Dragón Rapide (Jaime Camino, 1986) - · PDF file13 Vid.: Tomás Valero Martínez 4
Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields...
Transcript of Aplikasi mikrobiologi dalam kehidupan - Rara · PDF file13/1/2014 · Yields...
BIOTECHNOLOGY
MOLECULAR TECHNIQUE FOR IDENTIFICATION AND GENETICS ENGINER
Bioteknologi Adalah teknologi merekayasa pertumbuhan dan metabolisme sel hidup, baik dari mikroba, tumbuhan, hewan maupun manusia untuk produksi komoditi barang maupun jasa yang bermanfaat bagi manusia.
HORMON INSULIN
HORMON PERTUMBUHAN
Review
Introduction to PCRThe Polymerase Chain Reaction
Photo courtesy of Fisher Scientific
DefinitionPolymerase Chain Reaction (PCR): A procedure to amplify a specific DNA region
Yields millions of copies of the target region, Eksponensial amplification.
Makes enough DNA for further molecular work Is the first step in preparing DNA for :
Sequencing Restriction digestion Bacterial cloning
Diagram by Andy Vierstraete 1999
PCR
Exponential increase of the number of copies during PCR
TEKNIK-TEKNIK MOLEKULER UNTUK DIAGNOSTIK dan IDENTIFIKASI
Penggunaan teknik molekuler Untuk keperluan :1.Karakterisasi dan identifikasi Mikroba: – Keragaman genetik – Hubungan filogeni/kekerabatan2. Diagnosis: deteksi dini/cepat dari patogen/Penyakit.3. Rekayasa Genetika, (ClONING, TRANSGENIK
ORGANISM)
Keunggulan teknik molekuler: • Akurasi tinggi: sensitifitas dan spesifisitas • Cepat • Dapat mendeteksi keseluruhan mikroba: Viable
but not (yet) culturable.
PCR (POLYMERASE CHAIN REACTION) BASED METHODS KARRY MULLIS (1982)
Teknik Molekuler berkembang setelah ditemukannya PCR (Polymerase chain Reaction) oleh karry mullis (1982) dimana dengan sebuah alat yang dinamakan ‘’Thermal Cycler” Proses sintesis protein/Amplifikasi (pemanjangan) DNA dapat dilakukan secara invitro (diluar sel).
PCR ,thermal cycler multi-block system
Tahapan teknik molekuler: A. Ekstraksi DNA Produk DNA Genom B. PCR 1. Denaturasi, (94–96°C) pemutusan ikatan hidrogen pada
DNA Genom sehingga DNA menjadi Utas Tunggal .
2. Annealing,(45-60°C), penempelan PrimerTm = 4 (G+C) + 2 (A+T). Annealing Temperature.
3. Ekstension (70-72°C), pemanjangan DNA Target
C. Elektroforesis (Visualisasi )- Identifkasi Produk PCR
1. Ekstraksi DNA
2. PCR
The different steps of PCR
PCR
DNA sequencing
Microarrays
Mass-spec
Roles of PCR Reagents
GoTaq® PCR Mix Taq polymerase
Enzyme that extends growing DNA strand complementary to DNA template
MgCl2
Provides ions needed for enzyme reaction
dNTP’s Nucleotides (Adenine, Cytosine, Guanine, Thymine)
building blocks for new DNA strands
Buffer Maintains optimal pH for enzyme
ddH2O
Roles of PCR Reagents
Primers Anneal to single-stranded DNA template
Provide initiation site for extension of new DNA
Forward primer Anneals to DNA anti-sense strand
Reverse primer Anneals to DNA sense strand
DNA template In this case, the product of our DNA extraction
Quick QuizWhich of the following reagents is NOT in a master
mix?
A. MgCl2
B. Template DNAC. ddH2OD. dNTPs
PCR (Polymerase Chain Reaction)
Bahan Jumlah (µl)
Primer:
Forward
Reverse
1
1
dNTP 2,5
10 x Buffer Ex Taq 2,5
Taq DNA Polymerase 0,2
Steril Destilation Water (SDW) 18,5
Pembuatan Premix
Pair-ID Forwad Primer Reverse PrimerProd Len.
