Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine...
Transcript of Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine...
![Page 1: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/1.jpg)
Aus dem Universitätsklinikum Münster
Medizinische Klinik und Poliklinik A
Direktor: Univ.-Prof. Dr. Wolfgang E. Berdel
Tumor growth inhibition by RGD peptide directed delivery of
truncated tissue factor to the tumor vasculature
INAUGURAL – DISSERTATION
Zur
Erlangung des doctor medicinae
der Medizinischen Fakultät
der Westfälischen Wilhelms Universität Münster
Vorgelegt von
Federico Ludwig Herrera Alemán
aus Tegucigalpa / Honduras
2004
![Page 2: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/2.jpg)
2
2
Gedruckt mit Genehmigung der Medizinischen Fakultät der Westfälischen
Wilhelms-Universität Münster
![Page 3: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/3.jpg)
3
3
Dekan: Univ.-Prof. Dr. H. Jürgens Berichterstatter: Prof. Dr. R. M. Mesters. Berichterstatter: Priv.- Doz. Dr. J. Vormoor Tag der mündlichen Prüfung 29.11.04
![Page 4: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/4.jpg)
4
4
Aus dem Universitätsklinikum Münster
Medizinische Klinik und Poliklinik A Direktor: Univ.-Prof. Dr.Wolfgang E Berdel
Referent: Prof. Dr. R. M. Mesters Korreferent: Priv. Doz. Dr. J. Vormoor
ZUSAMMENFASSUNG
Antivaskuläre Therapie von malignen Tumoren mittels
Fusionspolypeptiden bestehend aus Gewebefaktor und RGD Peptiden
Federico Herrera Alemán
Die selektive Aktivierung der Blutgerinnung in Tumorblutgefäßen ist ein
vielversprechender antivaskulärer Therapieansatz zur Behandlung bösartiger Tumoren.
Aus der Thrombusbildung resultiert eine konsekutive Tumornekrose. Für eine solche
Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated
tissue factor, kurz tTF, welcher die Blutgerinnung aktiviert) und Oligopeptiden
bestehen, die die selektive Bindung an Rezeptoren der Tumor-Endothelzelle vermitteln.
Das tTF-Fusionspolypeptid tTF-GRGDSP (kurz: tTF-RGD) wurde stabil exprimiert,
gereinigt, biochemisch umfassend charakterisiert und anschließend an Transplantaten
menschlicher Tumoren (humanes Lungenkarzinom, malignes Melanon) im Mausmodell
evaluiert. Die Tumoren der mit tTF-RGD Fusionsprotein behandelten Mäuse wurden im
Vergleich zu tTF oder NaCl in ihrem Wachstum signifikant gehemmt.
Histologische untersuchungen belegen den Wirkungsmechanismus der Induktion einer
selektiven Tumorgefäßthrombose mit konsekutiver Tumornekrose.
Eine relevante Organtoxizität wurde auch bei Dosen der tTF-Fusionsproteine, die das
mehrfach der therapeutisch effektiven Dosis überschrieten, weder makroskopisch noch
mikroskopisch beobachtet.
Genehmigung durch die Bezirksregierung Münster am 2000
Aktenzeichen.: 50083510; G67 / 2000
Tag der mündlichen Prüfung 29.11.04
![Page 5: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/5.jpg)
5
5
Contents :
Page
Introduction
8
Angiogenesis
• Definition of angiogenesis
• The coagulation system and angiogenesis
10
10
Angiogenesis in cancer
• Role of angiogenesis in cancer
• Regulators of tumor angiogenesis
• Metastasis
• Mediators of tumor angiogenesis
11
13
14
15
Anti-angiogenesis
• The process of anti-angiogenesis
• Anti-angiogenic treatment strategies
• Angiogenesis inhibitors
• Anti-angiogenic factors and pro-angiogenic factors
• Gene treatment approaches
17
17
19
20
22
![Page 6: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/6.jpg)
6
6
Vascular targets
• Targeting the tumor vasculature
• The αVβ3 and αVβ5 integrins as natural endothelial markers
• Recombinant fusion proteins
23
26
27
Objectives
• General objectives
30
Material and Methods
• Cell lines and antibodies
• Construction of the E coli expression vector for soluble TF
• Expression, refolding and purification of tTF and tTF -
RGD fusion proteins.
• Characterization of tTF and tTF -RGD peptide
• SDS-PAGE and western blot analyses
• Binding of tTF-RGD fusion proteins to FVIIa
• Factor X activation by tTF and tTF-RGD fusion proteins
• Binding of tTF-RGD fusion protein to its targets
• Tumor xenotransplantation models
• Histological studies
31
31
32
33
33
34
35
36
37
39
![Page 7: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/7.jpg)
7
7
Statistical Analysis
40
Results
• Functional characterisation of tTF and tTF-RGD fusion
proteins
• Factor X activation by tTF and tTF-RGD
• Binding of tTF-RGD to purified αvβ3
• Binding of tTF-RGD on endothelial cells
• Antitumor activity of tTF-RGD in murine tumor models
• Histological analyses
41
42
43
44
45
48
Discussion
52
Literature
56
Abbreviations
73
Acknowledgements
74
Curriculum Vitae 75
![Page 8: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/8.jpg)
8
8
Introduction
Angiogenesis, i.e., the proliferation of new blood vessels from preexisting
ones, is a characteristic feature of aggressive solid tumors (Folkman et al,
1989). Molecules capable of inhibiting angiogenesis or of selectively
targeting and destroying new blood vessels, would be promising agents for
the treatment of angiogenesis-related diseases.
Tissue factor (TF) is a cell-surface glycoprotein and a major initiator of
blood coagulation. At sites of injury, blood comes in contact with the
membrane-bound TF, which forms a complex with the serine protease
FVIIa present in blood.
The resulting complex activates factors IX and X, which leads to thrombin
activation and ultimately to blood clotting. Truncated tissue factor (tTF)
consisting of only the extra cellular soluble domain (residues 1–219),
exhibits an ability to activate the clotting cascade in solution that is five
orders of magnitude lower than full length tissue factor incorporated in a
phospholipid membrane. When tTF is relocated to a phospholipid
membrane, tTF regains full activity like native tissue factor.
New approaches are targeting not the tumor cells but the endothelial cells
on tumors. Vascular targeting requires the identification of target molecules
that are present at sufficient density on the surface of vascular endothelium
in solid tumors but absent from endothelial cells in normal tissues. Such
molecules could be used to target cytotoxic agents to the vascular
endothelium of the tumor rather than to the tumor cells themselves.
Promising candidate molecules include bFGF (basic fibroblast growth
factor), VEGF (vascular endothelial growth factor) and VEGF receptor 2
![Page 9: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/9.jpg)
9
9
(VEGFR-2), endoglin, endosialin, a fibronectin isoform (ED-B domain),
the integrins αVβ3, αVβ5, α1β1, α2β1, amino peptidase N, NG2 proteoglycan
and the matrix metalloproteinases 2 and 9 (MMP 2 and 9) (Dvorak et al,
1991 and 1995; Burrows et al, 1995; Carmemolla et al, 1989; Arap et al,
1998; Bhagwat et al, 2001; Burg et al, 1999; Kessler et al 2002; Morrissey
et al, 1993; Olson et al, 1997; Rettig et al, 1992; Sengeer et al, 1997;
Pfeifer et al, 2000).
A novel approach to cancer therapy based on targeting of the human
coagulation-inducing protein tTF to tumor vasculature has recently been
proposed ( Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al,
2002; Peisheng et al, 2003). The approach is based on the concept that
thrombosis of tumor vessels may stop the supply of nutrients and oxygen to
tumor cells, thereby causing their death.
The targeted delivery of tTF would be of significant therapeutic relevance if
it is directed against a naturally occurring marker of tumor angiogenesis,
and if it mediates the selective thrombosis of tumor blood vessels
sufficiently to inhibit the tumor growth or to generate tumor infarction.
In this work we show that a protein consisting of the RGD peptide fused to
tTF mediates the selective tumor growth inhibition of two different types of
solid human tumors; the lung cancer (CCL185) and the malignant
melanoma (M21) in murine tumor models.
![Page 10: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/10.jpg)
10
10
Angiogenesis
Angiogenesis is defined as a process of vascular neoformation out of
existing ones, that occurs during development, menstruation and several
pathological conditions such as rheumatoid arthritis, age-related macular
degeneration, proliferative retinopathies, and psoriasis as well as tumor
growth and metastasis. Compensatory angiogenesis is demonstrated in the
formation of collateral blood vessels when there is oxygen or nutrient
deprivation in normal tissues. Despite the fact that angiogenesis refers to
the derivation of blood vessels of all types (micro and macro vessels), the
term is usually restricted to the neoformation of capillary blood vessels.
Angiogenesis requires the coordinated activation of genes that are
responsible for proliferation, migration and differentiation of endothelial
cells to form capillary-like structures. The activation of these genes is
thought to occur through paracrine factors also, the genes activated by
these factors encode autocrine/intracrine secondary regulators, proteolytic
enzymes, and molecules that are direct downstream substrates of
endothelial cytokine receptors (Bikfalvi, 1995).
The coagulation system and angiogenesis
Angiogenesis is the process of sprouting and configuring new blood vessels
from pre-existing blood vessels, whereas the haemostatic system maintains
the liquid flow of blood by regulating platelet adherence and fibrin
deposition. Both systems normally appear quiescent. With vessel injury, a
rapid sequence of reactions must occur to occlude the vessel wall defect
and prevent hemorrhage. Activated platelets link the margins of the defect
![Page 11: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/11.jpg)
11
11
and form a provisional barrier that is quickly enmeshed with polymerized
fibrin. This clot structure initially requires immobilized vascular
endothelial cells to anchor the clot and prevent further bleeding. Thereafter,
endothelial cells at the clot margins become mobile, dismantling and
invading the cross-linked fibrin structure to rebuild a new vessel wall.
Although the positive and negative regulators that control the delicate
balance of platelet reactivity and fibrin deposition have been elucidated
over the past four decades, analogous proteins that control endothelial cell
growth and inhibition have only been discovered within the past decade.
Hemostasis and angiogenesis are becoming increasingly inter-related
pathways generated by the haemostatic system, coordinating the spatial
localization and temporal sequence of clot / endothelial cell stabilization
followed by endothelial cell growth and repair of a damaged blood vessel.
To date, a limited number of these proteins have been identified (Browder
et al, 2000).
Role of angiogenesis in cancer
Angiogenesis performs a critical role in the development of cancer, solid
tumors smaller than 1 to 2 cubic millimeters are nor vascularized to spread,
they need to be supplied by blood vessels that bring oxygen and nutrients
and remove metabolic wastes.
New blood vessel development is an important process in tumor
progression. It favors the transition from hyperplasia to neoplasia i.e. the
passage from a state of cellular multiplication to a state of uncontrolled
proliferation characteristic of tumor cells.
![Page 12: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/12.jpg)
12
12
100 years ago researchers observed that angiogenesis occurs around tumors
(Kerbel et al, 2000; Algire et al, 1945).
In 1971 it was proposed that tumor growth beyond 1 to 2 mm in size and
metastasis are angiogenesis dependent and hence blocking angiogenesis
could be a strategy to arrest tumor growth (Folkman, 1971and 1990), thus
tumor cells that undergo the phenotypic switch are able to induce changes
in endothelial cells, leading to angiogenesis and to a growing tumor
(Polverini, 1996).
Tumor cells and infiltrating cells such as macrophages and fibroblasts
activate the endothelial cells, thus initiating angiogenesis by expressing
factors such as VEGF and bFGF. Once neovascularization occurs, the
tumor experience rapid growth and an increased metastatic potential (Poon
et al, 2001; Mattern et al, 1996; Toi et al, 1994).
