Post on 06-Aug-2020
Genome Based Surveillance andImplications for Public Health
Lothar H. Wieler, Torsten Semmler, Guido Werner, Tim Eckmanns, Norbert Bannert, Andreas Nitsche, Bernhard Renard
Hamburg, 09.06.2016
2
Robert Koch Institute HistoryTasks and InfrastructureData and Facts
National Reference and Consultation Laboratory Network Genomic Surveillance
Viral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
3
Robert Koch: his work on epidemiology and etiology of TB
© Foto RKI
Source: Robert Koch, Epidemiology of tuberculosis; Presentation at the Academy of Sciences in Berlin on April 7, 1910
© Foto RKI© Foto RKI
09.‐10. Juni 2016 RaMi‐NGS
4
„Triangle“, 1891 ‐ 19001891 Royal Prussian Institute for InfectiousDiseases. Robert Koch founding director until1904.
Robert Koch 1843 ‐ 1910Co‐Founder of Modern Bacteriology and Hygiene
1952 Institute as part of the newly foundedBundesgesundheitsamt
1994 Disolution of the Bundesgesundheitsamt independent Federal Institute (Bundesoberbehörde) in the Ministry of Health
Robert Koch Institute 1900
The Robert Koch Institute: From 1891 to 2016
09.‐10. Juni 2016 RaMi‐NGS
5
© Foto RKI© Foto RKI
© RKI© Foto RKI © Foto RKI
09.‐10. Juni 2016 RaMi‐NGS
The Robert Koch Institute: Locations
Legally based networks for Alerts in Germany, EU and WHO
RaMi‐NGS
European Commission
Local Health Authorities
Robert Koch Institute
Regional Health Authorities
WHO ECDC EFSA
IHR
EWRS TESSy ReportsGMLZ
Directive2003/99/EGDecision 1082/2013 EUIHR (2005)
EU
6
InfectionProtectionAct (2001)
09.‐10. Juni 2016 RaMi‐NGS
7
Employees: approx. 1.100, more than 400 Scientists
Budget: approx. 88 Mio. Euro (12.9 Mio for Investments)
More than 120 third party funded research projects (ca . 13 Mio Euro / year)
Peer‐reviewed publications (2012 ‐ 2015): between 438 and 551
90 different professions, 50 different academics, 48 trainees
74 PhD students (Robert Koch Doktoranden‐Kolleg, RoKoDoKo)
Numerous research/lecture links to Universities in Berlin and Braunschweig in particular
RKI website highly accessed by general and professional public(40.0 Mio. page impressions / year; 500.000 accesses to Epi. Bull. / month)
The Robert Koch Institute: Data, Facts
09.‐10. Juni 2016 RaMi‐NGS
8
Robert Koch Institute HistoryTasks and Infrastructure Data and Facts
National Reference and Consultation Laboratory Network Genomic Surveillance
Viral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
Lorem ipsum dolor sit 9
National Reference Centres (NRZ) andConsultation Laboratories (KL)
19 NRZ (5 at RKI)
40 KL (10 at RKI)
External (n = 14)*
Borrelien, Oberschleißheim Helicobacter pylori, Freiburg
Meningococci and H. influenzae, Würzburg Mykobacteria, Borstel Streptococci, Aachen Invasive fungal infections, Jena Hepatitis B‐ und D‐Viruses, Gießen Hepatitis C‐Viruses, Essen Papillom‐ und Polyomaviruses, Köln Retroviren, Frankfurt Tropical Infectious agents, Hamburg Gram‐negative nosokomial agents, Bochum Surveillance Transmissibler Spongiformer
Enzephalopathien, Göttingen Surveillance von nosokomialen Infektionen, Berlin
*(10 at Universities, 4 at other Institutions (z. B. Regional Health Authorities, private laboratories)Italics = new submission in 2016
RKI Internal (n = 5) Salmonella and other bacterial Enteritis‐
causing agents Staphylococci and Enterococci Influenza Measles, Mumps, Rubella Poliomyelitis and Enteroviruses
National Reference Centres (n = 19)
1009.‐10. Juni 2016 RaMi‐NGS
External (n = 30)* Adenoviruses Anaerobic bacteria Bartonella Bordetella pertussis Brucella Chlamydia Clostridium difficile Coxiella burnettii Coronaviruses Dermatophytes Diphtheria Echinococci Filoviruses FSME Gonococci Hantaviruses
RKI Internal (n = 10) Anthrax Clostridium botulinum Electron microscopic
Ddagnostics of infectiousagents
Kryptococcosis andimported Systemmycoses
Listeria Noroviruses Poxviruses Rotaviren RSV, PIV & hMPV Tularemia
Hepatitis‐A‐ & Hepatitis‐E‐Virus Herpes‐simplex‐Virus &
Varizella‐zoster‐Virus HUS Legionella Leptospira Mukoviszidosis‐bacteriology Mykoplasma Parvoviruses Rabies Toxoplasma Treponema Tropheryma whipplei Yersinia pestis Zytomegalievirus
Consultant Laboratories (n = 40)
Italics = new submission in 2016
1109.‐10. Juni 2016 RaMi‐NGS
12
Robert Koch Institute HistoryTasks and Infrastructure Data and Facts
National Reference and Consultation Laboratory Network Genomic Surveillance
Viral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
13
Public health surveillance is defined by the World Health Organization (WHO) as a systematic ongoing collection, collation, analysis, and interpretation of data and a timely dissemination of information(http://www.who.int/topics/public_health_surveillance/en/).