TmDiff.FPPos.RPPos.
2 GATGGTCAGTGCCTCTCA CCCAGTTGTATAGCGGTA 518 286
586
Primer
Primer design
General notes on primer design in PCR
Perhaps the most critical parameter for successful PCR is the design of primers
Primer selectionCritical variables are: - primer length - melting temperature (Tm) - specificity - complementary primer sequences - G/C content- 3’-end sequence
Primer length
- specificity and the temperature of annealing are atleast partly dependent on primer length
- oligonucleotides between 20 and 30 (50) bases are highly sequence specific- primer length is proportional to annealing efficiency: in general, the longer theprimer, the more inefficient the annealing
- the primers should not be too short as specificity decreases
Contoh Desain Primer
gatggatcatgaataaaactattacgttacttagtgcattattactaccactaagttttgctcacgctgccgagccaacattgtctccagagatggtcagtgcctctcaagtaagaagcgcgcaagcgaaacaaacttacacttatgtccgctgctggtaccgcaccagttattcaaaagatgaacctgcgaccgattgggaatgggcagaaaatccagacggcagttacttcacgcttgatggctactggtggagttcggtttctttcaagaacatgttctacacagacacaccgcaaagtgttatcaagcaacgttgtgagcaaactctggacctagcaaatgaaaacgctgacatcaccttctttgcagccgataaccgtttctcctacaaccatactatctggagcaacgaccctgtcatgcagccagaccaaatcaacaaggtcgtagcattgggtgacagcttgtctgatacaggcaacatctttaatgcatcacaatggcgattcccgaatccaaatagctggttcttgggacacttctcaaacggttttgtgtggactgagtacattgctcaagcgaaaaacttaccgctatacaactgggctgtgggtggcgcggcaggcgaaaaccaatacatcgctctgactggtgtaggtgagcaagtttcctcttacttggcatatgcgaaattagcgaaaaactacaagcctgctaataccctgtttacccttgagtttggtctaaatgacttcatgaactacaaccgtagcgtgccagaagtgaaatcagactacgcggaagccttgattaaactgaccgatgcaggtgcgaagaacttgttgttgatgacactaccagatgcaacacgtgcaccacagtttacctactcgactcaagaagaaatcaacaagatccgcgcgaagatcgtggaaatgaatgagttcatcaaagcacaagcggcgtattacactgcacaaggctacaacgttaccttgtacgatacgcatgcactgtttgaaagcttaacagcaaatccagagcaacacggttttgtaaacgcgagccaagcttgccaagacatcaaccgctcttcatcggtagattacctataccatcactcattgcgttctgagtgtgcgtcttctggctctgataagtttgtattctgggacgtaacacacccgaccacagcaaacaccactacgtggcagaaaaaatgctagaaagtacgaatcaattgtcaaaccatcctttctaa
Sekuen Gen Hemo
Sumber ; (Yuhana et al, 2009)
Forwards
Reverse
Good Primer Design
Length (17-28bp) GC content 50-60% GC Clamp Tm’s between 55-80 Avoid simple sequences – e.g. strings of G’s Avoid primer self complementary
e.g. hairpins, homodimers, heterodimers
Setting PCR Program
Tahapan Suhu(0C)
Waktu
Pre-Denaturasi 94 2 menit
Denaturasi 94 1 menit
Annealing 50 1 menit
Elongation 72 1 menit
Final Elongation 72 2 menit
35 siklus
Considerations
Contamination can easily lead to erroneous results
Avoid contaminating with DNA or PCR product…
DNA stocks, PCR reagents Gloves, tips, pipetters, benches
Carefully measure reagent quantities
Use appropriate cycling conditions
3. Elektroforesis
Visualisasi Produk PCR (Elektroforesis)
Gel agarosa 0,7% (0,21 gr
agarose+30 ml TBE)
Dipanaskan sampai bening dan diamkan
hingga hangat
Dituang ke ke dalam chamber yang sudah
dipasang sisir
Dimasukkan ke bak
elektroforesis
3 µl produk PCR + 4 µl
loading dye
Dimasukkan ke sumur dalam gel
1 µl marker + 4µl
Loading dye
Running (200 Volt, 70 mA)
hingga ¾ bagian dari lebar gel
Diletakkan di atas
ultraviolet illuminator
Pengambilan gambar
DNA Sequencing