Angiogenesis involves a series of steps, including endothelial cell
proliferation, differentiation, migration, and organization to form tubules
(Dvorak et al, 1995), because of this stepwise process anti-angiogenic
therapy can be developed against any of several steps in the process and
can be used to stop or to inhibit pathologies that involves such processes
(Lee, 2002).
Recent data strongly suggest an important role of angiogenesis in
hematological malignancies. Thus anti-angiogenic therapy could constitute
a novel strategy not only for the treatment of solid tumors or inflammatory
disorders but also malignancies like acute myeloid leukemia (Padró et al,
2000; Mesters et al, 2001).
![Page 13: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/13.jpg)
13
13
Regulators of tumor angiogenesis
At the site of vessel injury, adhered platelets secrete both positive and
negative regulators of angiogenesis, mainly from internal α granules.
The positive regulators include: vascular endothelial growth factor-A
(VEGF-A), vascular endothelial growth factor-C (VEGF-C), basic
fibroblast growth factor (bFGF), hepatocyte growth factor (HGF),
angiopoietin-1, insulin-like growth factor-1 and –2 (IGF-1-2), epidermal
growth factor (EGF), platelet-derived growth factor (PDGF) and
sphingosine 1 phosphate (Mohle et al, 1997; Wartiovaara et al, 1998;
Brunner et al, 1993; Nakamura et al, 1986; Karey et al, 1989; Ben-Ezra et
al, 1990; Hwang et al, 1992; Bar et al, 1989; Lee et al, 1999).
Numerous investigators have evaluated the presence of angiogenic peptide,
in particular bFGF and VEGF in clinical body fluids in an effort to explore
the usefulness of these measurements as potential clinical parameters. Most
of these studies are exploratory and suggest a correlation between
detectable levels of these peptides and clinical outcome.
There was a relatively good correlation between serum but not urinary
bFGF levels and tumor stage or grade in a small number of patients with
renal cell carcinoma (Rippmann et al, 2000). More recently, a significant
over expression of VEGF and its cellular receptor KDR (VEGFR-2) and
bFGF in the bone marrow of patients with acute myeloid leukemia was
found (Padró et al, 2002; Bieker et al, 2003).
An increased presence of matrix metalloproteinases (MMPs) may be
related to increased invasive, metastasis, and angiogenic potential of
tumors.
![Page 14: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/14.jpg)
14
14
The hepatocyte growth factor (HGF) secretes also negative regulators that
suppress the inducement of angiogenesis. The anti-angiogenic HGF
fragments consisting of either the NK1 or NK2 cringle domains suppresses
HGF induced endothelial cell migration. This anti-angiogenic fragments
inhibit tumor growth in vivo by increasing tumor cell apoptosis without
affecting the proliferation rate of tumor cells (Date et al, 1998).
Thrombospondin (TSP-1) re-adjusts growth factor and integrin signaling
pathways between endothelial cells and the fibrin clot and prevent
endothelial cell motility induced by fibrin, also blocks the chemotactic
response of endothelial cells to bFGF (Good et al, 1990).
Plasminogen activator inhibitor type 1 (PAI-1), alpha 2 antiplasmin and
alpha 2-macroglobulin suppress angiogenesis by limiting plasmin
generation within the clot structure (Blei et al, 1993).
Metastasis
New blood vessel development is an important process in tumor
progression. Neovascularization also influences the dissemination of cancer
cells throughout the entire body eventually leading to metastasis formation.
It has been suggested in the past that the growth of primary solid tumors is
strictly dependent on their ability to induce angiogenesis from the
surrounding vasculature, so that tumor progression including invasion and
metastasis, involves the different phases pre-vascular and vascular
(Gimbrone et al, 1972).
It has been also observed that removal of primary tumor can be followed by
a rapid onset of metastasis. This would suggest that a primary tumor can
![Page 15: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/15.jpg)
15
15
inhibit its metastasis growth, then the switch to an angiogenic phenotype
depends upon the net balance of angiogenic stimulators and inhibitors.
The development of metastasis is then greatly influenced by angiogenesis
(Bikfalvi, 1995). Also since primary tumor growth is often controlled with
surgery and/or irradiation, anti-angiogenic agents may be most beneficial in
the treatment of widespread metastasis disease. However, several principles
must be understood; anti-angiogenic therapy may need to be delivered on a
chronic basis since this type of therapy is not cytotoxic but rather only
prevents further growth of a tumor.
Secondly, the endpoint of anti-angiogenic therapy would not be tumor
shrinkage, but rather tumor stabilization (Ellis et al, 1996), recognizing that
angiogenesis is one step in the multistep process of metastasis (Fidler et al,
1994).
Some researchers selectively targeted tumor blood vessels in vivo, using
artificial or naturally occurring markers of angiogenesis with results of
therapeutic relevance (Huang et al, 1997; Ran et al, 1998; Nilsson et al,
2001; Liu et al, 2002; Peisheng et al, 2003).
Also it has been assumed that anti-angiogenic therapy of any type might
have to be delivered for the rest of a patient’s life, or at least for many years
(Boehm et al, 1997).
Mediators of tumor angiogenesis
A large number of angiogenic factors produced by tumor cells themselves
and by accessory host cells such as macrophages, mast cells and
lymphocytes have been identified.
![Page 16: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/16.jpg)
16
16
Recent attention has been focused on members of the fibroblast growth
factors (FGF) and vascular endothelial growth factors (VEGF) families as
the most common tumor angiogenic factors (Fernig, 1994; Dvorak et al,
1995; Claffey et al, 1996), (See table 1).
These cytokines stimulate migration and proliferation of endothelial cells
(ECs). The biological effect of VEGF is mediated by the binding to two
different receptors, VEGFR-1 (flt-1) and VEGFR-2 (flk-1/KDR), that are
mainly expressed on ECs (Terman et al, 1996).
Recently, neuropilin 1 has been identified as a third VEGF receptor that
exclusively binds to the VEGF165 splice variant and modulates binding of
VEGF to VEGFR-1 and VEGFR-2 (Soker et al, 1990). VEGF and its
receptors are over expressed in the vast majority of human tumors.
The importance of VEGF is underscored by the fact that blocking of VEGF
function results in suppression of angiogenesis and growth of a variety of
tumors in vivo (Kim et al, 1993; Millauer et al, 1994; Warren et al, 1995;
Cheng et al, 1996; Millauer et al, 1996; Skobe et al, 1997).
Integrins have been identified as additional key molecules of tumor
angiogenesis. These integrins play a pivotal role in mediating cell to cell
and cell to matrix interactions, essential components for tumor
angiogenesis and metastasis (Brooks et al, 1994a and 1994b; Yun et al,
1996; Senger et al, 1997; Ruegg et al, 1998).
Certain integrins (e.g. αVβ3, αVβ5 and others) are specifically and
selectively expressed on the tumor vasculature in high density, but outside
![Page 17: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/17.jpg)
17
17
of the female reproductive tract these integrins are not expressed under
physiological conditions on ECs.
The process of anti-angiogenesis
Based on observations that expansion of a tumor mass was limited in the
absence of angiogenesis, considerable experimental supporting evidence
for this concept has been assembled from inhibition of angiogenesis by:
• Mechanical separation of tumor cells from their nearest vascular bed
(Gimbrone et al, 1972)
• Blockade of tumor-derived angiogenic factors (Kim et al, 1993)
• Administration of angiogenesis inhibitors (Boehm et al, 1997)
• Endogenous production of angiogenesis inhibitors from tumor cells
(Bouck, 1990; Cao et al, 1998).
• Demonstration of the pre angiogenic phenotype in spontaneous
tumors (Hanahan et al, 1996).
Anti-angiogenic treatment strategies
The principal target for anti-angiogenic therapy is represented by
proliferating ECs, which with the exception of the female reproductive tract
are in a quiescent state in normal tissues.
![Page 18: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/18.jpg)
18
18
Only one of 10.000 ECs (0,01%) is in cell division at a certain point
(Engerman et al, 1967; Hobson et al, 1984).
As a response to a certain stimulus ECs leave the quiescent state and
proliferate as fast as haematopoietic cells from the bone marrow or
epithelial cells from the mucosa of the gastrointestinal tract.
Based on the current knowledge of angiogenesis, which is a complex
process of EC proliferation, selective degradation of the basement
membrane, extracellular matrix and subsequent EC migration (Folkman et
al, 1992).The following anti-angiogenic strategies are currently under
investigation:
• Interfering with receptor binding or activation of a particular
angiogenic factor.
• Inhibiting the release of a particular angiogenic factor by tumor cells.
• Enhancing the production or action of an angiogenic inhibitor.
• Being similar or identical to a particular angiogenic inhibitor.
• Interfering with signal transduction processes in an autocrine /
intracrine activation of capillary endothelial cells.
• Inhibiting the matrix degradation by protease matrix degrading
enzymes (Bikfalvi, 1995; Sato et al, 1990).
![Page 19: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/19.jpg)
19
19
Angiogenesis inhibitors
Numerous angiogenic inhibitors have been identified (Hagedorn et al,
2000) and many are now in clinical trials. Whereas some agents, such as
antibodies to VEGF and VEGFR2, continue to show promise, a few drugs
have proved disappointing (Coussens et al, 2002).
Nevertheless, there is still intense interest in angiogenesis inhibitors as
future clinical tools and much work is in progress (Novak, 2002).
There are two classes of angiogenesis inhibitors “direct and indirect”:
• Direct angiogenesis inhibitors, such as vitaxin, angiostatin and
others, prevent vascular endothelial cells from proliferating,
migrating or avoiding cell death in response to a spectrum of pro-
angiogenic proteins, including VEGF, bFGF, IL-8 and platelet-
derived growth factor (PDGF).
• Indirect angiogenesis inhibitors generally prevent the expression of
or block the activity of a tumor protein that activates angiogenesis
also blocking the expression of its receptor on endothelial cells.
Direct angiogenesis inhibitors are the least likely to induce acquired drug
resistance, because they targeted genetically stable endothelial cells rather
than unstable mutating tumor cells. (See table 1).
![Page 20: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/20.jpg)
20
20
Pro-angiogenic factors Anti-angiogenic factors
Angiogenin Angiostatin (plasminogen fragment)
Angiopoetin-1 Endostatin (collagen XVIII fragment)
Del-1 Cartilage-derived inhibitor (CD1)
Fibroblast growth factor, acidic (bFGF) CD59 complement fragment
Antiangiogenic antithrombin III Fibronectin fragment
Fibroblast growth factor, basic (bFGF) Gro-beta
Follistatin Heparinases
Transforming growth factor beta (TGF- ß)
Granulocyte colony-stimulating factor (G-
CSF)
Heparin hexasaccharide fragment
Hepatocyte growth factor (HGF) Human chorionic gonadotropin (hCG)
Interleukin-8 (IL-8) Interferon inducible protein (IP-10)
Leptin Interferon alpha, beta, gamma
Midkine Interleukin 12 (IL-12)
Placental growth factor (PiGF) Cringle 5 (plasminogen fragment)
Platelet-derived endothelial cell growth
factor (PD-ECGF)
Tissue inhibitors of metalloproteinases (TIMPs)
Platelet-derived growth factor-BB(PDGF-
BB)
2-Methoxyestradiol
Pleiotrophin (PTN) Placental ribonuclease inhibitor
Proliferin Plasminogen activator inhibitor
Transforming growth factor-alpha (TGF-
alpha)
Platelet factor 4 (PF4)
Transforming growth factor beta (TGF-beta) Prolactin 16kD fragment
Tumor necrosis factor-alpha (TNF-a) Retinoids
Vascular endothelial growth factor (VEGF) Tetrahydrocortisol-S
Thrombospondin-1 (TSP-1)
Vasculostatin
Vasostatin (calreticulin fragment)
Table 1 Pro-angiogenic and Anti-angiogenic factors.