Two main pillars of surveillance are existing: Indicator based Event based surveillance.
Indicator based surveillance can be reporting of physicians and laboratories. If syndromic surveillance is organized in a structured way it is also indicator basedFor event based surveillance often media and/or rumors and alerts aremonitored and assessed for relevance
Integrated surveillance: covering various diseases ‐ ideally also animal diseases
Public Health Surveillance
09.‐10. Juni 2016 RaMi‐NGS
09.‐10. Juni 2016 RaMi‐NGS 14
NGS‐based surveillance
Bioinformatic methodology
1509.‐10. Juni 2016 RaMi‐NGS
Sentinel Surveillance of recently acquired HIV infections:Sampling strategy
DSS(Dried Serum Spots)
Anonymous HIV‐Report
(IfSG)
Serum of 60 % ofnew HIV diagnoses 3200 DSS filters/year 82 laboratories
+
•Gender•Transmission group•Country of origin•Country of infection•Other data
•Antibodies• Viral RNA
1609.‐10. Juni 2016 RaMi‐NGS
Sentinel Surveillance of recently acquired HIV infections:Workflow in the Lab
DSS sample receipt(3200 per year)
DSS sample receipt(3200 per year)
Recency AssayBED IgG capture ELISA
Recency AssayBED IgG capture ELISA
Recent infections(1000 samples/year)
RNA isolation
Recent infections(1000 samples/year)
RNA isolation
RT‐PCR of sequences associated with resistance
RT‐PCR of sequences associated with resistance
Population sequencing+ HIV‐genotyping
(Resistance and Subtype)
Population sequencing+ HIV‐genotyping
(Resistance and Subtype)
Analysis using the linkedsocio demographic & clinical
data from HIV‐report
Analysis using the linkedsocio demographic & clinical
data from HIV‐report
stable TDR rate
Prop
ortio
n (%
)
PTrend > 0.05
(CI 95%: 9.3‐12.6)
Sentinel Surveillance of recently acquired HIV infections:Transmitted drug resistance (TDR) in recent HIV infections (Germany 2013‐2015)
1709.‐10. Juni 2016 RaMi‐NGS
source caseinvestigation
classical epidemiological contact tracing
molecular typing of pathogens
contact tracing
Latent TB infection
Bact. negativeactive TB
Bact. confirmedactive TB
Contact investigation: tracing and interruptingtransmission as a priority for TB control
1809.‐10. Juni 2016 RaMi‐NGS
A joint cross‐border investigation of a cluster of MDR‐TB in Austria, Romania and Germany using classic, genotyping and whole‐genome‐sequencing
Fiebig L., et al. (submitted)1909.‐10. Juni 2016 RaMi‐NGS
20
Robert Koch Institute HistoryTasks and Infrastructure Data and Facts
National Reference and Consultation Laboratory Network Genomic Surveillance
Viral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
Examples Outbreak support (e.g. Ebola) Strengthening IHR‐Systems Biosafety
GuineaSierra LeoneLiberiaNigeria
Nord‐Sudan
Marokko
SenegalBurkina FasoElfenbeinküste
Tunesien
Demokratische Republik Kongo
Ägypten
ÄthiopienKenia
GhanaRuandaTansania
Südafrika
Montenegro
Pakistan
Tajikistan
Turkmenistan
Usbekistan
Ukraine
Jemen
Armenien
Bosnien‐Herzegowina
Cooperation with
Kirgisistan
Angola
2109.‐10. Juni 2016 RaMi‐NGS
Infant mangabey found dead in the Tai National Park (Fabian Leendertz) Multiple skin lesions typical of poxvirus infection Comparison of classical virus propagation plus NGS and direct NGS
First proof of Monkeypox in wild‐living monkeys
Skin/swab
Cell culture
Virus purification
IonTorrent
DNA prep
DNA prep
Illumina HiSeq RR5 days
25 h
1 h
36 h
2209.‐10. Juni 2016 RaMi‐NGS
Radonic A. et al., EID (2014)
Direct sequencing revealed the virus type rapidly New virus belongs to the West African clade (Radonic A. et al. EID 2014)
Western African clade viruses are known to be of low virulence
First proof of Monkeypox in wild‐living monkeys
2309.‐10. Juni 2016 RaMi‐NGS
Radonic A. et al., EID (2014)
Viral genomes are comparably small 5 kb to 200 kb
Viruses require cells for replication Cellular genome 3.3 x109 bp
Unfavorable ratio of viral to cellular nucleic acid in clinical specimen Read numbers attributable to viruses in clinical specimens usually low
Viral genomes can consist of DNA or RNA Different nucleic acid preparations needed Ratio of viral to cellular RNA variable (transcriptional state etc.)
