α Expression Through Estrogen...