![Page 21: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/21.jpg)
21
21
In this way two approaches have been adopted: first, the use of antibodies
to either VEGF or VEGF receptors, and second, the development of
specific inhibitors of the VEGF receptor tyrosine kinase.
Ferrara and colleagues were the first to show that antibodies to VEGF
slowed tumor growth (Kim et al, 1993), and humanized forms are now in
Phase III clinical trials for the treatment of solid tumors.
Because of the difficulties and expense of using biological agents in the
clinic, others set out to identify low-molecular-weight inhibitors of the
tyrosine kinase activity of KDR (VEGFR2 in humans), also with promising
results in hematological malignancies.
In this way several compounds have been identified and are undergoing
clinical evaluation (Bikfalvi et al, 2002; Mesters et al, 2000).
Inhibitors of the KDR VEGF receptor tyrosine kinase Developer Compound Clinical stage
Pharmacia (Sugen) SU101 No longer in
development
Pharmacia (Sugen) SU5416 No longer in
development
Pharmacia (Sugen) SU6668 Phase II
AstraZeneca ZD4190 Phase II
Novartis PTK787ZK222584 Phase II
![Page 22: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/22.jpg)
22
22
Gene treatment approaches in anti-angiogenesis
Based on inhibition of angiogenesis by gene therapy Lin et al, used an
adenoviral vector to deliver a recombinant Tie2 receptor (tirosine kinase
receptor) that blocked activation of the Tie2 receptor on endothelial cells.
Most important, delivery of the soluble Tie2 receptor-adenoviral construct
at the time of surgical excision of primary tumors also inhibited subsequent
metastasis growth, demonstrating that gene therapy directed against the
Tie2 receptor on endothelial cells will inhibit tumor angiogenesis (Lin et al,
1998).
Goldman et al, reported the use of an ex vivo gene transfer method to
transfect stable human tumor cells with the cDNA encoding a truncated
form of native soluble FLT-1, a receptor for the angiogenic factor VEGF.
Soluble FLT-1 inhibited VEGF function (Goldman et al, 1998).
Moreover, researchers have to consider the local vs. systemic anti-
angiogenic gene therapy, and direct vs. indirect anti-angiogenic gene
therapy (Folkman, 1998).
Also, combinations of angiogenesis inhibitors and conventional cytotoxic
chemotherapy cured tumors in mice when either therapy alone could not
accomplish this (Teicher et al, 1994).
![Page 23: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/23.jpg)
23
23
In the future, systemic anti-angiogenic therapy may be used:
• After surgery or after radiotherapy to prevent recurrence of distant
metastases.
• In combination with conventional chemotherapy
• In combination with vaccine therapy or immunetherapy
• In combination with others types of gene therapy, for example delivery
of tumor suppressor genes.
Vascular targets
Two types of vascular target agents (VTAs) are currently being developed
for cancer treatment:
a) The ligand-directed VTAs, which use antibodies and peptides to
target toxins, pro-coagulants, and pro-apoptotic effectors to tumor
endothelium.
b) The small molecules that do not specifically localize to tumor
endothelium, but which exploit pathophysiological differences
between tumor and normal tissue endothelia to induce selective
occlusion of tumor vessels (Ching et al, 1999), (See table 2).
![Page 24: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/24.jpg)
24
24
Vascular targeting of malignant tumors has been shown to be a new
potential approach for the treatment of cancer (Huang et al, 1997), and
some of the advantages over conventional anti-tumor cell therapies are:
1. target antigen is directly accessible, and penetration of drugs
through the tumor tissue, which has been defined as a major
problem in the treatment of solid tumors is not
necessary.(Baxter et al, 1989; Fujimori et al, 1989; Jain,
1990).
2. There is a potentiation effect because the killing of one
endothelial cell results in the death of thousands of tumor cells
(Denekamp, 1990), and the coagulation process is a cascade in
which one molecule of initiating coagulation factors results in
the generation of millions of molecules fibrin per minute.
3. The target cells are unlikely to acquire genetic mutations and
to develop a drug resistance (Boehm et al, 1997).
The same targeted drug can be used for a variety of solid tumors because
the target antigen should be present in many different tumors, also a
surrogate marker of biological activity (i.e., blood flow) is measurable in
the clinic and temporary effects on vascular function may be sufficient.
Studies indicate that > 99 % of tumor cells in vivo can be killed during a 2-
hrs period of ischemia (Chaplin et al, 1994).
![Page 25: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/25.jpg)
25
25
Finally, unlike angiogenesis inhibitors, VTAs should require only
intermittent administration to synergize with conventional treatments rather
than chronic administration over months or years.
VTA approach Compound Comments
Ligand-directed Antibody-TF
Anti-VCAM1-TF
L19 scFv-TF
TF induces coagulation
VCAM-1 is a cell adhesion marker
L19 scFv targets fibronectin ED-B
domain
VEGF-gelonin
Anti-endoglin linked to ricin A
Anti-TES-23 linked to
Neocarzinostatin
L19 scFv-IL-12
L19 scFv-TNF-a
Anti-PS
Targeted ATPµ-Raf gene
DNA encoding Flk-1 fused
to Fas
Gelonin is a plant toxin
Antibody-toxin
Antibody-cytotoxic
Antibody-cytokine
Antibody-cytokine
Naked antibody
Gene therapy, blocks signaling
Gene therapy, induces apoptosis
Small molecules CA4P
ZD6126
AVE8062A
Oxi4503
DMXAA
Phosphate prodrug of CA4P
Phosphate prodrug of N-
acetylcolchinol
Combrestastatin analogue
Combrestastatin analogue
Flavonoid
Table 2. Philip Thorpe et al, The first International Conference on Vascular Targeting:
Meeting Overview.
![Page 26: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/26.jpg)
26
26
THE αVβ3 and αVβ5 integrins as natural endothelial markers
In the past decade, many molecules have been described to be up-regulated
on angiogenic endothelial cells, which can in theory be therapeutically
exploited (Schraa et al, 2002).
Some of these molecules are the integrins αVβ3 and αVβ5, which recognizes
RGD (Arg-Gly-Asp) motifs in extracellular matrix components (Brooks et
al, 1994a), and are essentially absent from the normal tissues of an adult
animal and are also selectively up-regulated in angiogenesis related
diseases.
Several members of the integrin family of adhesion receptors are expressed
on the surface of cultured smooth muscle and endothelial cells. Among
these integrins is αVβ3, the endothelial cell receptor for vitronectin, von
Willebrand factor, fibrinogen and fibronectin (Cheresh, 1987).
Cheresh showed that in both human and chick, blood vessels involved in
angiogenesis have enhanced expressions of αVβ3, playing a key role in
angiogenesis and suggesting that integrin αVβ3 will be a therapeutic target
for diseases characterized by neovascularization (Brooks et al, 1994a).
The αVβ3, αVβ5, α5β1 and other integrins are each up-regulated in
angiogenic vessels and play a role in angiogenesis (Eliceiri et al, 1999).
In the fetus, α5β1 is necessary for the development of the vasculature (Yang
et al, 1993), whereas fetal or adult angiogenesis can occur without the αV
integrins.
![Page 27: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/27.jpg)
27
27
However, αVβ3 and αVβ5 are somehow important in adult angiogenesis
because peptides and antibodies that perturb their function block
angiogenesis (Ruoslahti, 2002).
Recombinant fusion proteins
General advantages of recombinant fusion proteins are:
1 Easy production of defined homogeneous proteins
2 Protein engineering can be performed on the DNA level
3 The constructs can be produced as entirely human proteins, which
addresses the previously described problem of immunegenicity
(Kuus-Reichel et al, 1994).
4 Easy experimentation on mice.
The anti-tumor efficacy of tTF targeted to tumor vessels has already been
proved; Huang et al, 1997, targeted the TF molecule to a class II antigen in
a mouse neuroblastoma model through a bispecific antibody, transfecting
first the mice with the IFN-y gene, to generate the expression of MHC class
II antigens on the tumor vascular endothelium in mice.
To target tTF to tumor vascular endothelium, a mixture of tTF and the
bispecific F(ab´)2 antibody was injected in tumor allografted mice. The
binding of tTF to MHC class II antigen on endothelial cells induced
selective coagulation activation with tumor infarction.
The treatment induced thrombosis of tumor vessels with 38% of complete
regression. (Huang et al, 1997).
![Page 28: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/28.jpg)
28
28
One year later Sophia Ran et al, from the same group used a coaguligand
consisting of a monoclonal antibody to murine VCAM-1 (vascular cell
adhesion molecule-1) covalently linked to tTF. By antibody directed
targeting of tTF to the tumor vasculature selective infarction of solid
Hodgkin's tumors in mice was mediated.
The treatment induced thrombosis of tumor vessels and retarded tumor
growth, complete tumor regression was not observed. A 50% reduction in
tumor growth occurred, although VCAM-1 was present only in a minority
of vessels (larger vessels within the tumor mass) (Ran et al, 1998).
Dario Neri et al, used a similar approach by fusing an antibody fragment
(scFv) specific for the oncofetal ED-B domain of fibronectin to tTF. The
fusion protein mediated the complete and selective infarction of three
different types of solid tumors in mice.
In this approach 30% of mice exhibited a complete tumor regression in a
single dose treatment, but showing also signs of toxicity and the animals
were not cured (Nilsson et al, 2001).
Liu C et al, coupled tTF to an inhibitor of prostate-specific membrane
antigen. This protein induced selective local in vivo infarctive necrosis of
the rat Mat Lu prostate tumor when administered intravenously (i.v.).
The combined administration of this fusion protein with low-dose
doxorubicin produced a profound tumoricidal effect, resulting in complete
eradication of some tumors (Liu et al, 2002).
Another group induced extravascular coagulation targeting a highly
selective tumor stroma associated marker, they constructed a fusion protein
comprising of a single-chain molecule of a fibroblast activation protein
![Page 29: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/29.jpg)
29
29
(FAP)-specific humanized antibody [single chain fragment
variable(scFv)OS4] and the extra cellular domain of human tissue factor.
The fused protein scFv-tTF targeted to FAP induced an extravascular
coagulation of the tumor stroma in an antigen-specific manner (Rippmann
et al, 2000).
Recently P. Hu et al 2003, generated three MAb fusion proteins that
selectively block the blood flow to tumors by targeting different antigens;
the first one the RGD/tTF, targets endothelial αVβ3 and αVβ5 integrins
exposed on tumor vessels, the second fusion protein, chTV-1/tTF, targets a
vessel antigen, fibronectin, which is located in the basement membrane of
vessels and the third fusion protein, chTNT-3/tTF, targets necrotic regions
of the tumor in which conserved and abundant intracellular antigens are
exposed in degenerating cells.
![Page 30: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/30.jpg)
30
30
OBJECTIVES
The present study focuses on the fact that the human coagulation inducing
protein tissue factor, is the major initiator of blood coagulation. The aim of
this work was to investigate the feasibility of treating human solid tumors
by selective delivery of human truncated tissue factor fused to RGD
peptide sequences to the tumor vascular endothelium in a mouse model, as
a new approach for cancer therapy.
The objectives are:
To demonstrate that the tTF-RGD fusion proteins selectively induce
coagulation in the tumor vasculature in an animal model.
To demonstrate the anti-tumor activity of tTF-RGD fusion proteins in a
mouse xenotransplantation model.
To demonstrate that the selective thrombosis of treated solid tumors in our
approach should lead to regression and inhibition of tumor growth.
To demonstrate the safety of this anti-vascular treatment strategy.