NGS‐based virus diagnostics: Challenges
2409.‐10. Juni 2016 RaMi‐NGS
Generation of a dramatically increased number of NGS‐reads At monetary and bioinformatics cost
Enrichment of virus particles (e.g.TUViD, Kohl et al. EID 2015) Depletion of background (capture technology)
Previous knowledge of virus type helpful Risk of loosing the relevant viruses
Pre‐amplification of viral target sequences (Brinkmann et al. in preparation) Loss of open view
Routine application: HIV‐resistance‐testing and subtype determination on plasma/serum viruses following RNA isolation (with or without pre‐amplification (RT‐PCR) of viral target sequences
Combination of different approaches
NGS‐based virus diagnostics: Approaches
2509.‐10. Juni 2016 RaMi‐NGS
Bremen 2009 to 2012 Neonatal Intensive Care Unit (NICU) Root: 2.5 years before outbreak was
recognised
Haller, Eller, Hermes, Kaase, Steglich, Radonic, Dabrowski, Nitsche, Pfeifer, Werner, Wunderle, Velasco, Abu Sin, Eckmanns, Nübel, BMJ Open (2015)
26
Start screeningPeriod NICU closed
NICU re‐opened
NICU closed again and not re‐opened
10.03.16 Sepsis – the challenges of science, politics and society
Healthcare associated outbreak 1: Klebsiella pneumonia (ESBL)
Cluster 1(2015/11)
putative newCluster (Cluster 3)
Cluster 2
Healthcare associated outbreak 2: Klebsiella pneumonia (ESBL)
2709.‐10. Juni 2016 RaMi‐NGS
200 bp ‐300 bp ‐400 bp ‐500 bp ‐600 bp ‐700 bp ‐
Interpretation
‐ Presence of all three bandsindicates the outbreak strain
Primer pair 1 ‐ product: 606bp4160kb‐F: GTTAGAATCAAGATGCACAGTACGC4160kb‐R: CCATGGATTGAACTTGGTGTGAG
Primer pair 2 ‐ product: 379bpHem‐F: GGGTTTGGTTGTATTAAATGCCACGHem‐R: CCCAATCGCTTTATTTTCCTGACG
Primer pair 3 ‐ product: 265bpUnique‐F: CACAAATTCCCATCTGAGGTCATGUnique‐R: CCACCAAAGCTAAATACTTCGCTG
K. pneumoniae: Deducing a diagnostic MP‐PCR from NGS data
S 1 2 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 N P 1, outbreak strain2, non‐outbreak strainN, negative control strainP, positive control strainS, size marker
2809.‐10. Juni 2016 RaMi‐NGS
29
Robert Koch Institute HistoryTasks and Infrastructure Data and Facts
National Reference and Consultation Laboratory Network Genomic Surveillance
Viral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic Research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
Schaufler et al., FEMS Microbiol. Ecol. (2016)
One Health: CTX‐M‐15 E. coli of ST410 crossing host barriers
3009.‐10. Juni 2016 RaMi‐NGS
Phylogeny of ST131 (n=228) from various sources(Maximum likelihood, 9 non‐ST131 outliers isolates to root the phylogeny)
McNally et al. (submitted)3109.‐10. Juni 2016 RaMi‐NGS
McNally et al. (submitted)
The core genome alignment (BAPS clusters, BratNextGen analysis), CTX‐M gene type, accessory gene profile cluster (KPax2). (The accessory gene profile phylogeny is colour coded by overlaying the accessory genome profile)
‐multiple circulating clones of E. coli ST131 ‐ each contains a fixed plasmid repertoire ‐ each has undergone clonal expansion and global dissemination
Phylogeny of ST131 (n=228) from various sources
3209.‐10. Juni 2016 RaMi‐NGS
Pandemic ST131 (n=228) from various sources: Recombination
McNally et al. (submitted)3309.‐10. Juni 2016 RaMi‐NGS
34
Robert Koch Institute HistoryTasks and Infrastructure Data and FactsNational Reference and Consultation Laboratory Network
