Abstract #4143
1
microRNA-874 as a tumor suppressor in maxillary sinus squamous cell carcinoma based on microRNA expression signature Abstract #4143 Toyoyuki Hanazawa 1 , Nijiro Nohata 1,2 , Takashi Kinoshita 1,2 ,Naoko Kikkawa 1 ,Miki Fuse 1 , Takeshi Chiyomaru 3 , Hirofumi Yoshinoi 3 , Hideki Enokida 3 , Masayuki Nakagawa 3 , Yoshitaka Okamoto 1 and Naohiko Seki 2 1 Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan 3 Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan MicroRNAs (miRNAs) are an abundant class of small non- protein-coding RNAs that function as negative gene regulators. They regulate diverse biological processes, and bioinformatic data indicates that each miRNA can control hundreds of gene targets, underscoring the potential influence of miRNAs on almost every genetic pathway. Recent evidence has shown that miRNA mutations or mis-expression correlate with various human cancers and indicates that miRNAs can function as tumour suppressors and oncogenes. Overexpressed miRNAs can act as oncogenes by repressing tumor suppressor genes, whereas under-expressed miRNAs can function as tumor suppressors by negatively regulating oncogenes. miRNAs have been clearly shown to repress the expression of important cancer-related genes and might prove useful in the diagnosis and treatment of cancer. Role of microRNAs in human cancers Maxillary sinus squamous cell carcinoma (MSSCC) comprises 2-3% of all cancers of head and neck tumor and the annual incidence rate is 0.5-1.0 per 100,000 populations. Clinical symptoms of MSSCC present insidiously. Primary tumors are often diagnosed as advanced disease. The 5-years survival rate of T4 tumors is 50% around. Local recurrence is the most common cause of treatment failure and death . Maxillary sinus squamous cell carcinoma Aims of this study 1. To identify the down-regulated miRNAs based on miRNA expression signature using clinical specimens of maxillary sinus squamous cell carcinoma. 2. To elucidate the functional significance of microRNA-874 (miR-874) in maxillary sinus squamous cell carcinoma. 3. To find candidate target genes of tumor suppressive miR-874 by performing genome- wide analysis (microarray analysis and web-based program search). Take home notes 1. We revealed that miR-874 was down-regulated in tumor tissues and functioned as a tumor suppressor based on miRNA expression signature of clinical specimens of maxillary sinus squamous cell carcinoma. 2. Genome-wide expression analysis using miR-874 transfectants revealed that PPP1CA, PAAF1 and TGOLN2 were overexpressed in tumor tissues and were inversely correlated with miR-874 expression in clinical samples. 3. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels. 4. Knockdown of PPP1CA by siRNA inhibited cell proliferation in IMC-3 cells. 5. The PP1a catalytic subunit can form complexes with many regulatory subunits, which regulate various cellular activities such as cell cycle, apoptosis, and signal transduction. 1. Characteristics of twenty patients with maxillary sinus squamous cell carcinoma miRNA Accession No. Chromosome Locus Fold change Normalized ratio P-Value Normal Tumor miR-874 MIMAT0004911 5q31.2 0.011 3.05E-04 3.36E-06 0.0463 miR-133a MIMAT0000427 18q11.2, 20q13.33 0.017 1.89E-02 3.14E-04 0.0033 miR-375 MIMAT0000728 2q35 0.035 3.95E-02 1.36E-03 0.0161 miR-204 MIMAT0000265 9q21.12 0.045 3.26E-02 1.47E-03 0.0055 miR-1 MIMAT0000416 18q11.2, 20q13.33 0.054 1.88E-03 1.02E-04 0.0240 No. Age Gender Differentiation T N M Stage 1 68 Male Well 4b 0 0 IVB 2 77 Male Poor 3 0 0 III 3 76 Male Moderate 3 0 0 III 4 61 Male Well 3 0 0 III 5 54 Male Poor 3 0 0 III 6 65 Female Poor 4b 0 0 IVB 7 65 Male Moderate 4a 0 0 IVA 8 64 Male Poor 4b 0 0 IVB 9 74 Male Well 4a 0 0 IVA 10 71 Male Moderate 3 1 0 III 2. Top five down-regulated miRNAs from TaqMan Low Density Array (n=5) 3. miR-874 expression levels and tumor suppressive function in IMC-3 cells AACR 103 rd ANNUAL MEETING, Tuesday April 3, 2012, 1:00 PM – 5:00 PM Normal Tumor P = 0.0307 0 0.020 0.015 0.010 0.005 miR-874 expression (Normalized to RNU48) *:P< 0.05 No. Age Gender Differentiation T N M Stage 11 64 Male Moderate 4a 0 0 IVA 12 80 Male Moderate 4a 0 0 IVA 13 66 Female Poor 4a 2c 0 IVA 14 67 Male Moderate 4a 0 0 IVA 15 60 Male Poor 4a 0 0 IVA 16 66 Female