![Page 31: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/31.jpg)
31
31
Material and methods
Cell lines and antibodies:
Lung cancer cell line (CCL185) were described earlier (Topp et al, 1993)
and the melanoma tumor cell line (M21) as described was kindly provided
by Dr. Silletti, University of California San Diego (USA)(Felding-
Habermann et al, 1992). Anti-tTF was obtained by Diagnostic international
(Karlsdorf, Germany), Integrin αVβ3 and GRGDSP-peptide was obtained
by Chemicon (Temecula, California, USA). Anti-Histag antibody (Santa
Cruz Biotechnology).
Construction of the E. coli expression vector for soluble TF (truncated
TF [tTF1-219])
The c-DNA coding for tTF1-219 and tTF1-219-GRGDSP (short tTF-RGD) was
amplified by polymerase chain reaction (PCR) using the primers :
5‘CATGCCATGGGATCAGGCACTACAAATACTGTGGCAGCATATA
AT.3‘(5‘Primer)5‘CGGGATCCTATTATCTGAATTCCCCTTTCTCCTG
GCCCAT3‘(3`Primer) for tTF and 5‘CATGCCATGGGATCAGGCACTA
CAAATACTGTGGCAGCATATAAT3‘(5‘Primer)5’CGGGATCCTATT
ATGCATGTGCTCTTCCGTTACCTCTGAATTCCCC-3’(3‘-Primer) for
tTF-RGD (primers from Oligofactory PE Applied Biosystems Germany).
The RGD sequence was ligated to the carboxyl terminus of the tTF. This
would allow the tTF-RGD to adopt an orientation perpendicular to the
![Page 32: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/32.jpg)
32
32
phospholipid membrane of the cell similar to native tissue factor (Banner et
al, 1996).
On the other hand, ligation of the peptide to the carboxyl terminus of tTF
should not result in a sterical hindrance for the interaction of tTF and its
substrate FX.
Expression, refolding and purification of tTF1-219 and tTF1-219 RGD
peptide.
With the DNA-Ligation Kit (Novagen, Madison, Wisconsin, USA), the
cDNA were cloned into the expression vector pET-30(+)a (Novagen),
using the Bam H 1 and NCO I restriction sites of the vector.
The vectors were introduced into competent Escherichia coli cells (BL21
DE3) according to the manufacturers protocol (Novagen).
After stimulating with IPTG (Novagen) the cells were harvested and 5-7 ml
lysis buffer (10 mM Tris-HCl, pH 7,5; 150 mM NaCl; 1 mM MgCl2; 10
µg/ml Aprotinin; 2 mg/ml Lysozym) per gram wet weight and 20 µl
Benzonase (Novagen) were added to the pellet.
Then the cells were incubated for 90 minutes at RT and centrifuged at
12,000 g for 20 min at 4°C. The pellet was resuspended and homogenized
by sonicating in washing buffer (10 mM Tris/Hcl, pH 7,5; 1 mM EDTA;
3% Triton X-100).
To solubilize the inclusion bodies, 2-4 ml Guanidinium buffer (6 M GuCl;
0,5 M NaCl; 20 mM NaH2PO4; 1 mM DTT) per gram wet weight was
added. After incubation over night at RT, the suspension was centrifuged at
![Page 33: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/33.jpg)
33
33
5,000g for 30 min at 4°C. The supernatant was filtered through a 0,22 µm
filter.
Purification and refolding was done with the His Bind Buffer Kit
(Novagen) according to the manufacturers protocol. To remove the salt, the
suspension was dialyzed in a Slide-A-LyzerR 10 K dialysis cassette
(Pierce, Rockford, Illinois, USA) against TBS buffer.
Characterization of tTF1-219 and tTF1-219 RGD peptide
For chemical characterization, sequences of the coding cDNA in the
expression plasmids are confirmed in an automatic sequencer equipped
with laser and CCD-camera (ABI PRISM 310, Perkin Elmer). N-terminal
amino acid sequences of proteins are confirmed by Edman degradation and
amino acid analyses is performed additionally ( Applied Biosystems
Sequencer Model 477A and AS-Analyzer 120A). Subsequently,
SDS/PAGE and Western Blot analyses are carried out with antibodies
against tTF
SDS-PAGE and Western blot analysis
The purified tTF-RGD fusion proteins were analysed by SDS-PAGE as
described above.The presence of the tTF moiety for each fusion protein
was further confirmed by western blotting analyses.
The protein samples were diluted trying to obtain a similar concentration
between them. Using a precision protein standard (Bio-rad) the
electrophoresis was runned at 120 volts and later stained with Gel code
![Page 34: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/34.jpg)
34
34
blue stain reagent (PIERCE). The tTF-RGD fusion proteins in the SDS-
PAGE gel (ready gel Bio-rad, 4°C) were transferred to a PVDF membrane
overnight at 30 volts and 90 mA.
To identify those bands containing the tTF and tTF-RGD fusion proteins,
the protein immunoblotting (Opti-4CN amplified, Bio-Rad) was done
incubating the fusion proteins with a primary antibody (anti-Histag Santa
Cruz biotechnology) biotin conjugated and a HRP antibody (streptavidin
HRP).
Tumor endothelial cells
Figure 1. Schematic
representation of the binding of
the fusion protein tTF-RGD, to
avß3-integrin.
This receptor is selectively
expressed in high density on tumor
endothelial cells, but with few
exceptions not in quiescent
endothelial cells in normal tissues.
Binding of tTF1-219 and tTF1-219 RGD peptide to FVIIa
The apparent dissociation constant (Kd) for the interaction of the tTF
constructs with FVIIa are calculated employing a published method based
on the amidolytic activity of the tTF:VIIa complex towards the
chromogenic substrate Spectrozyme Factor Xa (American Diagnostica)
(Ruf et al, 1991a and b).
Into each well of a microtiter plate the following reagents are added: a) 26
µl 0.05 M Tris/HCl, 0.15 M NaCl, pH 7.4, 0,1 % bovine serum albumin
![Page 35: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/35.jpg)
35
35
(TBS-BSA). b) 26 µl tTF 1-219 and the tTF 1-219-RGD peptide, respectively,
diluted in TBS-BSA in concentrations ranging from 300 pM to 25 µM and
c) 26 µl 8 nM recombinant FVIIa (Novo-Nordisk) in TBS-BSA. After 15
min at RT, 26 µl of Spektrozyme Factor Xa are added and the initial
reaction is monitored by change in absorption at 405 nm on a microplate
reader (Bio-Rad, Hercules, California, USA).
Rates are converted into concentrations of tTF:VIIa. On the basis of
calculated free and bound ligand, the apparent Kd is determined by fitting
these data to the single-site-binding equation:
(number of bindings sites x [free ligand]) [Bound ligand] = ________________________________________
([free ligand] + Kd)
Factor X activation by tTF and tTF-RGD
The ability of tTF and tTF-RGD to enhance the specific proteolytic
activation of Factor X by Factor VIIa was assessed as described by Ruf et
al (104). Briefly, to each well in a microtiter plate was added 20 µl of: (a)
50 nM recombinant FVIIa (Novo-Nordisc) in TBS-BSA; (b) 0,16 nM –1,6
µM tTF/tTF-RGD in TBS-BSA; (c) 25 nM CaCl2 and 500 µM
phospholipids (phosphatidylcholine/ phosphatidylserine, 70/30, MM;
Sigma).
After 10 min at room temperature, 20 µl of the substrate Factor X (Enzyme
Research Laboratories) was added in a concentration of 5 µM.
Aliquots were removed from the reaction mixture every minute and
stopped in 100 nM EDTA. Spectrozyme FXa was added and rates of Factor
Xa were monitored by the development of color at 405 nm.
![Page 36: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/36.jpg)
36
36
The activity of tTF-RGD bound to microvascular endothelial cells (MVEC)
was determined in vitro by using a chromogenic assay to detect FXa as
described by Ran et al, 1998.
Briefly, MVEC were grown in a 96 well plate to confluence. The cells were
washed two times with PBS-buffer containing 2mg/ml BSA. The cells were
incubated with different concentrations of tTF-RGD (0,025-0,4 nM) for 20
min at 37°C.
To each well in the microtiter plate was added: (a) 50 µl of Tris/HCl, 0,15
M NaCl, pH 7,4, 0,1% BSA (TBS-BSA); (b) 25 µl of 10 nM recombinant
FVIIa (Novo Nordisk, Bagsværd, Denmark) in TBS-BSA; (c) 25 µl of 5
mM CaCl2 in TBS-BSA.
After an incubation time of 20 min at room temperature, 100 µl of each
well was transferred to a new 96-well plate. 50 µl of 1,1 M EDTA and 25
µl of Spectrozyme FXa (5nM) were added.
The breakdown of substrate was measured by reading the absorbance in a
microplate reader (Bio-Rad, Hercules, California, USA) at 405 nM. The
cells were detached and counted. The results are expressed as the amount
of FXa generated per 104 cells.
Binding of tTF-RGD fusion proteins to its targets
The binding of tTF-RGD to purified immobilized αvβ3 (Chemicon) was
analyzed by ELISA (enzyme linked immunoadsorbent assay) techniques as
described earlier (Silleti et al, 2001). Binding steps were performed in the
![Page 37: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/37.jpg)
37
37
absence and presence of the synthetic peptide GRGDSP (Chemicon) as
competitive ligand in order to show the specificity of this interaction.
Subsequently, the specific binding of tTF-RGD to αvβ3 on endothelial cells
was evaluated.
To this end, the differential binding of biotinilated tTF and tTF-RGD on
endothelial cells in suspension was analyzed by FACS. Streptavidin-
phycoerythrin has been employed for detection of bound protein (See
fig.4).
Tumor Xenotransplantation models
All procedures on animals were performed in agreement with german
regulations (Tierversuchsgesetz § 8 Abs. 2) and specifically approved in
form of a project license.
Single cell suspension (2 x 106 in 100µl) of CCL185 (human
adenocarcinoma of the lung) or M21 (human melanoma) were injected
subcutaneously (s.c.) into the right anterior flank of male BALB/c nude
mice (9-12 weeks old).
Tumor growth was allowed to a volume of approximately 50-100 mm3
(CCL185) and 500-700 mm3 (M21), respectively. At this point, mice were
randomly assigned to different experimental groups. Group 1 received
0.9% NaCl (100 µl), group 2 tTF (30µg in 100µl 0.9% NaCl) and group 3
tTF-RGD (30µg in 100µl 0.9% NaCl) via tail vein injection.
![Page 38: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/38.jpg)
38
38
Depending on the growth kinetics injections were repeated twice weekly
for five times (CCL185) or daily for five times (M21).
Tumor size in vivo was evaluated using a standard caliper measuring tumor
length and width in a blind fashion. Tumor volumes were calculated using
the standardized formula (length x width² x π/6).
According to our project license, animals had to be euthanazed when
tumors became too large, if mice lost >20% of body weight, or at signs of
pain.
Representative photographs of animals and tumors were taken at the end of
each experiment (data not shown). Next, mice were sacrificed by cervical
dislocation in deep CO2 anesthesia in agreement with standard regulations
and project license.
Immediate debleeding was achieved by injection of NaCl 0,9 % and
heparinized solutions directly into the left cardiac ventricle and opening
femoral vessels. Tumors and organs (heart, lung, liver, kidney) were
excised and fixed in 4% buffered formaldehyde solution before embedding
in paraffin.
For toxicity studies an extra set of animals was injected with a higher dose
of tTF-RGD (50µg) and analyzed for signs of thrombosis in heart, lung,
kidney or liver 1h, 4h or 24 hrs after injection in a similar manner.
![Page 39: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/39.jpg)
39
39
Histological studies
Histological analyses, was performed as described earlier (31). Briefly, to
assess the toxicity of treatment by histological analysis, organs (heart, lung,
liver and kidney) were collected 1h, 4 hrs and 24 hrs after injection of 2.0
mg/kg/body weight of tTF-RGD, tTF and saline, fixed in 4 % buffered
paraformaldehyde and embedded in paraffin.