The separation of the sequencing fragments
To measure the sizes of the fragments, each of the four reactions would be loaded into a separate well on a gel, and the fragments would be separated by gel electrophoresis
Elektroforesis
Quick QuizIf you forgot to add one of your primers your
resultant gel will probably have
A. No bandsB. A smearC. A band of the wrong sizeD. Many bands
Dolly adalah hewan hasil kloning pertama
Teknik Kloning Dolly
Sel telur dari domba donor I diambil, lalu dikeluarkan intinya (yang dipakai hanya sel yang tanpa inti)
Sel dari kelenjar ambing domba donor II diambil DNAnya saja (sel dibuang, hanya inti yang dipakai)
Sel dari domba I dan II digabungkan (dengan arus listrik), kemudian terjadi pembelahan sel (embrio)
Sel yang telah membelah tsb ditanam pada uterus domba betina lain, yang selanjutnya beranak Dolly
Sepanjang hidupnya Dolly tlh melahirkan 2x, disuntik mati krn radang paru-paru dan arthritis pd umur 6,5 thn.
Profil Dolly
Review.
Kloning Pada Manusia?
Kloning Untuk Menghasilkan Sel Sebagai Terapi?
Tujuan jangka panjangriset kloning antara lain adalah di-hasilkannya protein yang dibutuhkan manusia, sbg terapi dgn menciptakan berbagai sel dan organ kompatibel yang siapdi-transplantasikan ke tubuh manusia.
Contoh membuat sel untuk melawan kanker
Cloning Genes
Agrobacterium tumefaciens Agrobacterium tumefaciens,
penyebab penyakit crown gall, pada tanaman.
Mekanisme : parasit pada jaringan tanaman, melibatkan integrasi sebagian DNA bakteri pada tanaman inang yang menyebabkan tumor dan mengubah metabolisme tanaman.
Agrobacterium tumefaciens A. tumefaciens digunakan
sebagai agen kontrol biologi dan sebagai alat untuk enginering gen pada tanaman.
Plasmid Ti Hanya sel yang mengandung plasmid spesifik
(plasmid Ti) yang dapat menyebabkan penyakit. A. tumefaciens strains yang tidak mempunyai plasmid tumbuh sebagai rizosphere – inhabiting bacteria tanpa menyebabkan penyakit.
Bakteri dapat menstimulasi inang untuk memperbanyak dan membelah diri sel secara cepat dan tidak normal. Hal ini karena bakteri tersebut dapat menyisipkan sebagian DNA nya ke dalam kromosom DNA inang yang menyebabkan overproduksi dari cytokinins dan auxins.
Cytokinin dan auksin merupakan plant growth regulators, dan opines yang memberikan nutrient bagi patogen.
Jaringan inang akan terus membesar dan akan membentuk tumor di batang atau akar.
Plasmid Ti
GMO(Genetically Modified Organism)
Ice Plus Protein (Ice Nucleation active Protein)
The methods used by molecular biologists to study DNA have been developed through adaptation of the chemical reactions and biological processes that occur naturally in cells
Many of the enzymes that copy DNA, make RNA from DNA, and synthesize proteins from an RNA template were first characterized in bacteria. This basic research has become fundamental to our understanding of the function of cells and have led to immense practical applications for studying a gene and its corresponding protein.
As science advances, so do the number of tools available that are applicable to the study of molecular genetics.
PCRDNA sequencing
Microarrays
Mass-spec
The new biology lab
Laboratory Tools and Techniques
Terimakasih Semoga Bermanfaat