Genomic SurveillanceViral PathogensBacterial Pathogens
Genomic DiagnosticsViral PathogensBacterial Pathogens
Genomic Research Bioinformatics
Outline
09.‐10. Juni 2016 RaMi‐NGS
Use of NGS for clinical microbiology
diagnosticmicrobiology
Identificationof species
Identificationof species
antimicrobialresistance
antimicrobialresistance
presence ofvirulence
determinants
presence ofvirulence
determinants
public healthmicrobiology
detectingoutbreaksdetectingoutbreaks
monitoringtrends in infection
monitoringtrends in infection
Identifying the emergence of new threats
Identifying the emergence of new threats
Major Challenges
• requires major changes in the organization, skill mix and infrastructure of diagnostic laboratories
• strengthening competence in bioinformatics and software development
• Advances are required in databases, efficient software and algorithms for analysis, software that automatically updates knowledge bases and sophisticated links between pathogen genomics databases and patient clinical record systems
3509.‐10. Juni 2016 RaMi‐NGS
E. coli: How big is the Core‐Genome?
• Size of core‐ und pan‐genome depends of the numbers and relatedness of genomes used
• Core‐Genome: Seems to converge at around 1400 gene families
• Pan‐genome: more than 53,000 genes in the Ecore set of 429 strains
• → Each E. coli strain has only ~10% of all E. coli genes!
3609.‐10. Juni 2016 RaMi‐NGS
Finding homologous genes
• Clustering was used to group genes into gene families
• We used usearch/uclust, a fast heuristic clustering , and a clustering threshold of 70% protein sequence identity
• uclust performs a star‐like clustering and calculates only the similarity to one reference sequence for each cluster
3709.‐10. Juni 2016 RaMi‐NGS
Defining the Maximum Common Genome (MCG)
• The MCG is defined as the set ofconserved genes occurring in every ofthe considered genomes
• The size of the MCG changesdepending on the group looked at: The more related the genomes are, the
bigger will be the MCG
• Genes in the MCG don't need to beessential. Essential genes don't need tobe in the MCG, but usually the overlapis quite big
MCG
Genome 1
Genome 2 Genome 3
von Mentzer et al., Nature Genetics (2014)
3809.‐10. Juni 2016 RaMi‐NGS
Assemblies
Read Mapping
Phylogenetic Rooting
Quality Control
ContigA1ContigA2ContigA3ContigA4
Training Contigs
Kuhring et al., BMC Bioinformatics, 2015
Giese et al, Bioinformatics2013
Calvignac‐Spencer et al.,PLoS Currents Outbreaks, 2014
3909.‐10. Juni 2016 RaMi‐NGS
16 April 2014
02 May 2014
16 June 2014Our contribution:RootAnnotator Softwae
12 September 2014• Genome analysis of Ebolavirus from
78 patients in Sierra Leone• Confirmation of phylogenetic
placement based on new data
4009.‐10. Juni 2016 RaMi‐NGS
Our Phylogenetic Analysis
2014
2007
2002
1996
1995
1976
Outbreaklies withinlineage ofprior
outbreaks=> Import
from Central Africa 4109.‐10. Juni 2016 RaMi‐NGS
Strain level quantification
Statistical validation
Characterizing known unknowns
Computational Metagenomics
SimilarityMatrix
ABCD
A B C D ABCD
Lindner & Renard, Nucleic Acids Research, 2013
Lindner et al., PLoS ONE, 2015
Piro et al, Bioinformatics, 2016
4209.‐10. Juni 2016 RaMi‐NGS
Lindner et al. (submitted)
Real‐Time Sequencing
4309.‐10. Juni 2016 RaMi‐NGS
44
Thanks indeed for your attention
© Foto RKI
4409.‐10. Juni 2016 RaMi‐NGS