Four µm sections were cut and transferred onto glass slides.
At least, 10 sections per sample were available for evaluation.
Hematoxylin-Eosin (H&E) stained sections from organs were analyzed
using conventional light microscopy for signs of necrosis and thrombosis in
a blinded fashion.
Mice were sacrificed at different time points after injection of
2.0mg/kg/body weight. The tumors were excised, fixed in 4 % buffered
paraformaldehyde and embedded in paraffin. Sections were cut and stained
with H&E.
Thrombosis of vessels was defined as complete or incomplete occlusion of
intratumoral vessels by closely packed red blood cells.
![Page 40: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/40.jpg)
40
40
STATISTICS
The data are presented as medians and interquartile ranges.
The binding differences between tTF and tTF-RGD and the differences in
tumor growth rates between treated tTF-RGD mice and control mice (tTF
or NaCl) were tested for statistical significance using a nonparametric test
(Mann-Whitney rank sum test) for independent samples that makes no
assumptions about tumor size being normally distributed.
P values of <0.05 were considered significant.
In the tumor growth analyses the data are presented as means, standard
deviation (SD) and standard error.
![Page 41: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/41.jpg)
41
41
RESULTS
Characterization of tTF and tTF-RGD
After expression and purification, tTF and tTF-RGD were analyzed under
denaturing conditions on SDS-PAGE and Western-blot (See fig. 1-2 and
3).
M 1 2 3
Figure.2. SDS-PAGE ( Electrophoresis ready gel-Bio rad) M=molecular weight marker,
1=tTF, 2=tTF-RGD, 3=tTF-RGD
Fig. 3 Western-blot analyses of recombinant tTF and tTF fusion proteins. The
purity and identity of tTF and tTF fusion proteins was verified using SDS-PAGE (Gel
code blue ) and Western-blotting (monoclonal anti-tissue factor antibody clone VIC7
American Diagnostics, anti-Histag ab. Santa Cruz) following extraction from E. coli
(BL21 DE3) and refolding with a linear urea-gradient (6M – 1M). M=molecular weight
marker, 1-4 = tTF, 5=tTF-RGD, 6=tTF-NGR.
37 kd
25kd
37 kd
25 kd
Western-blotting, of tissue factor fusion proteins.
M 1 2 3 4 5 6
![Page 42: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/42.jpg)
42
42
Factor X activation by tTF and tTF-RGD
The ability of tTF and the tTF fusion proteins to enhance the specific
proteolytic activation of factor X (FX) by Factor VIIa (FVIIa) is
demonstrated by Michaelis-Menten analyses. The calculated Michealis
constants (Km) for tTF and the tTF-RGD was within the range of 0.15 nM
as reported in the literature (104a) (Figure 4). Thus, the ligation of the RGD
peptide sequence at the carboxyl terminus of tTF does not affect its
functional activity.
Figure 4. Determination of the Michaelis constant (Km):
For the activation of FX by FVIIa / tTF and FVIIa / tTF fusion proteins the Michaelis-
Menten kinetics were calculated according to a published method (104).
0,0016 0,016 0,16 1,6 16 160 16000
10
20
30
40
50
60
70
80
90
100
∆ m
OD
/ m
in
tTF (nM)
Km = 0,16
0,0016 0,016 0,16 1,6 16 160 16000
10
20
30
40
50
60
70
80
90
100
∆ m
OD
/ m
in
tTF-RGD (nM)
Km = 0,12
![Page 43: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/43.jpg)
43
43
Binding experiments of tTF fusion proteins (tTF-RGD) to purified αvβ3
The specific binding of tTF-RGD to immobilized αvβ3 is shown in a
purified receptor binding assay (Figure 5.a-b). Binding of our construct to
immobilized αvβ3 was dose-dependent and saturable. The specificity of this
RGD-dependent interaction is underlined by the competition of the
synthetic peptide GRGDSP. In the presence of 10-100 fold molar excess of
synthetic RGD peptide our construct showed merely no significant binding
capability to αvβ3.
Figure 5 a
Binding of tTF, tTF-RGD to the integrin
αvβ3. The binding of 0.1µM tTF, tTF-
RGD to immobilized αvβ3 was detected
with a polyclonal antibody against human
TF by ELISA. The results are presented as
median and interquartile range. The
difference in binding between tTF-RGD
and tTF was significant (p<0.005, Mann-
Whitney-Test).
Figure 5b
Specificity of the binding of tTF-RGD to
integrin αvβ3 . The binding of tTF-RGD
(0.1µM) to immobilized avß3 was
significantly inhibited by the synthetic
peptide GRGDSP (p<0.005, Mann-
Whitney test for both RGD peptide
concentrations).
0
1
2
4
6
8
0
2
4
tTF -RGDtTF 0
0
0
0
0
1
1,
,
Bin
ding
.to α
vß3 (m
OD
)
0
20
40
60
80
100
tTF-RGD tTF-RGD +1 µM RGD
tTF-RGD +10 µM RGD
Bin
ding
to
αvβ 3
(%)
![Page 44: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/44.jpg)
44
44
Binding of tTF-RGD on endothelial cells
Subsequently, the specific binding of tTF-RGD to receptors on endothelial
cells (MVEC) was evaluated by FACS. Differential binding of biotinilated
tTF and tTF-RGD on endothelial cells in suspension is shown.(Figure 6A).
Indeed, the measured fluorescence intensity was eight fold higher for tTF-
RGD compared to tTF. Furthermore, the binding of 0,1 µM tTF-RGD to
endothelial cells was reduced to 25% in the presence of 1 µM synthetic
peptide GRGDSP. These results underscore again the RGD-dependency of
tTF-RGD binding to receptors on endothelial cells such as integrins αvβ3 or
αvβ5 (See fig. 6B).
A
Cell
count
Fluorescence intensity
B
Fluorescence intensity
Figure 6. Binding of tTF and tTF-RGD to human endothelial cells. A) FACS
analyses of endothelial cells that were incubated with 0.1 µM (2) or with 0.1 µM tTF-
RGD (3)for 60 min. at 4°C. B) By the addition of 1 µM GRGDSP the binding of the
tTF-RGD fusion protein to endothelial cells was reduced by 75% due to competitive
inhibition (4). Line 1 in A and B shows the negative control.
![Page 45: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/45.jpg)
45
45
Anti-tumor activity of tTF-RGD in human malignant melanoma
tumors
The anti-tumor activity of the tTF-RGD fusion protein was determined in
BALB/c nude mice bearing 500-700 mm3 M21 tumors (human malignant
melanoma). The saline solution, tTF (20µg) and tTF-RGD (20µg) in 200 µl
saline solution respectively, were administered i.v. five times at intervals of
24 hours. The pooled results of two independent experiments are presented
(Figure 7).
The tumor growth was significantly retarded at the 4th day of the treatment
(P=0,001) in comparison to tTF and saline treatment.
The tumor weight was in the tTF-RGD treated group significant lower in
comparison to the control groups (P=0,001).
During treatment tumors showed macroscopic signs of necrosis within 24
hours of treatment start similar to the results published by other groups
(Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001; Liu et al, 2002;
Peisheng et al, 2003). Besides, histological studies revealed substantial
amount of tumor vessels which were thrombosed and confirmed the
macroscopic impression of gross tumor necrosis. Thus, the presumable
mode of action of the tTF-RGD fusion protein, i.e. the thrombotic
occlusion of tumor vessels is underlined by these observations.
The high selectivity of the tTF-RGD for tumor blood vessels is
demonstrated by the fact that no visible thrombosis or necrosis occurred in
normal tissues such as heart, kidney, liver, and lung (see fig 8). Even
![Page 46: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/46.jpg)
46
46
repeated high doses of tTF-RGD (4 mg/kg body weight) did not cause any
thrombosis or visible organ damage.
Figure 7. Anti-tumor activity of tTF-RGD on growth of M21 tumors in mice
The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c
nude mice bearing M21 tumors. The tTF, saline solution and tTF-RGD respectively,
were administered i.v. five times at intervals of 24 hours. The tumor growth was
significantly retarded at the 4th day of the treatment (P=0,001) in comparison to tTF and
saline treatment. The tumor weight in the tTF-RGD treated group was significantly
lower in comparison to the control group (P=0,001).
Anti-tumor activity of tTF-RGD in human lung cancer tumors in mice
Furthermore, we determined the anti-tumor activity of the tTF-RGD
protein in BALB/c/nude mice bearing 50-100 mm3 CCL185 (human lung
cancer) tumors. Because of the slower tumor growth in the experiment, the
0
300
600
900
1200
1 2 3 4 5 6 7
TIME [days]
TUM
OR
VO
LUM
E [m
m3 ]
Saline
tTF
tTF-RGD
![Page 47: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/47.jpg)
47
47
tTF-RGD (20µg) and the controls tTF(20µg) and saline solution were
administered five times at intervals of 3-4 days.
The pooled results of two independent experiments are represented (Fig.8).
After the 5th injection of tTF-RGD, we could show a significant growth
inhibition of the CCL185 tumors in comparison to the control groups
(P=0,001).
Figure 8. Anti-tumor activity of tTF-RGD on growth of CCL-185 tumors in mice
The anti-tumor activity of the tTF-RGD fusion proteins was determined in BALB/c
nude mice bearing CCL185 tumors. Because of the slower tumor growth in the
experiment, the tTF-RGD, the tTF and the saline solution, respectively, were
administered at intervals of 3-4 days. After the 5th injection of the tTF-RGD, we could
show a significant growth inhibition of the CCL185 tumors in comparison to the control
groups (P=0,001).
0
100
200
300
400
500
600
TIME [days]
TUM
OR
VO
LUM
E [m
m3 ]
Saline
tTF
tTF- RGD
1 4 7 10 13 16 19 22 25
![Page 48: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/48.jpg)
48
48
Histological analyses from mice organs treated with tTF-RGD
All animals were macroscopically and histologically analyzed after
treatment. The organs (heart, kidney, liver and lung) from the tTF-RGD
treated mice didn’t show any sign of thrombosis or necrosis (See figure 9).
Figure 9. Representative H&E sections of heart (A), kidney (B), liver (C) and lung (D),
1 hour after injection of 4 mg/kg/body weight of tTF-RGD in the mice. No visible
thrombosis or necrosis was observed in these organs (magnification x 200).
The high selectivity of tTF-RGD for tumor blood vessels is demonstrated
by the fact that no visible thrombosis or necrosis occurred in normal tissues
such as heart, kidney, liver and lung (Fig. 10).
A B
C D
![Page 49: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/49.jpg)
49
49
Histological analyses of the effect of tTF-RGD on tumor tissue
The microscopic studies revealed that tumor vessels of the malignant
melanoma and lung cancer were thrombosed (Fig. 10 A-B). Thus, the
presumable mode of action of tTF-RGD, i.e. the thrombotic occlusion of
tumor vessels is confirmed by these observations.
Figure 10. Representative Hematoxylin/eosin (H&E) sections of the malignant melanoma (M-21) tumor bearing mouse, 1 hour after injection of tTF-RGD (A and B) or saline control (C and D) in the tail vein of the mice. Blood vessels in tumors treated with tTF-RGD fusion proteins appear thrombosed (arrows). In the area surrounding an occluded blood vessel extensive tumor cell necrosis is observed (A-B). Photographs are from representative areas of the tumor (A and C: magnification x 200; B and D magnification x 400).
A
DC
B
![Page 50: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/50.jpg)
50
50
Macroscopic experiment showing the effect of the tTF-RGD on tumor
treated mice
In order to prove the mode of action that thrombotic occlusion of tumor
vessels does really occur, the following experiment was performed:
The human melanoma cell line M-21 was injected into the flank of two
male balb/c/nude mice. After having reached a tumor volume of
approximately 500 mm3, 2.0 mg/kg/body weight of tTF-RGD or 0,9 %
NaCl was injected in the tail vein of the mice.