Moderate 4a 0 0 IVA 17 85 Male Poor 4a 0 0 IVA 18 69 Male Well 4a 0 0 IVA 19 57 Male Poor 4a 0 0 IVA 20 69 Male Poor 4a 2b 0 IVA 0 20 40 60 80 100 120 control miR-874 Proliferation (% of control) * EntrezGene ID GeneName Gene Symbol Log2 rario miR-874 target 1373 carbamoyl-phosphate synthetase 1, mitochondrial CPS1 -1.85 2 3939 lactate dehydrogenase A LDHA -1.75 - 1915 eukaryotic translation elongation factor 1 alpha 1 EEF1A1 -1.45 - 5499 protein phosphatase 1, catalytic subunit, alpha isozyme PPP1CA -1.25 1 5660 prosaposin PSAP -1.23 - 80227 proteasomal ATPase- associated factor 1 PAAF1 -1.22 1 567 beta-2-microglobulin B2M -1.21 - 303 annexin A2 pseudogene 1 ANXA2P1 -1.18 - 5223 phosphoglycerate mutase 1 (brain) PGAM1 -1.15 - 1303 collagen, type XII, alpha 1 COL12A1 -1.09 1 3486 insulin-like growth factor binding protein 3 IGFBP3 -1.08 - 2778 GNAS complex locus GNAS -1.08 - 55536 cell division cycle associated 7-like CDCA7L -1.06 - 8667 eukaryotic translation initiation factor 3, subunit H EIF3H -1.05 1 10916 melanoma antigen family D, 2 MAGED2 -1.05 - 10618 trans-golgi network protein 2 TGOLN2 -1.03 2 4077 neighbor of BRCA1 gene 1 NBR1 -1.02 1 343477 heat shock protein 90kDa beta (Grp94), member 3 (pseudogene) HSP90B3P -1.00 - Overexpressed miRNAs as oncogenes Underexpressed miRNAs as tumor suppressors rs=-0.465 P=0.002 rs=-0.477 P=0.002 rs=-0.464 P=0.003 0 1.0 2.0 3.0 4.0 5.0 6.0 P=0.0154 Normal Tumor Normalized to GUSB PPP1CA mRNA expression 0 0.05 0.10 0.15 0.20 0.25 P=0.0298 Normal Tumor PAAF1 mRNA expression Normalized to GUSB P=0.0312 0 0.5 1.0 1.5 2.0 2.5 3.0 Normal Tumor TGOLN2 mRNA expression Normalized to GUSB 4. Down-regulated genes by miR-874 in IMC-3 cells 5. Three candidate genes were overexpressed in tumor and were inversely correlated with miR-874 expression PPP1CA mRNA expression (% of miR-control) 0 20 * 40 60 80 100 120 PP1α normalized to β-Actin 0 20 40 60 80 100 120 PP1α β-Actin 0 si-control si-PPP1CA_1 si-PPP1CA_2 Cell viability (% of si-control) 20 *** 40 60 80 100 120 *** (%) 1 2 3 4 5 0 0hr 24hr 48hr 72hr Cell number (x10 4 ) miR-874 miR-control * 237-243 5‘ ...GCCGAGGCUGCAGCUCAGGGCAA.. . ||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC 5‘ ...GCCGAGGCUGCAGCU------- A... ||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC Position 237-243 deletion Position 237-243 PPP1CA (NM_001008709) 3’UTR length:353 miR-874 target sites 100 300 200 miR-control miR-874 *:P< 0.05 Luminescence (normalized) 237-243 wild type 0 0.2 0.4 0.6 0.8 1.0 1.2 * 237-243 deletion *:P< 0.05 * 1 2 3 4 0 0hr 24hr 48hr 72hr Cell number (x10 4 ) si-PPP1CA_1 si-control si-PPP1CA_2 ** *:P<0.0018, **:P<0.0005 ***:P<0.0001 6. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels 7. si-PPP1CA inhibited cell growth in IMC- 3 cells
description
Role of microRNAs in human cancers. - PowerPoint PPT Presentation
Transcript of Abstract #4143
microRNA-874 as a tumor suppressor in maxillary sinus squamous cell carcinoma based on microRNA expression signatureAbstract #4143
Toyoyuki Hanazawa1, Nijiro Nohata1,2, Takashi Kinoshita1,2,Naoko Kikkawa1,Miki Fuse1, Takeshi Chiyomaru3, Hirofumi Yoshinoi3, Hideki Enokida3, Masayuki Nakagawa3, Yoshitaka Okamoto1 and Naohiko Seki2
1Department of Otorhinolaryngology / Head and Neck Surgery, Graduate School of Medicine, Chiba University, Chiba Japan2Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba, Japan3Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan
MicroRNAs (miRNAs) are an abundant class of small non-protein-coding RNAs that function as negative gene regulators. They regulate diverse biological processes, and bioinformatic data indicates that each miRNA can control hundreds of gene targets, underscoring the potential influence of miRNAs on almost every genetic pathway. Recent evidence has shown that miRNA mutations or mis-expression correlate with various human cancers and indicates that miRNAs can function as tumour suppressors and oncogenes. Overexpressed miRNAs can act as oncogenes by repressing tumor suppressor genes, whereas under-expressed miRNAs can function as tumorsuppressors by negatively regulating oncogenes. miRNAs have been clearly shown to repress the expression of important cancer-related genes and might prove useful in the diagnosis and treatment of cancer.
