Clostridium difficile Binary toxin
1) 1) 1) 1)
1) 2) 3)
1) 734-8551 1-2-3 2) 3)

C. difficile Binary toxin 2010 4 2011 3 1 2012 7 2012 12 C. difficile infectionCDI 587 587 18.9% 81.1% 107 toxin toxin A+B+ 60.7%toxin A–B+ 15.0%toxin A–B– 24.3%Binary toxin 1 Binary toxin slpA sequence typing PCR ribotyping slpA sequence type y05-02/PCR ribotype hu13027 C. difficile Binary toxin
PCR

Clostridium difficileC. difficile C. difficile toxin A toxin Btoxin B toxin A 1,000 1 )
toxin A toxin B 1990 toxin A toxin B C. difficile 1 ) 3 Binary toxinactin-specific ADP– ribosyltransferase
C. difficileBI/NAP1/027 BI/NAP1/078 2002 2 )

C. difficile Binary toxin
26 11 14 26 12 16
242 Vol.64 No.2 2015
I
1 1 2010 4 2011 3
1 2 2012 7 2012 12 C. difficile infection
CDI C. difficile toxin toxin 587 2 1
Cycloserine-Cefoxitin-Mannitol Agar CCMA 3648 Rap ID 2toxin
1 toxin TOX A/B QUIK CHEK 2 C.DIFF QUIK CHEK COMPLETE 3
PCR 3 ) 1 mL MacFaland No. 0.51 97 15 13,000 rpm 5 5 μL DNA templete PCR GoTaq Green Master MixPromega 25 μL
Table 1 toxin A NK9-NK11-NKV011tcdA 9520 denature62120
annealing 35 toxin B NK104-NK105tcdB 9520 denature55120 annealing 35
PCR 1.5%
PCR tcdA 1,266 bp tcdB 204 bp
toxin A+B+tcdA 714 bp tcdB 204 bp toxin A–B+tcdA tcdB toxin A–B– 4Binary toxin
Binary toxin cdtcdtApos- cdtArevcdtA cdtBpos-cdtBrevcdtB 9520 denature57120
annealing 35 4 ) cdtA 375 bpcdtB 510 bp Binary toxin
Figure 1Binary toxin SlpA Sequence typing PCR ribotyping
primers
(bp)
tcdB NK104 GTGTAGCAATGAAAGTCCAAGTTTACGC 204 NK105 CACTTAGCTCTTTGATTGCTGCACCT
cdtA cdtApos TGAACCTGGAAAAGGTGATG 375 cdtArev AGGATTATTTACTGGACCATTTG
cdtB cdtBpos CTTAATGCAAGTAAATACTGAG 510 cdtBrev AACGGATCTCTTGCTTCAGTC
Table 1
←510 bp ←375 bp
PCR for Binary toxin genes M: 100 bp ladder1: cdtA(+) cont2: cdtB(+) cont3: cdtA(+) 4: cdtB(+)
Figure 1
II
1 1 2
587 18.9%111 81.1%476 107 toxin Table 2 toxin toxin A+B+ 60.7%65 toxin A–B+ 15.0%16 toxin A–B– 24.3%26 toxin A – B+ 19.8%16/81 2Binary toxin
Binary toxin 1 toxin A+B+Table 2 slpA sequence typing PCR ribotyping slpA sequence type y05-02/PCR ribotype hu13027
III
C. difficile toxin A toxin B toxin A toxin B toxin
CDI 2 C. difficile 75% toxin toxin A+B+ 60.7%toxin A–B+ 15.0% toxin A+B+
toxin A–B+ 1992 toxin A+B+ 1 ) toxin A–B+ 19.8% toxin A+B+ 73.3%toxin A–B+ 13.3%toxin A–B– 13.3% 5 ) toxin A+B+ 48.1%toxin A–B+ 37.0%toxin A–B– 14.8%
n = 107
A+B+
6560.7%
MNZ 1 1
1
VCM 8 VCM 8Binary toxin 1
19 6
1110.3%
5
A–B–
2624.3%
15
Table 2
244 Vol.64 No.2 2015
Binary toxin 1 3.7% 6 ) toxin A+B+ toxin A–B+ toxin A–B+
toxin toxin 7 ), 8 ) toxin 35.8% 64.2%CDI C. difficile 75.7% CDI C. difficile toxin
Binary toxin 1 PCR ribotyping BI/ NAP1/027 BI/NAP1/078 2010 BI/NAP1/027 1 2 ) Binary toxin 6 )
Binary toxin Table 2 VancomycinVCM0.5 g × 3/day R 3 g × 3/day Binary toxin
BI/NAP1/027 toxinotype III pulsed-field gel electrophoresis
PPFG 9 )BI/NAP1/027 outbreak