See the photograph of the tumor bearing mouse 20 minutes after injection
of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side)
respectively (Figure 11 A).
The tumor was bruised and blackened indicating apparent massive tumor
ischemia after injection of tTF-RGD.
The mice were sacrificed 60 min. after injection and the tumor was
completely removed for histological studies (data not shown).
We could see areas of hemorrhage and ischemia in the tumor of the mouse
treated with tTF-RGD in contrast to the apparent vital appearance of the
tumor treated with saline solution after injection.
(Figure 11 B-C).
![Page 51: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/51.jpg)
51
51
Figure 11. A, Representative photographs of the malignant melanoma (M-21) tumors bearing mice 20 minutes after injection of the tTF-RGD fusion protein (left side) and 0.9 % NaCl (right side), respectively. The tumor was bruised and blackened indicating massive tumor ischemia after injection of tTF-RGD. B, shows areas of hemorrhage in the tumor of the mouse treated with tTF-RGD in contrast to the vital appearance of the tumor treated with 0.9 % NaCl solution C.
A
CB
![Page 52: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/52.jpg)
52
52
DISCUSSION
The initial reports on the selective induction of intratumoral thrombosis
using tTF fused to antibodies or antibody fragments directed to artificial or
natural markers of angiogenesis showed impressive efficacy in terms of
tumor growth inhibition. The first report by Huang et al, on the targeted
induction of intraluminal blood coagulation in tumor blood vessels using an
artificial marker of angiogenesis generated a great interest to learn whether
the same strategy would work in tumor models carrying natural markers of
angiogenesis.
The second report on this strategy, featuring the targeting of the VCAM-1,
was less impressive because only a 50% reduction in the tumor growth rate
was observed.
The third report by Nilsson et al, featuring the targeting of the mice ED-B
domain sequence in the vasculature of aggressive growing tumors observed
a complete remission in 30 % of the mice treated, however animals were
not cured (Huang et al, 1997; Ran et al, 1998; Nilsson et al, 2001).
One last report by Peisheng Hu et al 2003, shows the results of three
different targeted tissue factor fusion proteins for inducing tumor vessel
thrombosis; the chTNT-3/tTF which targets the antigens exposed in
necrotic regions of the tumor, the chTV-1/tTF targets a vessel antigen,
fibronectin and RGD/tTF similar to the fusion protein constructed in our
approach.
Of interest, a comparison of the three targeting approaches from Hu et al, to
deliver the tTF to the tumor site demonstrated that chTNT-3 and chTV-1
were found to be the most effective vehicles. Interestingly, RGD/tTF alone
![Page 53: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/53.jpg)
53
53
did not display significant anti tumor effects on its own. The authors
explained this by the fact that the receptor for RGD, αVβ3 , is mainly
associated with endothelial cells undergoing angiogenesis known to occur
principally in newly formed capillaries and small sized vessels, not larger
sized, mature vessels. Moreover, they argued that the RGD receptors have
a relative low affinity for a ligand compared with antigen-antibody
interactions, thus explaining the less impressive results obtained with this
fusion protein (Peisheng Hu et al, 2003).
Antibody fusion proteins highly depend on the appropriate formulation to
prevent protein aggregates associated side effects. The bigger size of even
single-chain antibody fragments which are fused to tTF may be of sterical
hindrance to tTF in terms of inducing coagulation. Promising candidates to
target tTF to the tumor vasculature without the above mentioned drawbacks
include small peptide fusion proteins selective for natural markers on tumor
endothelium (Baxter et al, 1989).
Integrins αVβ3, αVβ5 as well as other integrins have been identified as
markers of activated endothelium and seem to play a crucial role in
developmental and tumor angiogenesis (Fujimori et al, 1989; Jain, 1990;
Denekamp, 1990).
RGD-peptide fusion proteins which bind to these endothelial ligands have
been identified as promising agents to target the tumor endothelium (Arap
et al, 1998).
In this study, we show the ability of tTF and tTF-RGD fusion protein to
enhance the specific proteolytic activation of factor X (FX) by Factor VIIa
(FVIIa). The calculated Michaelis constants (Km) for tTF and the tTF-RGD
![Page 54: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/54.jpg)
54
54
were within the range of 0.15 nM as reported in the literature,
demonstrating the efficacy of our tTF to activate coagulation.
The specific binding of tTF-RGD to immobilized αvβ3 is shown in a
purified receptor binding assay. Binding of our construct to immobilized
αvβ3 was dose-dependent and saturable. The specificity of this RGD-
dependent interaction is underlined by the competition using the synthetic
peptide GRGDSP. In the presence of 10-100 fold molar excess of
unlabeled synthetic RGD peptide, our construct showed merely no
significant binding capability to αvβ3, thus suggesting the specificity of
tTF-RGD binding to αvβ3.
The anti-tumor activity of the tTF-RGD fusion protein was evaluated in
BALB/c nude mice bearing 500-700 mm3 M21 tumors (malignant
melanoma) and 50-100 mm3 CCL185 tumors (lung cancer). The tumor
growth was significantly retarded in comparison to tTF alone and saline
treatment. Moreover, the tumor weight was significant lower in the tTF-
RGD treated group in comparison to the control group.
In the groups of control mice, there was no statistically significant
difference between mice injected with saline or with tTF protein alone, no
macroscopically signs of ischemia or occluded vessels by histological
analyses, confirming that the selective targeting of tTF-RGD was necessary
for the anti-tumor effect.
In our approach, the injection of the tTF-RGD fusion protein in mice
through the tail vein shows the efficacy of the fusion protein without
significant side effects in vivo.
![Page 55: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/55.jpg)
55
55
Our effective tumor growth inhibition may be explained by the fact that the
receptors for RGD, αVβ3, αVβ5 are associated with endothelial cells
undergoing angiogenesis.
Moreover, by the suggestion that for optimal effects tTF needs to be
targeted to the luminal surface of the tumor endothelium in all regions of
the tumor mass, probably because platelet activation, assembly of
coagulation factors, or both occur most efficiently on the luminal side
(Brooks, PC et al, 1994b).
The mechanism of vessel thrombosis with the reagent is readily understood
because RGD receptors are located on the luminal side of tumor vessels
(Ran et al, 1998; Nilsson et al, 2001).
According to that and based on the known crystal structure of the
tTF:FVIIa complex (Banner et al, 1996), the fusion to RGD would allow
the tTF-peptide fusion proteins to adopt an orientation perpendicular to the
phospholipid membrane of the endothelial cell similar to native TF.
On the other hand, ligation of the peptide to the carboxyl terminus of tTF,
as done in our work, should not result in a sterical hindrance for the
interaction of tTF with FVIIa and its substrate FX.
This work shows for the first time an effective in vivo inhibition of human
tumor growth by selectively targeting the tTF-RGD fusion protein to
natural markers of angiogenesis. The selective induction of intraluminal
blood coagulation in the tumor vasculature, results in effective anti tumor
therapy in two experimental solid tumor mice models. However, future
preclinical studies are necessary to optimize this antivascular treatment
strategy, e.g. by combining tTF-RGD with cytotoxic agents or other
antiangiogenic drugs.
![Page 56: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/56.jpg)
56
56
LITERATURE
1 Algire, GH., and Chalkley, HW. Vascular reactions of normal and
malignant tissues in vivo I. Vascular reactions of mice to wounds
and to normal and neoplastic implants. J Natl Cancer Inst USA;
6: 73-85, 1945.
2 Arap, W., Pasqualini, R., and Ruoslahti, E. Cancer treatment by
targeted drug delivery to tumor vasculature in a mouse model.
Science 279:377-380, 1998.
3 Bader, BL., Rayburn, H., Crowley, D., and Hynes, RO. Extensive
vasculogenesis, angiogenesis, and organogenesis precede lethality in
mice lacking all alpha v integrins. Cell, 95: 507-519, 1998.
4 Banner, DW., D´Arcy, A., Chene, C., Winkler, FK., Guha, A.,
Konigsberg,WH., Nemerson, Y., Kirchhofer, D. The crystal structure
of the complex of blood coagulation factor VIIa with soluble tissue
factor.Nature 380:41-46, 1996.
5 Bar, RS., Boes, M., Booth, BA., Dake, BL., Henley, S., & Hart, MN.
The effects of platelet-derived growth factor in cultured microvessel
endothelial cells. Endocrinology 124, 1841-1848, 1989.
6 Baxter, LT., and Jani, RK. Transport of fluid and macromolecules in
tumors.I. Role of interstitial pressure and convection. Microvasc
Res 37:77-104, 1989.
![Page 57: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/57.jpg)
57
57
7 Ben-Ezra, J., Sheibani, K., Hwabg, D L., & Lev-Ran, A. Megakaryocyte
synthesis is the source of epidermal growth factor in human platelets.
Am. J. Pathol. 137, 755-759, 1990.
8 Bhagwat, S V., Lahdenranta, J., Giordano, R., Arap, W., Pasqualini, R.,
and Shapiro, L H. CD13/APN is activated by angiogenic signals and is
essential for capillary tube formation. Blood 97: 652-659, 2001.
9 Bieker R, Padró T, Kramer J, Steins M, Kessler T, Retzlaff S, Herrera F,
Kienast J, Berdel WE, Mesters RM. Overexpression of basic fibroblast
growth factor and autocrine stimulation in acute myeloid leukemia.
Cancer Research nov 1;63:7241-7246, 2003.
10 Bikfalvi, A. Significance of Angiogenesis in Tumour Progression and
Metastasis. European Journal of Cancer Vol.31A; Nos 7/8: 1101-1104,
1995.
11 Bikfalvi, A., Bicknell, R. Recent advances in angiogenesis,
anti-angiogenesis and vascular targeting. Trends in Pharmacological
Sciences 23;12: 576-582, 2002.
12 Blei, F., Wilson, EL., Mignatti, P., Rifkin, DB. Mechanism of action of
angiostatic steroids: suppression of plasminogen activator activity via
stimulation of plasminogen activato inhibitor synthesis. J Cell Physiol;
155:568-578, 1993.
![Page 58: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/58.jpg)
58
58
13 Boehm, T., Folkman, J., Browder, T., O’Reilly, MS. Antiangiogenic therapy
of experimental cancer does not induce acquired drug resistance.
Nature ;390:404-407, 1997.
14 Boger, DL., Goldberg, J., Silletti, S., Kessler, T., and Cheresh, DA.
Identification of a novel class of small-molecule antiangiogenic agents
through the screening of combinatorial libraries which function by inhibiting
the binding and localization of proteinase MMP2 to integrin alpha(V)beta(3).
J Am Chem Soc, 123: 1280-1288,2001.
15 Bouck, N. Tumor angiogenesis: the role of oncogenes and tumor suppressor
genes. Cancer Cells 2: 179-185,1990.
16 Brooks, PC., Silleti, S., von Schalscha, TL., Friedlander, M., Cheresh, DA.
Integrin avß3 antagonists promote tumor regression by infuscing apoptosis
of angiogenic blood vessels. Cell;79:1157-1164, 1994b.
17 Brooks. PC., Clark, RAF., Cheresh, DA. Requirement of vascular integrin
avß3 for angiogenesis. Science;264:569-571, 1994a.
18 Browder, T., and -Folkman, J. The hemostatic system as a regulator of
angiogenesis. The Journal of Biological Chemistry, Jan 21;275(3):1521-4,
2000.
19 Brunner, G., Nguyen, H., Gabrilove, J., Rifkin, DB., & Wilson, EL. Basic
fibroblast growth factor expression in human bone marrow and peripheral
blood cells. Blood 81, 631-638, 1993.