Role of microRNAs in human cancers
Maxillary sinus squamous cell carcinoma (MSSCC) comprises 2-3% of all cancers of head and neck tumor and the annual incidence rate is 0.5-1.0 per 100,000 populations. Clinical symptoms of MSSCC present insidiously. Primary tumors are often diagnosed as advanced disease. The 5-years survival rate of T4 tumors is 50% around. Local recurrence is the most common cause of treatment failure and death .
Maxillary sinus squamous cell carcinoma
Aims of this study1. To identify the down-regulated miRNAs based on miRNA expression signature
using clinical specimens of maxillary sinus squamous cell carcinoma.
2. To elucidate the functional significance of microRNA-874 (miR-874) in maxillary sinussquamous cell carcinoma.
3. To find candidate target genes of tumor suppressive miR-874 by performing genome-wide analysis (microarray analysis and web-based program search).Take home notes
1. We revealed that miR-874 was down-regulated in tumor tissues and functioned as a tumor suppressor based on miRNA expression signature of clinical specimens of maxillary sinus squamous cell carcinoma.
2. Genome-wide expression analysis using miR-874 transfectants revealed that PPP1CA, PAAF1 and TGOLN2 were overexpressed in tumor tissues and were inverselycorrelated with miR-874 expression in clinical samples.
3. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels.4. Knockdown of PPP1CA by siRNA inhibited cell proliferation in IMC-3 cells.5. The PP1a catalytic subunit can form complexes with many regulatory subunits,
which regulate various cellular activities such as cell cycle, apoptosis, and signal transduction.
1. Characteristics of twenty patients with maxillary sinus squamous cell carcinoma
miRNA Accession No. Chromosome Locus Fold changeNormalized ratio P-ValueNormal Tumor
miR-874 MIMAT0004911 5q31.2 0.011 3.05E-04 3.36E-06 0.0463 miR-133a MIMAT0000427 18q11.2, 20q13.33 0.017 1.89E-02 3.14E-04 0.0033 miR-375 MIMAT0000728 2q35 0.035 3.95E-02 1.36E-03 0.0161 miR-204 MIMAT0000265 9q21.12 0.045 3.26E-02 1.47E-03 0.0055 miR-1 MIMAT0000416 18q11.2, 20q13.33 0.054 1.88E-03 1.02E-04 0.0240
No. Age Gender Differentiation T N M Stage1 68 Male Well 4b 0 0 IVB2 77 Male Poor 3 0 0 III3 76 Male Moderate 3 0 0 III4 61 Male Well 3 0 0 III5 54 Male Poor 3 0 0 III6 65 Female Poor 4b 0 0 IVB7 65 Male Moderate 4a 0 0 IVA8 64 Male Poor 4b 0 0 IVB9 74 Male Well 4a 0 0 IVA10 71 Male Moderate 3 1 0 III
2. Top five down-regulated miRNAs from TaqMan Low Density Array (n=5)
3. miR-874 expression levels and tumor suppressive function in IMC-3 cells
AACR 103rd ANNUAL MEETING, Tuesday April 3, 2012, 1:00 PM – 5:00 PM
Normal Tumor
P = 0.0307
0
0.020
0.015
0.010
0.005
miR-87
4 expr
ession
(Nor
mali
zed to
RNU48
)
*:P< 0.05