BI/NAP1/027 BI/NAP1/078 10 ), 11 ) C. difficile Binary toxin
IV
Binary toxin PCR ribotyping BI/NAP1/027 BI/NAP1/078
Binary toxin
slpA sequence typing PCR ribotyping

1) toxinA toxinB Clostridium difficile2003; 31: 666–669.
2) Binary toxin Clostridium difficile 1 2010; 7: 179– 183.
3) Clostridium difficile 2002; 12: 115–122.
4) Stubbs S, et al.: “Production of actin-specific ADP- ribosyltransferase (binary toxin) by strains of Clostridium difficile,” FEMS Microbil Lett, 2000; 86: 307–312.
5) Clostridium difficile C. difficile A/B C.DIFF QUIK COMPLETE 2011; 21: 253–258.
6) Clostridium difficile 2010; 84: 147–152.
7) Clostridium difficile toxin toxin 2012; 108: 1–3.
8) C.DIFF QUIK CHEK COMPLETE 2013; 111: 33–35.
9) Michel W et al.: “Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe,” Lancet, 2005; 366: 1079–1084.
10) Debast SB et al.: “Clostridium difficile PCR ribotype 078 toxinotype V found in diarrhoeal pigs identifical to isolates from affected humans,” Environ Microbiol, 2009; 11: 505–511.
11) Goorhuis A et al.: “Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078,” Clin Infect Dis, 2008; 47: 1162–1170.
Vol.64 No.2 2015 245
Material
Prevalence of Clostridium difficile binary toxin genes in Hiroshima University Hospital
Toshinori HARA 1) Maki FURUSHIMO 1) Makoto ONODERA 1) Yumiko KOBA 1) Rie NAGAOKA 1) Hiroki OHGE 2) Michiya YOKOZAKI 3)
1) Department of Clinical Support, Hiroshima University Hospital (1-2-3, Kasumi, Minami-ku, Hiroshima 734-8551, Japan)
2) Department of Infectious Diseases, Hiroshima University Hospital 3) Division of Clinical Laboratory Medicine, Hiroshima University Hospital
Summary The purpose of this study is to determine the Clostridium difficile toxin genotypes and the prevalence of binary toxin
genes. We investigated 587 stool specimens with suspected CDAD submitted between April 2010 and March 2011 and between July 2012 and December 2012. As a result, of the 587 stool specimens examined by culture, 18.9% were positive and 81.1% were negative for the toxin genes. We examined the toxin type of 107 toxin-gene-positive specimens. The breakdown of toxin genotypes was as follows: 60.7%, toxin A+B+; 15.0%, toxin A−B+; 24.3%, toxin A−B−. In addition, binary-toxin-gene-positive strains were found in one specimen. The binary-toxin-gene-positive strains analyzed by PCR ribotyping and slpA sequence typing were identified as having the slpA sequence type y05-02/PCR ribotype hu13027. In conclusion, epidemiological studies of C. difficile using methods such as culture examination, toxin genotyping, and binary toxin gene analysis are considered to be very important for understanding the current status of the epidemic strains of C. difficile in a region and in individual hospitals.
Key words: Clostridium difficile, Binary toxin-producing gene, PCR ribotyping (Received: November 14, 2014; Accepted: December 16, 2014)
246 Vol.64 No.2 2015