![Page 59: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/59.jpg)
59
59
20 Burg, M A., Pasqualini, R., Arap, W., Ruoslahti, E., and Stallcup, W B.
NG2 proteoglycan-binding peptides target tumor neovasculature. Cancer Res
59: 2869-2874, 1999.
21 Burrows, F J., Derbyshire, E J., Tazzari, P L., Amlot, P., Gazdar, A F.,
King, S W., Letarte, M., Vitetta, E S., and Thorpe, P E.,
Up-regulation of endoglin on vascular endothelial cells in human solid
tumors: implications for diagnosis and therapy. Clin Cancer Res 1:
1623-1634, 1995.
22 Cao, Y., O’Reilly, MS., Marshall, B., Flynn, E., Jie, R-W., & Folkman, J.
Expressions of angiostatin cDNA in a murine fibrosarcoma suppresses
primary tumor growth and produces long-term dormancy of metastases.
J Clin Invest 101:1055-1063, 1998.
23 Carnemolla, B., Balza, E., Siri, A., Zardi, L., Nicotra, M R., Bigotti, A.,
and Natali, PG. A tumor-associated fibronectin isoform generated by
Alternative splicing of messenger RNA precursors.
J Cell Biol 108:1139-1148, 1989.
24 Chaplin, DJ., and Horsman, MR. The influence of tumor temperature on
ischemia-indued cell death: potential implications for the evaluation of
vascular mediated therapies. Radiother Oncol 3,0: 59-65, 1994.
25 Cheng, S-Y., Huang, HJ., Nagane, M., Ji, XD., Wang, D., Shih, CC.,
Arap, W., Huang, CM., Cavenee, WK. Suppression of glioblastoma
angiogenicity and tumorigenicity by inhibition of endogenous expression
![Page 60: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/60.jpg)
60
60
of vascular endothelial growth factor. Proc Natl Acad Sci USA 93:8502-8507,
1996.
26 Cheresh, DA. Human endothelial cells synthesize and express an
Arg-Gly-Asp-directed adhesion receptor involved in attachment to
Fibrinogen and von Willebrand factor. Proc Natl Acad Sci USA Sep;
84 (18):6471-5, 1987.
27 Ching, LM., Goldsmith, D., Joseph, WR., Komer, H., Sedgwick, JD., and
Baguley, BC. Induction of intratumoral tumor necrosis factor (TNF)
synthesis and hemorrhagic necrosis by 5,6-dimethylxanthenone-4-acetic
acid (DMXAA) in TNF knockout mice. Cancer Res 59:3304-3307, 1999.
28 Claffey, KP., Robinson, GS. Regulation of VEGF / VPF expression in
tumor cells: consequences for tumor growth and metastasis. Cancer
Metastasis Rev 15: 165-176, 1996.
29 Coussens, LM., Fingleton, B., Matrison, LM. Matrix metalloprotienase
inhibitors and cancer: trials and tribulations. Science; vol: 295(5564):
p. 2387-2392, 2002.
30 Date, K., Matsumoto, K., Kubs, K., Shimura, H., Tanaka, M., &
Nakamura, T.Inhibition of tumor growth and invasion by a four kringle-
antagonist (HGF/NK4) for hepatocyte growth factor. Oncogene 17:.
3045-3054, 1998
![Page 61: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/61.jpg)
61
61
31 Denekamp J. Vascular attack as a therapeutic strategy for cancer. Cancer
Metastasis Rev. 9:267-282, 1990.
32 Dvorak, H F., Brown, L F., Detmar, M., and Dvorak, A M. Vascular
permeability factor/vascular endothelial growth factor, microvascular hyper
permeability, and angiogenesis. Am J Pathol 146: 1029-1039, 1995.
33 Dvorak, H F., Sioussat, T M., Brown, L F., Berse, B., Nagy, J A., Sotrel, A.,
Manseau, E J., Van de Water, L., and Senger, D R. Distribution of vascular
permeability factor (vascular endothelial growth factor) in tumors:
concentration in tumor blood vessels. J Exp Med 174: 1275-1278, 1991.
34 Eliceiri, BP., and Cheresh, DA. The role of alphav integrins during
angiogenesis: insights into potential mechanisms of action and clinical
development. J Clin Invest 103: 1227-1230, 1999.
35 Ellis, LM., and Fidler, IJ. Angiogenesis and Metastasis. European Journal
of Cancer 32A; 14: 2451-2460, 1996.
36 Engerman, RL., Pfaffenbach, D., Davis, MD. Cell turnover of capillaries.
Lab Invest 17:738-743, 1967.
37 Felding-Habermann, B., Mueller, B. M., Romerdahl, C. A., and Cheresh,
D. A. Involvement of integrin alpha V gene expression in human melanoma
tumorigenicity. J Clin Invest, 89: 2018-2022, 1992.
![Page 62: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/62.jpg)
62
62
38 Fernig DG , Fibroblast growth factors and their receptors: an information
network controlling tissue growth, morphogenesis and repair.
Prog Growth Factor Res. 5: 353-377, 1994.
39 Fidler, IJ., and Ellis, LM. The implications of angiogenesis to the biology
and therapy of cancer metastasis. Cell; 79:185-188, 1994.
40 Folkman Judah. Antiangiogenic gene therapy, Proc Natl Acad Sci USA
95: 9064-9066, 1998.
41 Folkman, J. Tumor angiogenesis: therapeutic implications. N Engl J Med
Nov 18;285(21):1182-6, 1971.
42 Folkman, J. What is the evidence that tumors are angiogenesis dependent.
Journal Natl Cancer Inst, Jan 3;82(1):4-6, 1990.
43 Folkman, J., Shing, Y. Angiogenesis. J Biol Chem 267:10931-10934, 1992.
44 Folkman, J., Watson, K., Ingber, D., and Hanahan, D. Induction of
angiogenesis during the transition fromhyperplasia to neoplasia.
Nature 339: 58-61, 1989.
45 Fujimori, K., Covell, DG., Fletcher, JE., and Weinstein, JN. Modeling
analysis of the global and microscopic distribution of immunoglobulin G,
F(ab')2, and Fab in tumors.Cancer Res 49:5653-5656, 1989.
![Page 63: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/63.jpg)
63
63
46 Gimbrone, MA Jr., Leapman, S., Cotran, R., Folkman, J. Tumor dormancy
in vivo by prevention of neovascularization. J Exp. Med. 136:261-276, 1972.
47 Goldman, CK., Kendall, RL., Cabrera, G., Soroceanu, L., Heike, Y.,
Gillespie, GY. Paracrine expression of a native soluble vascular endothelial
growth factor receptor inhibits tumor growth, metastasis, and mortality rate.
Proc Natl Acad Sci USA 95:8795-8800, 1998.
48 Good, DJ., Polverini, PJ., Rastinejad, F., Le Beau, MM., Lemons, RS.,
Frazier, WA., Bouck, NP. A tumor suppressor-dependent inhibitor of
angiogenesis is immunologically and functionally indistinguishable from a
fragment of thrombospondin. Proc. Natl. Acad. Sci U.S.A. 87,6624-6628,
1990.
49 Hagedorn, M., Bikfalvi, A. Target molecules for antiangiogenic therapy:
from basis research to clinical trials. Crit Rev Oncol Hematol 34:89-110,
2000.
50 Hanahan, D., Folkman, J. Patterns and emerging mechanisms of the
angiogenic switch during tumorigenesis. Cell 86:353-364, 1996.
51 Hobson, B., Denekamp, J. Endothelial proliferation in tumors and
normal tissues: continuous labeling studies. Br J Cancer 49:405-413,
1984.
52 Huang, X., Molema, G., King, S., Watkins, L., Edgington, T S., and Thorpe,
P E. Tumor infarction in mice by antibody-directed targeting of tissue factor
![Page 64: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/64.jpg)
64
64
to tumor vasculature. Science 275: 547-550, 1997.
53 Hwang, DL., Lev-Ran, A., Yen, C F., & Sniecinski, I. Release of different
fractions of epidermal growth factor from human platelets in vitro:
preferential release of 140 kDa fraction. Regul Pept; 37: 95-100, 1992.
54 Hynes, R. O. Integrins: versatility, modulation, and signaling in cell adhesion.
Cell, 69: 11-25, 1992.
55 Jain RK. Vascular and interstitial barriers to delivery of therapeutic agents
In tumors. Cancer Metastasis Rev 9:253-266, 1990.
56 Karey, K.P., Marquardt, H., & Sirbasku, DA. Human platelet-derived
mitogens.I. Identification of insulinlike growth factors I and II by
purification and N alpha amino acid sequence analysis. Blood 74,
1084-1092, 1989.
57 Kerbel, RS. Tumor angiogenesis: past, present and the near future.
Carcinogenesis Mar;21(3):505-15, 2000, Review.
58 Kessler, T., Pfeifer, A., Silletti, S., Mesters, R M., Berdel, W E., Verma, I.,
and Cheresh, D. Matrix metalloproteinase/integrin interactions as target for
anti-angiogenic treatment strategies. Ann Hematol 81;Suppl 2: S69-70, 2002.
59 Kim, KJ., Li, B., Winer, J., Armanini, M., Gillet, N., Phillips, HS.,
Ferrara, N. Inhibition of vascular endothelial growth factor-induced
angiogenesis suppresses tumor growth in vivo. Nature 362: 841-4, 1993.
![Page 65: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/65.jpg)
65
65
60 Kuus-Reichel, K., Grauer, LS., Karavodin, LM., Knott, C., Krusemeier, M.,
Kay, NE. Will immunogenicity limit the use, efficacy, and future development
of therapeutic monoclonal antibodies? Clin Diagn Lab Immunol 1:365-372,
1994.
61 Lee S Rosen, Clinical Experience with Angiogenesis Signaling
Inhibitors: Focus on Vascular Endothelial Growth Factor Blockers.
Cancer control vol. 9; suppl. 2: 36-44, 2002.
62 Lee, OH., Kim, Y-M., Lee, YM., Moon, E-J., Lee, D-J., Kim, J-H.,
Kim, K-W., & Kwon,YG. Sphingosine 1-phosphate induces angiogenesis:
its angiogenic action and signaling mechanism in human umbilical vein
endothelial cells. Biochem Biophys Res Commun 264: 743-750, 1999.
63 Lin, P., Buxton, JA., Acheson, A., Radziejewski, C., Maisonpierre, PC.,
Yancopoulos, GD. Antiantiogenic gene therapy targeting the endothelium-
specific receptor tyrosine kinase tie2. Proc Natl Acad Sci USA;
95:8829-8834, 1998.
64 Liu, C., Huang, H., Donate, F., Dickinson, C., Santucci, R., El-Sheikh, A.,
Vessella, R., and Edgington, T. S. Prostate-specific membrane antigen directed
selective thrombotic infarction of tumors. Cancer Res 62: 5470-5475, 2002.
65 Mattern, J., Koomägi, R., Volm, M. Association of vascular endothelial
growth factor expression with intratumoral microvessel density and tumor
cell proliferation in human epidermoid lung carcinoma. Br J Cancer;
73:931-934, 1996.
![Page 66: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/66.jpg)
66
66
66 Mesters, RM., Padró, T., Bieker, R., Steins, M., Kreuter, M., Goener, M.,
Kelsey, S., Scigalla, P., Fiedler, W., Buechner, T., Berdel, WE. Stable
remission after administration of the receptor tyrosine kinase inhibitor
SU5416 in a patient with refractory acute myeloid leukemia.
Blood Jul 1;98(1):241-3, 2000.
67 Mesters, RM., Padró, T., Steins, M., Bieker, R., Retzlaff, S., Kessler T.,
Kienast, J., Berdel, WE. Angiogenesis in patients with hematologic
malignancies. Onkologie sep;24 Suppl 5:75-80, 2001.
68 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.
Dominant-negative inhibition of flk-1 suppresses the growth of many
tumor types in vivo. Cancer Res 56:1615-1620, 1996.