No. Age Gender Differentiation T N M Stage11 64 Male Moderate 4a 0 0 IVA12 80 Male Moderate 4a 0 0 IVA13 66 Female Poor 4a 2c 0 IVA14 67 Male Moderate 4a 0 0 IVA15 60 Male Poor 4a 0 0 IVA16 66 Female Moderate 4a 0 0 IVA17 85 Male Poor 4a 0 0 IVA18 69 Male Well 4a 0 0 IVA19 57 Male Poor 4a 0 0 IVA20 69 Male Poor 4a 2b 0 IVA
0
20
40
60
80
100
120
control miR-874Prol
ifer
ation
(% of
contro
l)
*
EntrezGene ID GeneName Gene Symbol Log2 rario miR-874
target1373 carbamoyl-phosphate
synthetase 1, mitochondrialCPS1 -1.85 2
3939 lactate dehydrogenase A LDHA -1.75 -1915 eukaryotic translation
elongation factor 1 alpha 1EEF1A1 -1.45 -
5499 protein phosphatase 1, catalytic subunit, alpha isozyme
PPP1CA -1.25 1
5660 prosaposin PSAP -1.23 -80227 proteasomal ATPase-
associated factor 1PAAF1 -1.22 1
567 beta-2-microglobulin B2M -1.21 -303 annexin A2 pseudogene 1 ANXA2P1 -1.18 -5223 phosphoglycerate mutase 1
(brain)PGAM1 -1.15 -
1303 collagen, type XII, alpha 1 COL12A1 -1.09 13486 insulin-like growth factor
binding protein 3IGFBP3 -1.08 -
2778 GNAS complex locus GNAS -1.08 -55536 cell division cycle
associated 7-likeCDCA7L -1.06 -
8667 eukaryotic translation initiation factor 3, subunit H
EIF3H -1.05 1
10916 melanoma antigen family D, 2 MAGED2 -1.05 -10618 trans-golgi network protein
2TGOLN2 -1.03 2
4077 neighbor of BRCA1 gene 1 NBR1 -1.02 1343477 heat shock protein 90kDa
beta (Grp94), member 3 (pseudogene)
HSP90B3P -1.00 -
Overexpressed miRNAs as oncogenes
Underexpressed miRNAs as tumor suppressors
rs=-0.465P=0.002
rs=-0.477P=0.002
rs=-0.464P=0.003
01.02.03.04.05.06.0
P=0.0154
Normal TumorNormal
ized t
o GU
SB
PPP1CA mRNA expression
00.050.100.150.200.25
P=0.0298
Normal Tumor
PAAF1 mRNA expression
Norm
alized
to
GUSB
P=0.0312
00.51.01.52.02.53.0
Normal Tumor
TGOLN2 mRNA expression
Norm
aliz
ed to
GUSB
4. Down-regulated genes by miR-874 in IMC-3 cells
5. Three candidate genes were overexpressed in tumor and were inversely correlated with miR-874 expression
PPP1
CA mRN
A expr
ession
(% o
f mi
R-cont
rol)
0
20
*
40
60
80
100
120
PP1α
norm
alized
to β
-Actin
020406080
100120
PP1α
β-Actin
0si-controlsi-PPP1CA_1si-PPP1CA_2
Cell
viabi
lity
(% o
f si
-contr
ol)
20
***
40
60
80
100
120
***
(%)
1
2
3
4
5
00hr 24hr 48hr 72hr
Cell
numbe
r (x10
4 ) miR-874miR-control
*
237-243
5‘ ...GCCGAGGCUGCAGCUCAGGGCAA...
||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC5‘ ...GCCGAGGCUGCAGCU-------
A... ||||||| 3’ AGCCAGGGAGCCCGGUCCCGUC
Position 237-243deletion
Position 237-243
PPP1CA (NM_001008709) 3’UTR length:353
miR-874 target sites
100 300200miR-controlmiR-874*:P< 0.05
Lumine
scence
(n
orma
lized)
237-243wild type
0
0.2
0.4
0.6
0.8
1.0
1.2
*
237-243deletion
*:P< 0.05
*
1
2
3
4
00hr 24hr 48hr 72hr
Cell n
umber
(x10
4 ) si-PPP1CA_1si-control
si-PPP1CA_2
**
*:P<0.0018, **:P<0.0005
***:P<0.0001
6. miR-874 directly regulated PPP1CA expression in both mRNA and protein levels
7. si-PPP1CA inhibited cell growth in IMC-3 cells