69 Millauer, B., Shawver, LK., Plate, KH., Risau, W., Ullrich, A.
Glioblastoma growth inhibited in vivo by a dominant-negative flk-1
mutant. Nature 367:576-579, 1994.
70 Mohle, R., Green, D., Moore, MA., Nachman, RL., and Rafii, S.
Constitutive production and thrombin-induced release of vascular
endothelial growth factor by human megakaryocytes and platelets.
Proc Natl Acad Sci USA, 94: 663-668, 1997.
71 Morrissey, JH., Macik, BG., Neuenschwander, PF., and Comp, PC.
Quantitation of activated factor VII levels in plasma using a tissue factor
mutant selectively deficient in promoting factor VII activation.
Blood 81: 734-744, 1993.
![Page 67: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/67.jpg)
67
67
72 Nakamura, T., Teramoto, H., & Ichihara. Purification and characterization
of a growth factor from rat platelets for mature parenchymal hepatocytes
in primary cultures. Proc Natl Acad Sci USA;83: 6489-6493, 1986.
73 Nilsson, F., Kosmehl, H., Zardi, L., and Neri, D. Targeted delivery
of tissue factor to the ED-B domain of fibronectin, a marker of
angiogenesis, mediates the infarction of solid tumors in mice.
Cancer Res 61: 711-716, 2001.
74 Novak, K. Angiogenesis inhibitors revised and revived at the AACR.
Nat Med 8: 427, 2002.
75 Olson, T A., Mohanraj, D., Roy, S., and Ramakrishnan, S. Targeting the
tumor vasculature: inhibition of tumor growth by a vascular endothelial
growth factor-toxin conjugate. Int J Cancer 73: 865-870, 1997.
76 Padró, T., Bieker, R., Ruiz, S., Steins, M., Retzlaff, S., Bürger, H.,
Büchner, T., Kessler, T., Herrera, F., Kienast, J., Müller-Tidow, C.,
Serve, H., Berdel, WE., and Mesters, RM. Overexpression of vascular
endothelial growth factor (VEGF) and its cellular receptor KDR
(VEGFR-2) in the bone marrow of patients with acute myeloid leukemia.
Leukemia 16: 1302-1310, 2002.
77 Padro, T., Ruiz, S., Bieker, R., Burger, H., Stein, M., Kienast, J.,
et al, Increased angiogenesis in the bone marrow of patients with acute
myeloid leukemia. Blood Apr 15;95(8):2637-44, 2000.
![Page 68: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/68.jpg)
68
68
78 Peisheng, Hu., Jianghua, Yan., Jahangir, Sharifi., Thomas, Bai., Leslie, A.,
Khawli, and Alan, L, Epstein. Comparison of Three Different Targeted
Tissue Factor Fusion Proteins for inducing Tumor Vessel Thrombosis.
Cancer Research ;63: 5046-5053, 2003.
79 Pfeifer, A., Kessler, T., Silletti, S., Cheresh, D A., and Verma, I M.
Suppression of angiogenesis by lentiviral delivery of PEX, a noncatalytic
fragment of matrix metalloproteinase 2. Proc Natl Acad Sci U S A,
97: 12227-12232, 2000.
80 Philip Thorpe ., David, J Chaplin., and David, C Blakey. The first
International Conference on Vascular Targeting: Meeting Overview.
Cancer Res 63, 1144-1147, 2003.
81 Polverini, PJ. How the extracellular matrix and macrophages contribute
to angiogenesis-dependent diseases. Eur. J Cancer, Dec; 32A(14):
2430-7, 1996.
82 Poon, RT., Fan, ST., Wong, J. Clinical implications of circulating
angiogenic factors in cancer patients. J Clin Oncol Feb 15;19(4):
1207-25, 2001, Review.
83 Ran, S., Gao, B., Duffy, S., Watkins, L., Rote, N., and Thorpe, P E.
Infarction of solid Hodgkin's tumors in mice by antibody-directed
targeting of tissue factor to tumor vasculature. Cancer Res, 58:
4646-4653, 1998.
![Page 69: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/69.jpg)
69
69
84 Rettig, W J., Garin-Chesa, P., Healey, J H., Su, S L., Jaffe, E A., and
Old, L J. Identification of endosialin, a cell surface glycoprotein of
vascular endothelial cells in human cancer. Proc Natl Acad Sci
U S A 89:10832-10836, 1992.
85 Reynolds, LE., Wyder, L., Lively, JC., Taverna, D., Robinson,
SD., Huang, X., Sheppard, D., Hynes, RO., and Hodivala-Dilke,
KM. Enhanced pathological angiogenesis in mice lacking beta 3
integrin or beta 3 and beta 5 integrins. Nat. Med. 8: 27-34,
2002.
86 Rippmann Pfizenmaier, K., Mattes, R., Rettig, WJ., and Dieter
Moosmayer. Fusion of the tissue factor extracellular domain to a
tumor stroma specific single-chain fragment variable antibody results
in an antigen-specific coagulation promoting molecule.
Biochem J 349: 805-812, 2000.
87 Ruegg, C., Yilmaz, A., Bieler, G., Bamat, J., Chaubert, P.,
Lejeune, F. Evidence for the involvement of endothelial cell
integrin avß3 in the disruption of the tumor vasculature induced
by TNF and IFN-y. Nature Medicine 4: 408-414, 1998.
88 Ruf, W., Rehemtulla, A., Morrissey, JH., and Edgington, TS.
Phospholipid independent and dependent interactions required
for tissue factor receptor and cofactor function. J Biol Chem 266
: 2158-2166, 1991a.
![Page 70: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/70.jpg)
70
70
89 Ruf, W., Kalnik, MW., Lund-Hansen, TS., Edgington, TS:
Characterization of factor VII association with tissue factor in
solution. J Biol Chem 266:15719-15725, 1991 b.
90 Ruoslahti, E. Specialization of tumor vasculature. Nat Rev Cancer
2: 83-90, 2002.
91 Sato, Y., Abe, M., Takaki, R. Platelet factor-4 blocks the binding
of basic fibroblasts growth factor to the receptor and inhibits the
spontaneous Migration of vascular cells. Biochem biophys Res
Commun, 172: 595-600, 1990.
92 Schraa, AJ., Everts, M., Kok, RJ., Asgeirsdottir, SA., Meijer, DK.,
de Leij, LF., Molema, G. Development of vasculature targeting strategies
for the treatment of cancer and chronic inflammatory diseases.
Biotechnology annual review; vol 8:133-165, 2002.
93 Senger, D R., Claffey, K P., Benes, J E., Perruzzi, C A., Sergiou, A P.,
and Detmar, M. Angiogenesis promoted by vascular endothelial growth
factor: regulation through alpha1beta1 and alpha2beta1 integrins.
Proc Natl Acad Sci U S A; 94: 13612-13617, 1997.
94 Silletti, S., Kessler, T., Goldberg, J., Boger, DL., and Cheresh, DA.
Disruption of matrix metalloproteinase 2 binding to integrin
alpha v beta 3 by an organic molecule inhibits angiogenesis and
tumor growth in vivo. Proc Natl Acad Sci U S A 98: 119-124, 2001.
![Page 71: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/71.jpg)
71
71
95 Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., Fusenig, NE.
Halting angiogenesis suppresses carcinoma cell invasion.
Nature Medicine 3:1222-1227,1997.
96 Soker, S., Takashima, S., Miao, HQ., Neufeld, G., Klagsbrun, M.
Neuropilin-1 is expressed by endothelial and tumor cells as an
Isoform-specific receptor for vascular endothelial growth factor.
Cell;92: 735-745, 1998.
97 Table 1Pro-angiogenic and Anti-angiogenic factors
(Angiogenesis Foundation). Understanding angiogenesis, 2002. http://www.angio.org/understanding/content understanding.html.
98 Teicher, BA., Holden, S A., Gulshan, A., Sotomayor, A., Huang, ZD.,
Chen, YN. Potentiation of cytotoxic cancer therapies by TNP-470
alone and with other anti-angiogenic agents. Int J Cancer, Jun 15;
57(6): 920-5, 1994.
99 Terman, BI., Dougher-Vermazen, M. Biological properties of
VEGF / VPF receptors. Cancer Metastasis Rev 15:159-163, 1996.
100 Toi, M., Hoshima, S., Takayanagi, T., Tominaga, T. Association of
Vascular Endothelial Growth Factor Expression with tumor angiogenesis
and with early relapse in primary breast cancer. Jpn J Cancer Res
Oct;85(10):1045-9, 1994.
![Page 72: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/72.jpg)
72
72
101 Topp, MS., Koenigsmann, M., Mire-Sluis, A., Oberberg, D.,
Eitelbach, F., von Marschall, Z., Notter, M., Reufi, B., Stein, H.,
Thiel, E., and Berdel, WE. Recombinant human interleukin-4
inhibits growth of some human lung tumor cell lines in vitro and in vivo.
Blood 82: 2837-2844, 1993.
102 Warren, RS., Yuan, H., Matli, MR., Gillett, NA., Ferrara, N.
Regulation by vascular endothelial growth factor of human colon
cancer tumorigenesis in a mouse model of experimental liver metastasis.
J Clin. Invest 95:1789-1797, 1995.
103 Wartiovaara, U., Salven, P., Mikkola, H., Lassila, R., Kaukonen, J.,
Joukov, Vl., Orpana, A., et al. Peripheral blood platelets express
VEGF-C and VEGF which are released during platelet activation.
Thromb. Hemostats 80, 171-175, 1998.
104 Yang, JT., Rayburn, H., Hynes, RO. Embryonic mesodermal defects
in alpha 5 integrin-deficient mice. Development 119: 1093-1105, 1993.
105 Yun, Z., Menter, DG., Nicolson, GL. Involvement of integrin avß3
in cell adhesion, motility and liver metastasis of murine RAW117
large cell lymphoma. Cancer Res;56: 3103-3111, 1996.
![Page 73: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/73.jpg)
73
73
ABBREVIATIONS
TF = Tissue Factor
tTF= truncated form of tissue factor
RGD = specific peptide sequence
PS = phosphatidylserene
VEGF = vascular endothelial growth factor
VCAM-1 = vascular cell adhesion molecule
B-FN = fibronecting containing ED-B
FACS = fluorescence activated cell sorting
MVEC = microvascular endothelial cells
Kd = dissociation constant
ELISA = enzyme linked immunoadsorbent assay
Ang1 = angiopoietin-1
ED-B= domain extra domai-B of fibronectin
FVIIa= activated factor VII
TNF-α= Tumor necrosis factor alpha
![Page 74: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/74.jpg)
74
74
ACKNOWLEGMENTS
I would like to express my gratitude to Prof. Dr med. Rolf M. Mesters for
providing me with opportunity and scientific environment to carry out the
studies.
I am grateful to Dr. Teresa Padró for her commitment, enthusiasm and
guidance throughout this investigation. I also thank Dr. Ralph Bieker and
Dr. Torsten Keßler for their educational advice.
I would also thank Mrs Sandra Ruiz, Dr. med. R Lüttmann, Mrs C Wilken,
Ms H Hintelmann who have contributed to a very pleasant atmosphere, for
their support and friendship in these 3 years.
Finally, I am particularly indebted to Jennifer George, mi wife, for her
emotional support, and friendship. Moreover, my family that after all,
without their, I would have never persisted in achieving this MD.
![Page 75: Aus dem Universitätsklinikum Münster Medizinische … · Strategie wurden Fusionsproteine generiert, die aus löslichem Gewebefaktor (truncated ... Die Tumoren der mit tTF-RGD Fusionsprotein](https://reader031.fdocument.pub/reader031/viewer/2022022614/5ba0202b09d3f2857a8c5fa4/html5/thumbnails/75.jpg)
75
75